Team:Hong Kong HKU/Results
Results
We tested the various properties of our nanostructure with different in-vitro analytical methods:
| Perspectives | Examination |
|---|---|
| 1) Tetrahedron Assembly | Gel Electrophoresis (PAGE and Agarose) |
| 2) Strand Displacement | Gel Electrophoresis (PAGE and Agarose) PCR clean up Mutant inputs |
| 3) G-quadruplex formation | Gel Electrophoresis (PAGE and Agarose) |
To recall our design, the input will induce a strand displacement, eventually change the oligo 1 in conformation to a G-quardruplex structure.
The G-quardruplex (Gq) will exhibit peroxidase activity in with the incorporation of hemin.
Wile hydrogen peroxide is used as substrate, ABTS is utilized to give out the resulting signal.
Simplified Beacon
It is not difficult to observe a simplified molecular beacon can be assembled Oligo 1 and Oligo 5, in which they possess a complementary region as counterparts.
This region is a functional unit of a YES-Gate, which are the essential components of the tetrahedron structure (see later for more).
We started off with this simplified version of the nanostructure to do several prelimary testings.
One of the testings was to check whether they are able to anneal as a response to the addition of input.
Below shows the results of 12% PAGE for the assembly of the beacon and the addition of the input.
The beacon was made by adding equal quantity of Oligos 1 and 5 in TM Buffer.
It is noted that the formation of complex nanostructures is allowed by a standard procedure of heating it up followed by step-wise cooling.
The detailed protocol regarding Nanostructure Assembly could be found here.
Tetrahedron nanostructure
The tetrahedron nanostructure is much more complex.
It consists of a total of 5 oligos and has a wider range of combinations subjected to investigation.
We have performed 12% PAGE to investigate into the migration of all 31 combinations of the 5 oligos (oligos alone included).
Several combinations of oligos are expected to anneal to form dimers, trimers and quadruplexes:
a) Dimers: O1+O3, O1+O5,
b) Tri-mers:
The results from PAGE were consistent with the list below.
It is quite easy to notice that the assembled tetrahedron stationed at the very top of the gel, meaning that perhaps it might be too large in size that is hard to move along.
A lower arcylamide percentage of the gel might give a signifcantly different result.
With the same tube of tetrahedron sample, we therefore later on performed a 8% PAGE to observe any differences on the migration of the tetrahedron.
From the above PAGE gels, still, it was well observed that the tetrahedron remained at the very top position of the gel. It reflects the diameter of the tetrahedron to be larger than that of the pore sizes of 8% polyacrylamide gels. We proceed to replicate the experiment on an 1% agarose gel. Now, the oligos alone are expected to be dots as they are too small to be resolved well at 1% Agarose.
PAGE and Agarose Gel Electrophoresis
The figure recalls the strand displacement reaction.
Another replication of the identical PAGE experiment with the abive is conducted at 15% arcylamide percentage.
Apart from providing another strong evidence of the successful assembly of the tetrahedral nanostructure (Lane 7 and Lane 10),
it is even more clearer to observe a signifcant difference in the band in Lane 6 (Oligo 5), Lane 8 (Input Oligo) and Lane 9 (Oligo 5 + Input Oligo).
The formation of a larger complex proves a strand displacement to occur when the two oligo meets.
Similar to the assembly protocol, the experiment was replicated on a 1% Agarose gel:
Once again, the bands in Lanes 8 and Lane 9 demostrated a strand displacement.
O1+O5 beacon and others
The following is the result of a 15% PAGE experiements that includes the analysis of the O1+O5 beacon, O1-O4 beacon and the tetrahedron. This gel image provides another promising evidence of the assembly of O1+O5. With reference to Lane 7 and Lane 8, Lane 4 and Lane 10, and Lane 9, it was showed that O5 is necessary for the strand displacement as the input strand binds to and only to Oligo 5 as the speciflied target.
PCR Method
Due to the small size of the output product, or, the dimer between the input strand and Oligo 5 (30 nucleotides long),
we manipulated this as the primers to amplify the template strand.
The template strand was made from 2 complementary single-stranded sequences in the thermocycler,
and was designed in such that both the sense and antisense strands of the output dsDNA can anneal and hence act as primers.
