Team:Hong Kong HKU/Experiments
Notebook
Protocol
| Oligo Name | Sequence (5' to 3') |
|---|---|
| O1 (97nt) | CTACTAGCTGCACGACGTAGTGGGTTGGGTCTAACTCCACTGGGTAGGGTCGTCGAGCTCACGTGCGTCACGCGCGATAGTCGA GTGCTGCTGAGTA |
| O2 (67nt) | CTACGAGTGATGACGAGACATGTGACAGTGCACACTATGTGCGCTCATCGCACGATAGCAGACGACG |
| O3 (84nt) | TGACGCACGTGAGCACTGCTATCGTGCGATGAGCGCACATAGACTGACACACGCATGACGCTATCGCAGCACGACTATCGCGCG |
| O4 (84nt) | GTCTCGTCATCACACGTGCAGCTAGTAGTACTCAGCAGCACAGCTGCGATAGCGTCATGCGTGTGTCAGAGTGCACTGTCACAT |
| O5 (30nt) | ATGGCACCCAGTGGAGTTAGACCCTGATTG |
General preparation of Native Polyacrylamide gel (Native PAGE gel)
Specifications
A piece of PAGE Gel (~12mL in volume)
Requiring Materials
| Materials (12% PAGE gel) | Quantity |
|---|---|
| Gel kit | 1 Set |
| Distilled water | 6.0 mL |
| 10X TBE | 1.2 mL |
| 30% Acrylamide (29:1) | 4.8 mL |
| 10% APS | 200 μL |
| TEMED | 200 μL |
Storage
4°C, keep wet in 1x TBE to prevent drying
Steps
1. Clean the glass plates and spacers thoroughly. Rinse the plates withdeionized water and ethanol and set them aside to dry.
2. Assemble the glass plates with spacers in gel caster. Make sure there is no water leakage.
3. Prepare the gel solution according to the desired polyacrylamide percentage. Note the addition of TEMED will immediately trigger the gel to polymerize.
4. Vortex the solution roughly for 5 seconds.
5. Quickly piette the gel solution into the caster. Insert the appropriate comb into the gel, prevent to trap air bubbles under the teeth.
6. Let the polymerization go for 30 minutes at room temperature.
7. Surround the comb and the top of the gel with paper towels that have been soaked in 1x TBE.
Then seal the entire gel in plastic bag and store it at 4°C until needed.
Notes
Different polyacrylamide percentage results in different speed and discrimating ability for sample running down in electrophoresis.
The quantity of the solutions varies with the percentage.
The required quantity of native PAGE gel in common polyacrylamide percentage is listed below.
| Polyacrylamide percentage | Distilled water | 30% Acrylamide (29:1) | 10X TBE | 10% APS | TEMED |
|---|---|---|---|---|---|
| 8% | 7.6 mL | 3.2 mL | 1.2 mL | 200 μL | 10 μL |
| 10% | 6.8 mL | 4.0mL | 1.2 mL | 200 μL | 10 μL |
| 12% | 6.0 mL | 4.8 mL | 1.2 mL | 200 μL | 10 μL |
| 15% | 5.2 mL | 5.6 mL | 1.2 mL | 200 μL | 10 μL |
TBE buffer consists of Tris base, Boric Acid and EDTA.
Usually, a 10X concentration is prepared for making PAGE gels.
For running the electrophoresis, the buffer is further diluted for 10 times to 1X concentration.
For 1L 10X TBE buffer can be prepared as follows:
| Materials | Quantity |
|---|---|
| Distilled water | ~800 mL |
| Tris | 108 g |
| Boric acid | 55 g |
| EDTA | 7.5g |
Remember to stir with a magnetic stirrer until the solution gets clear.
Add up the solution to 1L with distilled water before autoclaving.
Native PAGE
Steps
Load the followings. (DNA ladder: 2μL, DNA sample: 8μL, 1X loading dye: 8μL)
| Lane | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 |
|---|---|---|---|---|---|---|---|---|---|---|
| Gel A | 20 bp DNA ladder | O1.6 | O2 | O3 | O4 | O5 | Input | A1 | A2 | A3 |
| Gel B | 20 bp DNA ladder | A4 | A5 | A6 | A7 | A8 | A9 | A10 | B1 | B2 |
| Gel C | 20 bp DNA ladder | B3 | B4 | B5 | B6 | B7 | B8 | B9 | B10 | 1X Loading buffer |
| Gel D | 20 bp DNA ladder | C1 | C2 | C3 | C4 | C5 | Tetra | Tetra+Input | Output | 1X Loading buffer |
Run the gel at constant voltage at 100V for until the bands of dye reach ¾ of the length of the gel.
Preparation of agarose gel
Specifications
A piece of 1% Agarose gel
Requiring Materials
| Material | Quantity |
|---|---|
| Agarose powder | 1 g |
| 1X TBE | 100mL |
Storage
4°C
Steps
1. Pour 1g agarose powder into microwavable flask along with 100mL of 1xTBE.
2. Put into microwave for 1-3 minute until the agarose is completely dissolved. A nice rolling boil will be observed upon competion.
3. Let agarose solution cool down in room temperature for 5 minutes.
4. Pour the agarose into a gel tray with the well comb in place.
5. Place newly poured gel at 4°C for 10-15 minutes OR let sit at room temperature for 20-30 minutes, until it has completely solidified.
Agarose gel electrophoresis
Requiring Materials
| Material | Quantity |
|---|---|
Steps
1. Cast the gel into position.
2. Fill the gel box with 1X TBE until the gel is covered by the buffer.
3. Load the DNA loading dye to samples.
4. Load the followings.
| Lane 1 | Lane 2 | Lane 3 | Lane 4 | Lane 5 | Lane 6 | Lane 7 | Lane 8 | Lane 9 | Lane 10 | Lane 11 |
|---|---|---|---|---|---|---|---|---|---|---|
| 100bp DNA ladder | DNA ladder (2 log) | O1 (1μM) | O2 (1μM) | O3 (1μM) | O4 (1μM) | O5 (1μM) | Input (1μM) | O5+Input (1μM) | Tetra (1μM) | Tetra+Input |
5. Run the gel at a constant voltage of 100V for 1 hour.
Detecting G-quadruplex
DNA nanostructure (100nM final), nucleic acid input (100nM final) and hemin (400nM) are added to 23μl buffer (50 mM Tris–HCl, 150 mM NH4Cl, 20 mM KCl, and 0.03% Triton X-100, pH 7.5). The mixture is incubated at room temperature for 30 minutes in a shaker. 100μl 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) solution (from Roche CAT ELISA Kit) and 15μl H2O2 (12mM final) are added to the mixture, making the final volume to be 150μl. The reaction mixture is transferred to a 96-well plate and absorbance at 420nm is measured with a microplate spectrophotometer.1. Dilute 1M Tris buffer into 50mM by adding 5mL 1M Tris buffer to 95mL of distilled water.
LB Agar
Specification
A piece of LB Aagar (Antibiotic resistance: Chloramphenicol)
Storage
4°C
| Materials | Quantity |
|---|---|
| Distilled water | ~1 L |
| Agar | 15 g |
| NaCl | 10 g |
| Tryptone | 10 g |
| Yeast Extract | 5 g |
| Chloramphenicol (25 μg/mL) | Small amount |
Steps
1. Mix thoroughly the above (except the antibodic) with 1L of distilled water.
2. Autoclave at 121°C for 15 minutes.
3. Let the agar to cool down to 55°C in room condition.
4. Add at a concentration 25ug/mL of chloramphenicol to the cooled agar.
5. Aseptically, pour ~20mL LB agar per 10cm polystyrene Petri dish for the plates to growth E. coli DH10B.
6. Cover with lid and allow the plates to cool for 30-60 minutes at room temperature, or until set.
7. Label the bottom of plates as with antibiotic resistance 'CmR' and store it plastic bags at 4°C.
8. For those with colonies, seal them with parafilm and store them separately at 4°C.
