Team:Hong Kong HKU/Experiments

Notebook

Protocol

Equal amounts of oligonucleotides are mixed in TM buffer (20 mM Tris, 50mM MgCl2, pH 8), making the final concentration of each oligo to be 10μM. The oligos are incubated at 95℃ for 5 minutes and cooled down to 25℃ with a drop of 0.5℃ every 30 seconds in a thermal cycler. The following table shows the sequence of our tetrahedral DNA nanostructure.

Oligo Name Sequence (5' to 3')
O1 (97nt) CTACTAGCTGCACGACGTAGTGGGTTGGGTCTAACTCCACTGGGTAGGGTCGTCGAGCTCACGTGCGTCACGCGCGATAGTCGA
GTGCTGCTGAGTA
O2 (67nt) CTACGAGTGATGACGAGACATGTGACAGTGCACACTATGTGCGCTCATCGCACGATAGCAGACGACG
O3 (84nt) TGACGCACGTGAGCACTGCTATCGTGCGATGAGCGCACATAGACTGACACACGCATGACGCTATCGCAGCACGACTATCGCGCG
O4 (84nt) GTCTCGTCATCACACGTGCAGCTAGTAGTACTCAGCAGCACAGCTGCGATAGCGTCATGCGTGTGTCAGAGTGCACTGTCACAT
O5 (30nt) ATGGCACCCAGTGGAGTTAGACCCTGATTG
The assembly of DNA nanostructure is analysed by 12% PAGE where the combinations of oligos (5μl, 10μM) are loaded. For analysis by 1% agarose gel, 10μl samples (10μM) are loaded. All the gels are run at a constant voltage of 100V. GelRed is used to prestained the gels.

For the analysis of strand displacement, equimolar (10μM final) DNA nanostructure and nucleic acid input are mixed and incubate at room temperature for 30 minutes in a shaker. The mixture (5μl, 10μM) is then loaded to 12% polyacrylamide gel. The gel is run at a constant voltage of 100V. GelRed is used to prestained the gel.

Detecting G-quadruplex

DNA nanostructure (100nM final), nucleic acid input (100nM final) and hemin (400nM) are added to 23μl buffer (50 mM Tris–HCl, 150 mM NH4Cl, 20 mM KCl, and 0.03% Triton X-100, pH 7.5). The mixture is incubated at room temperature for 30 minutes in a shaker. 100μl 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) solution (from Roche CAT ELISA Kit) and 15μl H2O2 (12mM final) are added to the mixture, making the final volume to be 150μl. The reaction mixture is transferred to a 96-well plate and absorbance at 420nm is measured with a microplate spectrophotometer.

LB Agar


Specification
A piece of LB Aagar (Antibiotic resistance: Chloramphenicol)
Storage
4°C

Materials Quantity
Distilled water ~1 L
Agar 15 g
NaCl 10 g
Tryptone 10 g
Yeast Extract 5 g
Chloramphenicol (25 μg/mL) Small amount


Steps
1. Mix thoroughly the above (except the antibodic) with 1L of distilled water.
2. Autoclave at 121°C for 15 minutes.
3. Let the agar to cool down to 55°C in room condition.
4. Add at a concentration 25ug/mL of chloramphenicol to the cooled agar.
5. Aseptically, pour ~20mL LB agar per 10cm polystyrene Petri dish for the plates to growth E. coli DH10B.
6. Cover with lid and allow the plates to cool for 30-60 minutes at room temperature, or until set.
7. Label the bottom of plates as with antibiotic resistance 'CmR' and store it plastic bags at 4°C.
8. For those with colonies, seal them with parafilm and store them separately at 4°C.


Copyright © 2016 HKU iGEM. All rights reserved.