We first run an Agarose Gel electrophoresis against the tetrahedron displacement,
which provides another solid evidence of the strand displacement.
We then extracted the output product from the gel.
Below shows the difference between before and after cutting the 1% Agarose gel for extraction.
The yellow and blue boxes indicate the site where the expected displaced products should be.
We then set the PCR program with the aid of NEB Tm calculator for the anneal temperature to start the PCR run and performed the PAGE with appropriate controls.
We used nanodrop to measure the concentrations of all the tubes that had been in the thermocycler. Each PCR tube contains 2nM of the template strand, as contained components according to the protocol available on the NEB website.
| From Gel Extraction | After PCR | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| OUT | TD1 | TD2 | TD3 | OUT | TD1 | TD2 | TD3 | Control | |
| Nanodrop result (ng/μL) | 7.5 | 8.6 | 4.6 | 5.0 | 396.1 | 398.4 | 391.6 | 403.9 | 1.4 |
Image J analyais of the gel was performed so as to analyze the relative increase to the marker (OUT), which acted as a positive control.
| A | B | C | D | E | |
|---|---|---|---|---|---|
| Output (O5 & input) | + | + | + | + | |
| Template | + | + | + | + | + |
| Peak intensities (arbitrary units) | 1571 | 9835 | 7627 | 7440 | 8024 |
It is clear that the concentration increased and this shows the correct output product via strand displacement.
Mutants
We tested in total 6 mutants, where 3 experienced single-base mutation, each of two experienced double- and triple-base mutation, and one random mutant strand of the same length as out target DNA. We also aspired to try the RNA inputs to test our probe, which proves the application with miRNAs as targets, which are promising biomarkers.
| Sequence | Length | |
|---|---|---|
| DNA Input | CAATCAGGGTCTAACTCCACTGGGTGCCAT | 30 |
| DNA Mutant | CAGGCAGTATCATGCGACATTGGGTGCAGC | 30 |
| RNA Input | CAAUCAGGGUCUAACUCCACUGGGUGCCAU | 30 |
| RNA Mutant | CAGGCAGUAUCAUGCGACAUUGGGUGCAGC | 30 |
We performed PAGE and compared the relative intensities of the output product using ImageJ®. The relative intensities are expected to reflect the rate of strand displacement.
ABTS Assay is one of the methods to test the G-quadruplex (Gq) formation.
While the the upper strand of our nanostructure, Oligo 5, is displaced (shown in the schematic diagram) as the input hybridizes,
the bottom strand, Oligo 1, which contains split Gq sequences quickly folds into a 4-strand structure, in the presence of potassium ions.
When Gq forms a complex with hemin, it exhibits peroxidase activity and functions as a DNAzyme.
It reacts with ABTS or TMB, together with H2O2 and gives out colour change from colorless to green, or to blue for TMB.
We perform ABTS assay on a 96-well plate where triplicates are made possible.
The experimental procedures of the ABTS assay can be found in here.
Absorbance against time
Together with appropriate controls, we first measured the relative absorbance of our nanostructure-hemin complexes,
once the ABTS and H2O2 were added, at 30-seconds intervals.
Fold Change
On the same set of results, we calculated the fold change by manipulating the following formula:
Fold change = absorbance of sample / absorbance of negative control
We then plotted bar charts at a picked time interval (t=9 minutes) of fold change against different components.
A bar chart is blotted to show the formation of G-quadruplex comparing to blank.
From the right bar chart above, since the S.D bars of the sample and the blank did not overlap,
it shows there is a significant difference between the fold changes hence a promising evidence of the Gq formation.
On the same plate, we also did the simplified version (O1+O5) to show the differences between a complete tetrahedral nanostructure and the simplified one.
Bar chart to show different beacons' Gq-formation.
The activity of the simplified O1+O5 beacon is no difference to that of the tetrahedron.
Mutant testing
After showing that there is indeed an increase in absorbance due to the addition of input and hence the formation of G-quadruplex, we went further to test if such change is specific to the sequence of our input by testing mutant inputs. The sequences of different inputs are shown in the table below:
| Input (DNA) | Sequence | Length (nucleotide) |
|---|---|---|
| Specificd Input | CAATCAGGGTCTAACTCCACTGGGTGCCAT | 30 |
| Random mutant | CAGGCAGTATCATGCGACATTGGGTGCAGC |
We carried out ABTS assay again to detect the presence of G-quadruplex as a result of strand displacement by the input. The probe used in this section is a simplified version consisting of only O1+O5, which is the crucial part of our tetrahedral DNA nanostructure. Below are bar charts showing the relative absorbance of the nanostructure with the correct input, mutants and random mutants, together with appropriate controls.
From the above graphs, it can be seen that adding a random mutant results in an absorbance similar to adding no input to our probe, while adding the correct input results in a much higher absorbance. This confirms our hypothesis that only the input that is complementary to the toeholds can lead to strand displacement and the formation of G-quadruplex afterwards.
From the beginning
Series of preliminary testing were carried out at the initial stage of our project. One of them is to obtain the optimal toehold length. In our design, a toehold is a region of unhybridized DNA for the hybridisation of the target by complementary base-pairing and hence the subsequent displacement. We varied the toehold length by adjusting the number of bases complementary to O5 on O1. This gives to 1- versions of O1. If the hybridised region is shorter, a longer toehold will be exposed. We expected that both longer and shorter toeholds would be unfavourable for our target to hybridise to the toehold for the hybridisation between O1 and O5 due to base-pairing between them respectively.
| O1_X | Length (nt) | Length of hybridized region between O1 and O5 (nt) | Toehold length on each end of O5 (nt) |
|---|---|---|---|
| 1 | 30 | 2 | 10 |
| 2 | 32 | 4 | 9 |
| ... | ... | ... | ... |
| 5 | 38 | 10 | 6 |
| ... | ... | ... | ... |
| 10 | 48 | 20 | 1 |
In our design, we expected that after the hybridisation of input to O5 and hence the displacement of O5, O1 will be unhybridized and G-quadruplex will be formed by self-folding. With an optimal toehold length, G-quadruplex would only be formed in the presence of the input and therefore produced the highest signal-to-background ratio. Equimolar input was first added to the O1+O5 duplex in a buffer (50 mM Tris–HCl, 150 mM NH4Cl, 20 mM KCl, and 0.03% Triton X-100, pH 7.5). The formation of G-quadruplex was detected by incubating the reaction mixture with hemin for 30 minutes, followed by the addition of ABTS and H2O2 which turned the solution green. (Details of the experimental procedure can be found here..) After 20 minutes, absorbance at 420nm was measured and was compared to a control with no input added. The result was shown in the following graphs. We expected that both longer and shorter toeholds would be unfavourable therefore a bell-shaped curve.
From the above graphs, it is clear that the fifth version of Oligo 1 was the best among the other versions as it produced the highest signal compared to the background signal. Seeing the strand displacement as a reversible reaction, we performed experiments with various concentration of input to test where there is an effect on the signal generated if the input concentration exceeds that of the tetrahedron. Literature suggested an equal molar ratio. After knowing that our design can distinguish the correct input from mutant inputs, we were interested to know what is the lowest concentration of input that can be detected. As a result, we determined the limit of detection (LOD) of our probe (simplified O1+O5 version) by carrying out ABTS assay. We varied the concentration of input (DNA) and measured their respective absorbance at 420nm. The data and graph of the experiment are shown below.
| [input]/nM | Absorbance at 420nm | ||||
|---|---|---|---|---|---|
| 1 | 2 | 3 | Average | S.D. | |
| 0 | 0.201 | 0.202 | 0.200 | 0.201 | 0.001 |
| 20 | 0.238 | 0.227 | 0.226 | 0.230 | 0.007 |
| 40 | 0.253 | 0.248 | 0.246 | 0.249 | 0.004 |
| 60 | 0.275 | 0.262 | 0.284 | 0.274 | 0.011 |
| 80 | 0.284 | 0.281 | 0.272 | 0.279 | 0.006 |
| 100 | 0.309 | 0.292 | 0.284 | 0.295 | 0.013 |
A regression line y= 0.0009x+0.2089 (R2 = 0.9637) is plotted from the data.
The LOD is calculated by CLOD = 3(sy/x)÷b , where CLOD is the concentration LOD,
sy/x is the standard error of regression and b is the slope of regression line.
First, the standard error of regression is determined.
| X | Y | Y' | Y-Y' | (Y-Y')2 |
|---|---|---|---|---|
| 0 | 0.201 | 0.2089 | -0.00789999999999999 | 0.0000624099999999998 |
| 20 | 0.230333333333333 | 0.2269 | 0.00343333333333301 | 0.0000117877777777756 |
| 40 | 0.249 | 0.2449 | 0.00409999999999999 | 0.0000168099999999999 |
| 60 | 0.273666666666667 | 0.2629 | 0.010766666666667 | 0.000115921111111118 |
| 80 | 0.279 | 0.2809 | -0.00189999999999996 | 0.00000360999999999984 |
| 100 | 0.295 | 0.2989 | -0.00390000000000001 | 0.0000152100000000001 |
| Sum of (Y-Y')2 | 0.000225748888888893 | |||
(Y' is the predicted value from the regression line y = 0.0009x + 0.2089)
Standard error of regression
= 0.0075 nM
Limit of detection
CLOD = 3(sy/x)÷b = 3(0.0075)÷0.0009 = 25.04nM
Plasmids and Parts
| Name (Part number) | Type | Description | Length(bp) | |
|---|---|---|---|---|
| ‽ | BBa_K2054000 | Coding | ALL oligos included in our desired nanostructure | 3641 |
| ‽ | BBa_K2054010 | Coding | Oligo 1 and Oligo 5 beacon | 2641 |
| BBa_K2054001 | Coding | Oligo 1 | 2388 | |
| BBa_K2054002 | Coding | Oligo 2 | 2358 | |
| BBa_K2054003 | Coding | Oligo 3 | 2375 | |
| BBa_K2054004 | Coding | Oligo 4 | 2375 | |
| BBa_K2054005 | Coding | Oligo 5 | 2313 |
The ligated products were then transformed following the protocol available on NEB.
The ligated p_SB1C3 digested with PstI and EcoRI was transform as an negative control, where no colonies were observed on the corresponding plate.
Considerable numbers of colonies were observed on the plates with the plasmid shown above.
It was mini-preped on the following day after another 14-16 hrs of incubation in LB broth.
An 1% agarose gel electrophoresis was performed to show the mini-prep results:
From the above, some appear to have the plasmids of the right size e.g. p_O1 in lane 2, some appear to have possible contaminations e.g. p_O4 in lane 10.
Restriction mapping
Multiple bands were seen in each lane, and this could be due to different configurations of the plasmids which affect the migration through the gel pores.
E.g. in the 2nd lane, the plasmid p_O1 might exist in super-coiled, linearised and circular (nicked circle) configurations which gave rise to the lower, the middle and the upper bands.
The middle band matches the band sizes of the ladder on the left, which is around 2300-2500bp.
Diagram to show the migration of different configurations of plasmid from literature (above) and our plasmid p_O1 (below)
To double check whether the above was the case and whether the mini-preped plasmids are the real deals, an RE digstion with AcuI and BsrBI were performed. This followed the protocol from NEB. Below showed the 1% agarose gel electrophoresis of the digested products.
Colony PCR
Meanwhile, we preformed colony PCR with the 1% agaorse gel electrophoresis to determine the colonies with the right inserts-ligated plasmids.
We have picked 4 colonies for each plate.
The couple of primers used was insert-specific, having the expected band sizes follow:
| Plasmid length (bp) | Insert length (bp) | |
|---|---|---|
| p_O1 | 2388 | 411 |
| p_O2 | 2358 | 381 |
| p_O3 | 2375 | 398 |
| p_O4 | 2375 | 398 |
| p_O5 | 2313 | 336 |
The selected couple of colonies marked were inoculated into LB broth with the appropriate amount of antibiotic Chloramphenicol added, and were incubated overnight at 37C.
Mini-prep was performed on the following day and an 1% gel electrophoresis was performed with appropriate restriction enzymes applied:
