Team:Duke/Notebook

Lab Maintenance

Made with Benchling

Project: Duke iGEM 2016

Authors: Nisakorn Valyasevi

Dates: 2016-05-18 to 2016-08-27

Wednesday, 5/18/16

Made 2 L of LB Broth

LB Broth/Media Protocol

Autoclaved for 30 min. -- One liter was made between two sealable 1 L bottles (each filled with 500 mL of media)

Made 1 L of LB Agar and LB Agar + KAN Plates

LB Agar Plates

Autoclaved for 30 min.

Made 1 L of 10% Glycerol and 500 mL of 50% Glycerol

Glycerol Stocks

Autoclaved for 30 min.

Made Kanamycin Stock

Antibiotic Stocks

Used 350 mg of Kanamycin to make a 1000X stock of 35 ug/mL

Aliquoted into 1 mL epi tubes.

Notes:

●

Shaker ("Max-Q 4000") set to 38; thermometer reads 33.2

Friday, 5/20/16

Made Ampicillin and Chloramphenicol Stocks (Nisa; Thomas)

Antibiotic Stocks

Made 7 mL of 200 mg/mL of Ampicillin

Made ~7 mL of 25 mg/mL of Chloramphenicol

Made KAN and CM Plates (Ben; Emma)

50 KAN plates

35 CM plates

LB Agar Plates

Made Gels

Gels

Made 3 gels

Tuesday, 5/24/16

Preparation of E. cloni Comp Cells (Parth; Nisa)

Electrocompetent Cells

Left culture overnight; did not check OD

Washed with glycerol 6 times

Forgot to do the final spin down and resuspension of equal volume of glycerol (these steps were not written in the protocol at the time, protocol has been updated)

Aliquoted 50 uL into 1.7 mL epi tubes

Made Gels

Made 2 more gels; wrapped in cling wrap and stored in 4 C fridge

Gels

Wednesday, 5/25/16

Made Gels

Gels

Made 3 gels

Wednesday, 6/1/16

Made KAN Plates

Stored most of KAN plates in bag in 4 C fridge -- the rest stored at room temp on shelf

Made 1 L of Agar for plates - all plates were KAN plate

LB Agar Plates

Thursday, 6/2/16

Made Gels

2 Gels were made

Gels

Autoclaved Tips and Glassware

Autoclaved 10 boxes of 200 tips and 5 boxes of 10 tips on gravity cycle

Autoclaved beakers and flasks

Made 20% Glycerol Stocks

Glycerol Stocks

40 mL of 100% Glycerol was added to 160 mL pH2O

Freezer Purge

The freezer stocks were gone through and all negative sequence stocks were discarded.

Friday, 6/3/16

Made Gels

Made 2 new gels and left in fridge for weekend

Gels

Sunday, 6/5/16

Gels for PCR (Jaydeep)

Made 4 gels, 200mL total

Gels

Monday, 6/6/16

Gels for PCR (Ben; Jaydeep)

Made 4 gels, 200mL tot

Gels

Tuesday, 6/7/16

Made KAN Plates (Nisa; Parth; Thomas)

Made 52 KAN plates

LB Agar Plates

Monday, 6/13/16

Made LB +KAN

LB Broth/Media Protocol

Made 4 bottles (250mL) of 125 mL aliquots of LB+KAN broth

Used 1/8 of the LB media recipe in each bottle (0.625 g of Salt and Yeast and 1.25 g of tryptone)

The old stocks had been contaminated

Used smaller bottles and smaller aliquots to limit contamination

Made Aliquots of Commonly Used Materials

Made conical tube aliquots (~50 mL) of 10%, 20%, and 50% Glycerol as well as pico water.

Made aliquots to help limit contamination and to clean up bench space.

Tuesday, 6/14/16

Made CM Plates

Made 0.5 L of CM Plates - 23 plates

LB Agar Plates

Made CM LB Stock

Made 0.5 L of LB Broth + CM

LB Broth/Media Protocol

Autoclaved Glassware

New half liter and liter bottles came in. All were autoclaved.

Made KAN Stock

Made KAN Stocks using 40 ng/ul.

Antibiotic Stocks

Wednesday, 6/15/16

Made E-cloni Stocks

Took old plate and inoculated two 50 mL LB flasks.

The plate had several infections

Took a long time to grow - suspicious

Decided to discard

Made new E-cloni Plate

Because the old plate had several infections, a chip of stock Ecloni was plated onto a new plate and grown overnight

Thursday, 6/16/16

Made E-cloni Stocks

Inoculated two flasks of 50 mL LB

Let grow

Friday, 6/17/16

Comp Cells were made

Electrocompetent Cells

Not yet tested

End of Week Check

Made more 70% ethanol

Made sure pipette tips were everywhere

Cleaned all counters

Tuesday, 6/21

Made CM and KAN plates

Made one liter of CM and one liter of KAN agar.

The plates set out for two hours and were still not set up - they were left overnight but were still not set in the morning.

All of the plates were discarded.

Wednesday, 6/22

Made CM and KAN plates

Made one liter of CM and one liter of KAN agar.

Stored in the 4C fridge

Thursday, 6/23

Made DLF-00286 Competent Cells

Total of 29 aliquots of 50 uL were stored in the -80°C freezer

Wednesday, 6/29

Autoclaved Epi Tubes and washed glassware.

Thursday, 6/30

Autoclaved glassware and biohazard trash.

Made Electrocompetent Cells (E cloni)

●

9 aliquots were made

Friday, 7/1

Made and autoclaved 1 L LB broth: transferred to autoclaved jar.

Wednesday, 7/6

Made Electrocompetent Cells (E cloni)

●

25 aliquots were made

Saturday, 8/27

Made Electrocompetent Cells (286 - J, R)

●

36 aliquots were made

LB Broth/Media Protocol

Introduction

LB Broth or Media is used to grow cells. Throughout the iGem Project, we used a low salt media because ...... The recipe below is for 1 L of Broth

Materials

• 10 g Tryptone
• 5 g Yeast Extract
• 5 g Sodium Chloride (NaCl or salt)
  • for a high salt media use 10 g of Sodium Chloride
• Deionized Water

Procedure

• Make Broth

1. In a 2000 mL Erlenmeyer flask mix the tryptone, yeast extract, sodium chloride.

2. Use a graduated cylinder to measure out 1 L of deionized water

3. Add the water to the flask and mix well

4. Autoclave on a liquid cycle for 15 min

• Make sure to add water or ice to the bucket before autoclaving.

LB Agar Plates

Introduction

This is a recipe for 1 L of LB for plates that are a low salt LB

Materials

• 15 g Agar
• 10 g Tryptone
• 5 g Yeast Extract
• 5 g Sodium Chloride
  • For a high salt agar, use 10 g of Sodium Chloride
• Deionized Water

Procedure

• Media

1. In a 2000 mL Erlenmeyer Flask, add the agar, tryptone, yeast extract, and sodium chloride.

2. In a graduated cylinder, measure out 1000 mL of deionized water.

3. Add it to the flask and mix.

4. Autoclave on a liquid cycle for 15 min

• Make sure to add water or ice to the bin before autoclaving.

• KAN (Kanamycin) Plates

5. Once out of the autoclave, allow media to cool.

6. Add as many uL of KAN 1000X Stock as there is mL of media

• For a 1 L media batch, add 1 mL of KAN 1000X stock.

7. Mix the flask well.

8. Pour plates.

• Make sure the cover the entire bottom of the plate and remove as many bubbles as possible.

• CM (Chloramphenicol) Plates

9. Once media is out of the autoclave, allow it to cool.

10. Add as many uL of CM 1000X Stock as there is mL of media

• For a 1 L media batch, add 1 mL of CM 1000X stock.

11. Mix the flask well.

12. Pour plates.

• Make sure the cover the entire bottom of the plate and remove as many bubbles as possible.

• AMP (Ampicillin) Plates

13. Once media is out of the autoclave, allow it to cool.

14. Add as many uL of AMP 1000X Stock as there is mL of media

• For a 1 L media batch, add 1 mL of AMP 1000X stock.

15. Mix the flask well.

16. Pour plates.

• Make sure the cover the entire bottom of the plate and remove as many bubbles as possible.

Glycerol Stocks

Introduction

Three concentrations of glycerol stocks.

Materials

• Glycerol
• pico Water
  • Autoclaved deionized water

Procedure

• 10% Glycerol Stock

1. Add 50 mL of 100% glycerol to liter bottle

2. Fill bottle to 500 mL with pH2O

3. Autoclave on liquid cycle for 15 min

4. Store at room temp

• 50% Glycerol Stock

5. Add 250 mL of 100% glycerol to liter bottle

6. Fill bottle to 500 mL with pH2O

7. Autoclave on liquid cycle for 15 min

8. Store at room temp

• Made 20% Glycerol Stocks

9. Add 40 mL of 100% Glycerol to a 500 mL bottle

10. Add 160 mL of pH2O.

11. Autoclave on liquid cycle for 15 min.

12. Store at room temp

Antibiotic Stocks

Introduction

Three kinds of antibiotic stocks (1000x). These recipes make 1000X stocks that follow the recommendations for plates.

Materials

• Antibiotic Powder
  • Stored in -20 C freezer
• Pico Water

Procedure

• Kanamycin Stocks (10 mL)

1. Use 10 mL of pico water (autoclaved dH2O)

2. Add 500 mg of Kanamycin powder (-20 C freezer)

3. Mix well

4. Filter [using antibiotic filters and syringes (in drawer underneath middle bench)] into aliquots of 1 ml epi tubes

5. Store aliquots labeled with concentration (1000x), date, and KAN in -20 C freezer

• Ampicillin Stock (10 mL)

6. Use 10 mL of pico water (autoclaved dH2O)

7. Add 1 g of Ampicillin powder (-20 C freezer)

8. Mix well

9. Filter using antibiotic filters into 1 mL aliquots (epi tubes)

10. Store aliquots labeled with concentration (1000x), date, and AMP in -20 C freezer

• Chloramphenicol Stock (10 mL)

11. Use 10 mL of ethanol

12. Add 250 mg of Chloramphenicol  powder (-20 C freezer)

13. Mix well

14. Filter using antibiotic filters into 1 mL aliquots (epi tubes)

15. Store aliquots labeled with concentration (1000x), date, and CM in -20 C freezer

Creating Parts

Made with Benchling

Project: Duke iGEM 2016

Authors: Jaydeep Sambangi

Dates: 2016-05-18 to 2016-07-28

Wednesday, 5/18/16

iCultures Grown:

●

pSMART-yibDp-GFPuv

○

"GFP" or "yib"

●

pSMART-EV

○

"pSMART" or "PSM"

●

DLF-00286

○

"286"

●

E-cloni

Results:

(5/19) All 8 Cultures grew successfully

Notes:

Taxol_G-Blocks.docx

Thursday, 5/19/16

Miniprep pSMART and yib

Used a 30 mL elution

Tested the concentration using UV/Absorbance and found that at 280 nm, the tib had an absorbance of 0.006 and at 260 nm it had an absorbance of 0.019. Using the ratio of Abs 1= 50 ug/mL this leads to the tib miniprep resulting in DNA of a concentration 95 ug/mL. The pSMART had an absorbance of 0.0037 at 260 nm and an absorbance of 0.025 at 280 nm. the ratio of 260:280 of 1.48. This leads to a concentration of 135 ug/mL.

Protocols:

●

Miniprep Protocol NEB

●

Testing Miniprep Concentration

Gibsons

Performed Gibson Assemblies on:

●

BadA (Nisa)

●

PAM (Thomas)

●

TAT (Parth)

●

TBT (Adam)

●

BAPT (Adam)

●

TAX10 (Emma)

●

DBAT (Ben)

●

TycA (Parth)

Used recipes below

GibsonPlan_-_Bootcamp_20160519.jpg

Protocol:

●

Gibson Protocol

Prepared Electrocompetent Cells (50 mL) of DLF-00286 and E-cloni

No changes from protocol

Protocol:

●

Electrocompetent Cells Protocol

Made Freezer Stocks

4 stocks were made of each strain for now; 4 stocks were made as a back up

Used 50% instead of 20% Glycerol

4 Strains were:

●

yib

●

pSMART

●

286

●

Ecloni

Protocol:

●

Freezer Stock Protocol

Transformations of Gibsons

Used electroporation to transform gibsons into competent cells.

Protocol:

●

Electroporation Protocol

Used 50 uL of Competent Cells and 1 uL of DNA

Plated the transformations after a one hour recovery.

Results:

(5/20)

[Name], [10uL colony #], [200uL colony #]

○

badA, 1, 6

○

PAM, 0, 0

○

TAT, 0, 28

○

TBT, 0, 0

○

BAPT, 23, Lots

○

TAX10, 2, 20

○

DBAT, 4, 55

○

TycA, 0, 0

○

Control, 0

●

Calculating Efficiency

CFU/ug = [(Colony #)* (Dilution)*(1000 ng/ug)] / X (ng/L) = 4.4✕107 CFU/ug for E-cloni

○

CFU = “Colony Forming Unit”

Notes:

Possible Projects include:

●

Cloning hydroxylase enzymes (x7)

●

Fermenting Taxadiene (cannot buy)

●

Clone 10 genes in Taxol pathway, map how it works (currently unknown)

●

Enzyme Engineering - improve enzymes

●

NEB videos

●

Computation for CRISPR

●

Take pictures to document summer work

●

Educational Outreach

Friday, 5/20/16

Colony PCR (Emma; Thomas; Adam; Nisa; Parth)

Protocol:

●

Colony PCR Protocol

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	27
3	MM	12.5	337.5
4	SL1	0.25	6.75
5	SR2	0.25	6.75
6	H2O	12	324

Table1

Ran Gel on Colony PCR

No samples worked

Only GFP and pSMART had bands present

Monday, 5/23/16

Gibson Assembly

Performed the Gibson again with a new recipe - less vector and more water (ran out of vector)

Used 1 uL of vector; 5 uL of mix, and 1.5 uL of inserts

Gibson_Plan_for_5_23_.jpg

Transformations of Gibsons

Used 3 uL of DNA; 20 uL of Comp Cells

Recovered for 2-3 hours

All samples electroporated for 654 ms at around 1600 V

Plated Transformation

PAM_Transformed_5_23_2016.JPG

TAT_Transformed_5_23_2016.JPG

TAX10_Transformed_5_23_2016.JPG

TBT_Transformed_5_23_2016.JPG

TycA_Transformed_5_23_2016.JPG

BAPT_Transformed_5_23_2016.JPG

DBAT_Transformed_5_23_2016.JPG

BadA did not grow any colonies

Colony PCR of Old Plates

Plates from 5/20/2016

Protocol:

●

Colony PCR Protocol

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	16
3	MM	12.5	200
4	SL1	0.25	10
5	SR2	0.25	10
6	H2O	12	200

Table2

Inoculation of E. cloni (Parth; Nisa)

Inoculated a colony of E. cloni in 35 uL of LB broth

Tuesday, 5/24/16

Ran Gels on 5/19 Gibsons

8 ul of ladder; 2 ul of DNA stain; 10 ul of DNA; 160 V for 20 min

524_PCR_Colony_Screening_Gel.jpeg

1: Ladder 2: Positive Control 3: Negative Control 4: tycA 5: DBAT 6: TAX10 7: BAPT 8: Ladder 9: TBT 10: TAT 11: PAM 12: BadA 13: Empty

There were no discernible bands; results do not align with expected transformation success

Cause is unknown as there were numerous colonies on plate but no inserts detectd

Because the mini prepped positive control clearly worked, hypothesis is that the econoTaq master mix is not successfully breaking down the cells to allow the DNA inside the nucleus to replicate.

Colony PCR of Gibsons from 5/23 (Ben; Emma)

8 colonies were celected from each plate except BadA

Made LB tubes with 50 mL of KAN + LB

Protocol:

●

Colony PCR Protocol

Transformation of badA into Comp Cells

Used badA Gibson from 5/23 and E. cloni from 5/24

Separated Gibson into three different transformations (T1, T2, and T3)

Recovered for 3 hours before plating onto KAN plates

Left overnight in incubator at 37 C

Electroporation Results:

●

T1: 250 V; 654 ms

●

T2: 1690 V; 654 ms

●

T3: 660 V; 654 ms

Wednesday, 5/25/16

Ran Gels for Colony PCR from 5/24

Protocol:

●

Gels

Used 10 uL of DNA instead of 5 uL of H20 and 5 uL of DNA

The Controls were diluted with 7uL of H2O in order to have enough to use in every gel (there was only 25 uL available after the PCR). The controls were also diluted by H2O in each well (5 uL of DNA and 5 uL of H2O). Controls were yibDp-GFP (+) and pSmart, no insert (-)

Two sets of three Gels ran for 35 min at 160 V

Note: Controls seemed to be the flipped version of what was expected. Assumed that controls were mislabeled

05252016_Angelica1.jpg

1: Ladder 2: Negative Control 3: Positive Control 4-11: PAM 1-8 12-13: BAPT 3-4

05252016_Brandon1.jpg

1: Ladder 2: Positive Control 3: Negative Control 4-11: DBAT 1-8 12-13: BAPT 1-2 *DBAT 2 (well 5) was a poor band length; less sample was added

05252016_Suzie1.jpg

1: Ladder 2: Positive Control 3: Negative Control 4-11: TAT 1-8 12-13: BAPT 5-6 *TAT 3-6 (wells 6-9) had bands too small

05252016_Angelica2.jpg

1: Ladder 2: Negative Control 3: Positive Control 4-11: TBT 1-8 12-13: BAPT 7-8

05252016_Brandon2.jpg

1: Ladder 2: Negative Control 3-10: TAX10 1-8

05252016_Suzie2.jpg

1: Ladder 2: Negative Control 3-10: TycA 1-8

DNA PCR (Emma; Thomas)

Goal: To determine if the Gibsons worked; Is the Colony PCR lysing the cells enough?

Used Colony PCR protocol but added 1 uL of DNA instead of 1 colony

For BadA, 2 uL of dH2O was added to the gibson and the entire volume added to the PCR tube

Protocol:

●

Colony PCR Protocol

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	10
3	MM	12.5	125
4	SL1	0.25	2.5
5	SR2	0.25	2.5
6	H2O	12	120

Table3

Ran Gel

05252016_PCRAmplificationofGibsonReactions.jpeg

1: Ladder 2: pSMART 3: badA 4: PAM 5: TAT 6: TBT 7: Empty 8: BAPT 9: TAX10 10: DBAT 11: TycA 12-13: Empty

No insert bands appeared

Suspected that the yib and pSMART labels were switched as the control was a pSMART and not the intended yib; labeling has been changed on tubes and on the picture.

Thursday, 5/26/16

Econo Taq PCR (Ben)

Goal: Test YibDp and pSmart in freezer to see if they are mislabeled; Is there a better Master Mix Recipe?

Protocol:

●

Colony PCR Protocol

Two Master Mixes were made

●

MM1 used the protocol given us by Charlie (0.25uL of each primer).

●

MM2 used the protocol Adam remembers (1.25uL of each primer in each tube).

The YibDp and the pSmart in the freezer were run on the PCR machine under each of these MM conditions. The mixes are given below:

●

Added  25uL EconoTaq / .5uL SL1 / .5uL SR2 / 24uL pH2O to Master Mix 1. 23uL of this was added to two tubes. 1.5uL DNA added after.

○

Each Reaction: 12.5uL EconoTaq / .25uL each primer / 12uL pH2O / Total = 25uL - 2uL to account for potential pipetting error

●

Added 25uL EconoTaq / 2.5uL SL1 / 2.5uL SR2 / 20uL pH2O to Master Mix 2. 23uL of this was added to two tubes. 1.5uL DNA added after.

○

Each Reaction: 12.5uL EconoTaq / 1.25uL each primer / 10uL pH2O / Total = 25uL - 2uL to account for potential pipetting error.

●

These were run on the same PCR protocol as yesterday. (98C for 5min, then cycle x35: (98C for 30s) / (50C for 30s) / (72C for 3min)

Note: 3min is overkill… Whoops; specifically, the increased extension time is unnecessary due to our insert being ~1kb

The PCR was then ran on a gel

Expectation:

○

1kb band in both yibDp-GFPs, garbage in pSmart (since there is no insert)

○

If the results of the samples seem flipped, then the minipreps of the samples located in the fridge have their labels swapped

○

If the samples with 1.25 μL of primer are clearer, then the PCR protocol will be updated with this improvement

05/26/2016 psmart vs yibd.jpeg

1: Ladder 2: yibDp-GFP * 3: pSMART * 4: Empty 5: yibDp-GFP ** 6: pSMART ** *0.25 uL of primer ** 1.25 uL of primer

The bands indicate that the minipreps had their labels swapped.

PCR machine is proven effective at doing PCR.

0.25 uL of primer is adequate for good PCR results.

Inoculations (Ben)

The following culture samples were inoculated from single colony plates (2 colonies per plate) into 5mL of LB+Kan. The numbers were marked with the corresponding colonies on the plates:

●

BAPT-1

●

BAPT-2

●

DBAT-1

●

DBAT-2

●

TAT-1

●

TAT-2

●

TycA-1

●

TycA-2

●

PAM-1

●

PAM-2

●

TBT-1

●

TBT-2

●

BadA-1

●

BadA-2

●

TAX10-1

●

TAX10-2

5/27 All cultures grew except for BadA-1

Friday, 5/27/16

Freezer Stocks/Miniprep/Concentration Check of Inoculations

Protocols:

●

Freezer Stocks Protocol

●

Miniprep Protocol NEB

●

Testing Miniprep Concentrations

Freezer Stock Edit: Used 500 uL of glycerol and culture instead of 750 uL. Stocks were created for each inoculation from 5/26.

Miniprep Edit: Used a 50 uL elution.

	A	B	C	D	E	F	G	H	I
1	Sample:	PAM-1	PAM-2	DBAT-1	DBAT-2	TBT-1	TBT-2	TAX10-1	TAX10-2
2	ng/uL:	11	300	88	94	57	175	89	96
3	Sample:	BAPT-1	BAPT-2	TycA-1	TycA-2	BadA-1	BadA-2	TAT-1	TAT-2
4	ng/uL:	101	63	11	48	5	146	59	119

Table4

PCR Mini prepped DNA

Used a colony PCR protocol

Protocol:

●

Colony PCR Protocol

Due to concentration results and limited quantity of Econo Taq, PAM-1, TycA-1, and BadA-1 were not run

Used 0.28 uL of each primer instead of 0.25 uL

Used 1 ng/uL dilutions of the mini prepped DNA

Dilutions were made is small epi tubes and stored in the -20 C freezer

Gel was run on the PCR Results

Protocol:

●

Gels

5-27-16_Angelica (1).jpg

1: Ladder 2: BadA-2 3: PAM-2 4: TAT-1 5: TAT-2 6: TBT-1 7: TBT-2 8: BAPT-1 8.5: Yib-pD

5-27-16_Brandon (1).jpg

1: Ladder 2: Yib-pD 3: BAPT-2 4: TAX10-1 5: TAX10-2 6: DBAT-1 7: DBAT-2 8: TycA-2

Only TBT-2 showed the expected band size

Sequencing

Total of 16.5 uL of DNA/dilution in each sample tube

Screen Shot 2016-06-05 at 2.11.57 PM.png

5/28: Only TBT-2 and PAM-2 showed positive on the sequencing

Tuesday, 5/31/16

Colony PCR of 5/23 Transformations

Goal: To use probability to find colonies with inserts for those inserts that came back with an empty vector from sequencing

Protocol:

●

Colony PCR Protocol

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	100
3	MM	12.5	1250
4	SL1	0.25	25
5	SR2	0.25	25
6	H2O	12	1200

Table5

Ran:

●

PAM Colony and Miniprep

●

TBT Miniprep

●

BAPT 20 colonies

●

TAX10 20 colonies

●

DBAT 20 colonies

●

TAT 14 colonies

●

BadA 14 colonies

●

pSMART 1 sample

●

GFP 1 sample

●

ProD 2 colonies

Used an elongation of 3.5 min

For Gel:

Used a 100 well gell mold

Used 450 mL of agarose; 45 uL of dye

Protocol:

●

Gels

Ran Gels:

Used 10 uL of DNA from PCR; 2 uL of dye

Ran for 35 min at 160 V

During loading, the pipette tips continuously retained some of sample or fell off

5:31:16 Big Bertha Row 1.jpg

1: Pro D 2: Pro D 3: PAM Colony 4: PAM Mini prep 5: TBT Mini prep 6: GFP 7: PSM 8: Ladder 9-29: BAPT 1-20 30: Ladder 31-50: TAX10 1-20

5/31/2016 Big Bertha Row 2.jpg

1-14: TAT 1-14 15: Ladder 16-35: DBAT 1-20 36: Ladder 37-50: BadA 1-14

Only the TBT miniprep, PAM miniprep, TAT colony 9, and TAT colony 10 showed the expected band sizes.

Made dilution of sequence confirmed PAM and TBT

Diluted samples to 50 ng/uL

●

For TBT Dilution, used 5.7 uL of DNA with 14.3 uL of pico H2O

●

For PAM Dilution, used 3.3 uL of DNA with 16.7 uL of pico H2O

Inoculation of ProD Cultures

Picked 2 colonies from proD plate (proD-1 and proD-2)

Inoculated in 10 mL of LB+KAN

Also Inoculated TAT 9, TAT 10, DBAT 16, DBAT 18, and DBAT 20.

Transformations of TBT and TycA

Protocol:

●

Electroporation Protocol

TBT was transformed into two cultures

●

TBT 1 - 1710 V 3.9 ms

●

TBT 2 - 1710 V 4.0 ms

TycA was transformed into one culture

●

TycA - 1580 V 654 ms

Recovered for 3 hours

3 uL of DNA and 20 uL of Comp Cells was used

Wednesday, 6/1/16

Freezer Stocks of 5/31 Inoculations

Protocol:

●

Freezer Stock Protocol

Used 500 uL of glycerol and culture instead of 750 uL

Created stocks of

●

TAT 9

●

TAT 10

●

DBAT 16

●

DBAT 18

●

DBAT 20

Double Colony PCR

Mike’s method of smearing things on the side of the PCR tube before pipetting into the tube was used for all big colonies. The smaller colonies were dipped into the master mix.

●

200uL pipette tips were used to pick and smear the colonies.

●

Experimental setup:

○

8 colonies from: TAX10, BAPT, BadA

■

2 of each colony, half tested on PCR machine in Teer basement lab and half in Lynch lab. Results will be compared later.

○

4 controls: PAM-2 Colony, PAM-2 Miniprep, GFP Miniprep, pSmart Miniprep in both lab tests

○

72 total reactions, made 74 Master mix according to the following:

■

1x // 74x

■

12.5 uL Econo // 925 uL

■

.25 uL SL1 // 18.5 uL

■

.25 uL SR2 // 18.5 uL

■

12 uL H2O // 888 uL

■

25 uL total // 1850 uL

■

NOTE: WE WERE 7 REACTIONS SHORT. PIPETTES NEED CALIBRATION

○

Protocol used in Teer basement:

■

Start: 98C for 10 min.

■

Cycle (x40)

●

Melt 98C for 45s

●

Anneal 50C for 45s

●

Extend 72C for 3m 30s

○

Time = (1 min / kbase)*length(longest amplificant)

○

Time = 1min/kbase * length(longest amplificant)

■

4C for inf

Colony PCR

Ran Gel on PCR in both Teer and in Lynch Labs

6-1-16_Angelica.jpg

1: Ladder 2: GFP 3: PAM - Mini prep 4: PAM Colony 5: pSMART 6-13: BadA A-H

6-1-16_Brandon.jpg

1:Ladder 2-9: TAX10 A-H 10-13: BadA A-D

6-1-16_Suzie.jpg

1: Ladder 2-9: BAPT A-H 10-13: BadA E-H

6-1-16_Gel1.jpg

1: Ladder 2-5: BAPT A-D 6: Empty 7: PAM Miniprep 8: PAM Colony

6-1-16_Gel2.jpg

1: Ladder 2-5: BAPT E-H 6: pSMART 7: GFP 8: Empty

6-1-16_Gel3.jpg

1: Ladder 2-3: TAX10 G-H 4-11: BadA A-H

6-1-16_Gel4.jpg

1: Ladder 2-9: BadA A-H 10-15: TAX10 A-F

In the Teer Gels Positive Resutls included:

●

TAX10- (A,B,D,E,G,H)

●

BAPT- (B, D, E, G, H)

●

badA- (A, B, C, D, F, G, H)

Inoculation of Positive Colonies

Colonies denoted in red in the above results were inoculated in 5 mL of LB + KAN and left in the shaker over night

Mini prep/Concentration Check of Successful Transformations from 5/31 (Nisa; Thomas)

Protocols:

●

Miniprep Protocol Zyppy

●

Testing Miniprep Concentrations

Miniprep Edit: Used 50 uL elution

	A	B	C	D	E	F
1	Sample	TAT-9	TAT-10	DBAT-16	DBAT-18	DBAT-20
2	ng/uL (Concentration)	121	80	117	72	55

Table6

Thursday, 6/2/16

Colony PCR on TycA Plate (Emma; Ben)

Protocol:

●

Colony PCR Protocol

Duplicate NOT run in Lynch Lab

Used an elongation of 4.5 min

Smeared 10 colonies using Mike's method

Ran a Gel

6-2-2016 Angelica (TycA).jpg

1: Ladder 2: GFP 3: PAM Mini prep 4: PAM Colony 5: pSMART 6-9: TycA 1-4 10: Spillage from TycA 4

6-2-2016 Brandon (TycA).jpg

1: Ladder 2: GFP 3: PAM Colony 4-5: TycA 9-10 6: Empty 7-10: TycA 5-8

Due to Gel results, TycA Samples 1-6, 9, and 10 were chosen for inoculation

Inoculation of Colonies

TycA Samples 1-6, 9, and 10 were inoculated in 5 mL of LB+KAN

Freezer Stocks/Miniprep/Concentration Check/Sequencing of Successful 6/1 Transformations (Parth, Nisa)

Samples:

●

TAX10- (A,B,D,E,G,H)

●

BAPT- (B, D, E, G, H)

●

badA- (A, B, C, D, F, G, H)

Protocols:

●

Freezer Stocks Protocol

●

Miniprep Protocol Zyppy

●

Testing Miniprep Concentrations

●

Preparation for Sequencing

Miniprep Edit: Used a 50 uL elution

	A	B	C	D	E	F	G	H
1	Sample:	TAX10-A	TAX10-B	TAX10-D	TAX10-E	TAX10-G	TAX10-H
2	Concentration (ng/uL)	69	203	210	190	132	94
3	Sample:	BAPT-B	BAPT-D	BAPT-E	BAPT-G	BAPT-H
4	Concentration (ng/uL)	61	51	146	142	180
5	Sample:	badA-A	badA-B	badA-C	badA-D	badA-F	badA-G	badA-H
6	Concentration (ng/uL)	52	209	60	100	165	149	130

Table9

Results of Testing DNA Concentration

Friday, 6/3/16

Freezer Stocks/Miniprep/Concentration Check of TycA

Labels were pGEM40-48 for samples TycA 1, 2, 3, 4, 5, 6, 8, 9, 10

Protocols:

●

Freezer Stocks Protocol

●

Miniprep Protocol Zyppy

●

Testing Miniprep Concentrations

Miniprep Edit: First step is 3500 rmp for 8 min

	A	B	C	D
1	Sample:	tycA 1	TycA 2	TycA 3
2	Concentration (ng/uL)	83	25	42
3	Sample:	TycA 4	TycA 5	TycA 6
4	Concentration (ng/uL)	75	36	53
5	Sample:	TycA 8	TycA 9	TycA 10
6	Concentration (ng/uL)	51	51	71

Table11

Transformations

Protocol:

●

Electroporation Protocol

DBAT, BAPT, TAX10, and TycA were transformed into competent E Cloni Cells

Recovered in Shaker for 2 hours.

	A	B	C
1	Sample	Volts	milliseconds
2	BAPT	1520	654
3	TAX10	1540	654
4	DBAT 1	1570	0.9
5	DBAT 2	1570	654
6	TycA 1	1610	1.3
7	TycA 2	1630	1.3

Table10

Transformations were then plated:

	A	B	C
1	Sample	10 uL	100 uL
2	BAPT	A	B
3	TAX10	A	B
4	DBAT 1	A	B
5	DBAT 2	A	B

Table12

TycA 1 and TycA 2 were both plated with 200 uL

Inoculated TycA

(1-8) small colonies and placed in shaker

Sent for Sequencing

Protocol:

●

Preparation for Sequencing

These samples were sent for sequencing:

●

TycA 1-6, 8-10

●

BadA-B

Did not dilute,

Sent 10 uL of each sample

Only sent in 1 primer

●

TycA sent in with SL1

●

BadA-B sent in with SR2

Diluted Samples

Diluted samples of BadA-B and TAT-9 to 50 ng/uL

●

BadA => 1.2 uL DNA; 3.8 uL pH2O

●

TAT => 2.1 uL DNA; 2.9 uL pH2O

Colony PCR

Protocol:

●

Colony PCR Protocol

Made a double PCR; ran one set on the old PCR machine; ran the new set on the new PCR machine

Samples run were:

●

pSMART

●

GFP

●

ProD Colony

●

ProD Colony

●

PAM-2 Colony

●

PAM-2 Miniprep

●

TBT Miniprep

●

BadA-B Miniprep

●

TAT-9 Miniprep

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	24
3	MM	12.5	300
4	SL1	0.25	6
5	SR2	0.25	6
6	H2O	12	288

Table13

Added a new protocol to the new PCR machine

●

Saved in a new folder "IGEM 2016" as "IGEM COL V1"

○

Ran for 30s at 50, 72, and 98 with an elongation of 4.5 min

Notes:

BadA is Sequence Confirmed

Tax10 and BAPT were blanks

Saturday, 6/4/16

Freezer Stocks of TycA and addition to Database

Protocol:

●

Freezer Stock Protocol

Labels were pGEM049-056 for samples TycA 1, 2, 3, 4, 5, 6, 7, 8

Mini Prep Inoculations for TycA

Protocol:

●

Miniprep Protocol NEB

The following inoculations were mini prepped:

●

TycA 1

●

TycA 2

●

TycA 3

●

TycA 4

●

TycA 5

●

TycA 7

●

TycA 8

●

TycA 9

Used a 50 uL elution.

Left minipreps for concentration testing on monday.

Concentrations (from 6/6 for these minipreps):

Protocol:

●

Testing Miniprep Concentrations

Tested Concentrations using nanodrop

	A	B	C	D	E	F	G	H
1	Sample	TycA-2	TycA-3	TycA-4	TycA-5	TycA-7	TycA-8	TycA-9
2	Round 1 (ng/uL)	33	10	22	6	3	5	5
3	Round 2 (ng/uL)	13	43	52	3	19	4	22
4	Concentration used:	33	43	52	N/A	19	N/A	22

Table17

Ran Gel on 6/3 PCR

The two PCR on 6/2 were run on two PCR machines. Samples tested in Angelica were from the old PCR machine and samples tested on Brandon were from the new PCR machine.

06/03/2016 Angelica JPG

30s denature, 30s anneal, 3:30 elongation, 35 cycles, oldmachine 1: Ladder 2: GFP 3: pSMART 4: PAM Miniprep 5: TBT Miniprep 6: TAT Miniprep 7: BAdA Miniprep 8: PAM Colony 9: ProD 1 10: ProD2 11-13: Empty

06/03/2016 Brandon.JPG

30s denature, 30s anneal, 3:30 elongation, 35 cycles, new machine 1: Ladder 2: GFP 3: pSMART 4: PAM Miniprep 5: TBT Miniprep 6: TAT Miniprep 7: BAdA Miniprep 8: PAM Colony 9: ProD 1 10: ProD2 11-13: Empty

Plated Gibson Transformations (Parth)

DBAT, TAX10, and BAPT were all plated on to Kan plates with the following uL amounts.

●

10 uL, 50 uL, 100 uL of transformation per enzyme

Sunday, 6/5/16

Colony PCR of Controls

Goal: Testing if the 45 second annealing and denature steps affected controls

Protocol:

●

Colony PCR Protocol

PCR of controls:

●

Standard PCR mix used

●

Miniprepped DNA diluted to 50ng/ul concentration

Samples: GFP, Psmart, Pam Mini, TBT mini, TAT mini, BADA Mini, PAM colony, ProD 1, Prod D2

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	24
3	MM	12.5	300
4	SL1	0.25	6
5	SR2	0.25	6
6	H2O	12	288
7	Total	25	600

Table16

Ran Gel

image (4).jpeg

45s denature, 45s anneal 3:30 elongation 35 cycles, Old machine 1:Ladder 2:GFP 3:pSMART 4:PAM miniprep 5:TBT miniprep 6:TAT miniprep 7:badA miniprep 8:proD colony 9:proD colony

Monday, 6/6/16

Colony PCR (Ben; Nisa)

Goal: Try different times and protocols to see where our controls stopped working

Notes:

-Running 4:30 elongation time on old PCR (Mike) and new PCRA (Charlie). 3:30 on new PCRB (NEB)

- Ran with 40x cycles

Samples used:

- PSM, GFP, PAM C, PAM M , BadA M, TBT M, TAT M, ProD C, ProD C.

(Time in: About 10:20a)

	A	B	C	D	E
1			(# col +1 control)	Using Old MM (Used in the first 6 that went into Mike)	New MM to make
2	Thing	1 rxn	30	6	24
3	MM	12.5	375	75	300
4	SL1	0.25	7.5	1.5	6
5	SR2	0.25	7.5	1.5	6
6	H2O	12	360	72	288
7	Total	25	750	150	600

Table14

Left Gels for tomorrow

Miniprep of DBAT, TAX10, and BAPT (Jay > Ben, Parth)

Goal: Miniprep....

Protocol:

●

Miniprep Protocol NEB

50 uL elution of dH2O

Inoculation samples used:

●

TAX10 (1-6)

●

DBAT (1-6)

●

BAPT (1-6)

Concentrations:

Protocol:

●

Testing Miniprep Concentrations

	A	B	C	D	E	F	G
1	TAX10 Sample	1	2	3	4	5	6
2	Concentration (ng/uL)	127	119	-12	40	98	84
3	DBAT Sample	1	2	3	4	5	6
4	Concentration (ng/uL)	-2	59	122	13	116	63
5	BAPT Sample	1	2	3	4	5	6
6	Concentration (ng/uL)	24	41	23	14	73	100

Table18

Transformation of Sequence Confirmed Mini prep into 286 Cells(Thomas; Emma)

Goal: That our miniprepped sequence confirmed cells can be transformed into the more robust 286 cells

Protocol:

●

Electroporation Protocol

Details:

●

Transformed: sequence confirmed minipreps of PAM-2, TBT-2, TAT-9, BadA-B

●

Used 500ul tubes

●

because of a shortage of 1.5ml tubes

left incubator for 2.5 hours

Recorded volts during electroporation

	A	B	C
1	Sample	Volts	Miliseconds
2	TAT -9 A	610	654
3	TAT-9 B	1690	3.5
4	BadA B	1680	3.8
5	PAM-2	1680	3.4
6	TBT-2	1710	4

Table15

Sequencing (Parth, Thomas)

Protocol:

●

Preparation for Sequencing

Sent the following samples for sequencing along with SL1 primer:

●

TycA- (2,3,4,7,9)

●

TAX10- (1,2,4,5,6)

●

DBAT- (2,4,5,6)*

○

Accidentally sent sample 4 instead of 3

●

BAPT- (2,5,6)

Tuesday, 6/7/16

Ran Gels for PCR Colony on 6/6

Protocol:

●

Gels

Mike-4m30s_elong.jpg

denature 45s, anneal 45s, elongation 4:30, 40 cycles, old machine 1: Ladder 2: pSMART 3: GFP 4: PAM Colony 5: PAM Miniprep 6: BadA Miniprep 7: TBT Miniprep 8:TAT Miniprep 9: ProD Colony 10: ProD Colony 11-13: Empty

Charlie-4m30s_elong.jpg

denature 45s, anneal 45s, elongation 4:30, 40 cycles, new machine 1: Ladder 2: pSMART 3: GFP 4: PAM Colony 5: PAM Miniprep 6: BadA Miniprep 7: TBT Miniprep 8:TAT Miniprep 9: ProD Colony 10: ProD Colony 11-13: Empty

NEB-3m30s_elong.jpg

denature 45s, anneal 45s, elongation 3:30, 40 cycles, new machine 1: Ladder 2: pSMART 3: GFP 4: PAM Colony 5: PAM Miniprep 6: BadA Miniprep 7: TBT Miniprep 8:TAT Miniprep 9: ProD Colony 10: ProD Colony 11-13: Empty

Well that didn't work quite right... Time for the next experiment!

PCR again: Find working Protocol for long TycA inserts

Protocol:

●

Colony PCR Protocol

GFP, Psm, PAM-M, PAM-C, TBT-M, TBT-C, TAT-M, TAT-C, BadA-M, BadA-C, ProD-1, ProD-2

Note: Add in 1 uL of 20-50ng/uL DNA.

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	38
3	MM	12.5	475
4	SL1	0.25	9.5
5	SR2	0.25	9.5
6	H2O	12	456
7	Total	25	950

Table7

Labels:

A

B

C

D

E

F

G

H

I

J

K

L

1

1

2

3

4

5

6

7

8

9

10

11

12

2

GFP

P-Smart

PAM-C

TBT_C

TAT-C

BadA-C

ProD-1

ProD-2

PAM-M

TBT-M

TAT-M

BadA-M

Table8

Old PCR machine on Angelica

(98C for 30s / 50C for 30s / 72C for 4m30s) x35

Left (New PCR A) on Suzie

(98C for 30s / 50C for 30s / 72C for 4m30s) x35

Right (New PCR B) on Brandon

(98C for 30s / 50C for 30s / 72C for 3m30s) x40

Inoculations (Adam)

Made liquid cultures of:

●

TycA (small colonies)

Wednesday, 6/8/16

Miniprep TycA Inoculations from 6/7 (Ben; Nisa; Ben)

Protocol:

●

Mini Prep Protocol NEB

50 uL elution used

Inoculation samples used:

●

TycA 1, 3, 4, 9

Concentrations:

Tested concentrations using nanodrop (Testing Concentrations Protocol)

	A	B	C	D	E
1	TycA Sample	1	3	4	9
2	Concentration (ng/uL)	13	13	9	4

Table20

Colony PCR: Testing overnight PCRs

Protocol:

●

Colony PCR Protocol

Each will be run with:

1.

GFP

2.

Psmart

3.

PAM-C

4.

PAM-M

5.

TBT-C

6.

TBT-M

7.

ProD

Each Protocol:

[98C for X sec / 50C for X sec / 72C for 3m30s] x 35

Old: X = 45s

Left: X = 45s

Right: X = 30s

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	23
3	MM	12.5	287.5
4	SL1	0.25	5.75
5	SR2	0.25	5.75
6	H2O	12	276
7	Total	25	575

Table19

Thursday, 6/9/16

Ran Gel on Overnight PCR from 6/8

Protocol:

●

Gels

Ran gels for

Suzie 6/9

RIGHT: [98C for 30 sec / 50C for 30 sec / 72C for 3m30s] x 35 NOTE: overnight caused some resideue bands to appear in the negative control 1. Ladder 2. GFP 3. Psmart 4. PAM-C 5. PAM-M 6. TBT-C 7. TBT-M 8. ProD

Brandon 6/9

OLD: [98C for 45 sec / 50C for 45 sec / 72C for 3m30s] x 35 NOTE: Faint band on negative control likely due to overnights. What is the long crap on PAM-C? 1. Ladder 2. GFP 3. Psmart 4. PAM-C 5. PAM-M 6. TBT-C 7. TBT-M 8. ProD

Angelica 6/9

LEFT: [98C for 45 sec / 50C for 45 sec / 72C for 3m30s] x 35 NOTE: Bright band on negative control likely due to overnight at 105C. What is the bright band over ProD? 1. Ladder 2. GFP 3. Psmart 4. PAM-C 5. PAM-M 6. TBT-C 7. TBT-M 8. ProD

Friday, 6/10/16

Gibson Attempt Three (Changing concentrations)

We found that the lucigen p-smart is 742ng/ul

Our DBAT gblock is 40ng/ul

We diluted the p-smart at 17ng/ul in a separate aliquot

Attempted the gibson again, used Comp Cells from the Lynch Lab; 1 uL of DNA 20 uL of comp cells

DBAT in several trials

Protocol:

●

Gibson Protocol

Saturday, 6/11/16

Transformation Results

●

Nothing grew 😞 😭

●

Potentially due to low times on the electroporation

Monday, 6/13/16

Transformation Take Two

We performed the Gibson Again, on DBAT

Used two variables;

●

4 uL of DNA

●

And then diluted with water to 1 uL of H2O and 1 uL of DNA

Results (6/14)

Most plates grew

Tuesday, 6/14/16

Colony PCR of DBAT Plates

Protocol:

●

Colony PCR Protocol

Edits:

●

8 colonies picked per plate (DBAT -A, DBAT-B, DBAT-3)

●

Controls: (GFP, PSmart, TBT-M, TBT-C)

●

PCR run on old machine

○

(98 C for 30s/ 50C for 30s/72c for 2m45s)x35

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	30
3	MM	12.5	375
4	SL1	0.25	7.5
5	SR2	0.25	7.5
6	H2O	12	360

Table21

Gel of colony PCR

Angelica

IMG_1235.jpg

1. Ladder 2-5. GFP, pSMART, TBT Miniprep, TBT Miniprep 6-13. DBAT-B (colonies 1-8)

Brandon

IMG_1236.jpg

1. Ladder 2-9. DBAT-A (colonies 1-8)

Suzie

IMG_1239.jpg

1. Ladder 2-9. DBAT-3 (colonies 1-8)

Restriction Digest

Protocol:

●

Digest

Edits:

●

Digested pSB1C3 (45 ng/uL) and TAT9 (121ng/uL) with EcoRI-HF and PstI-HF

●

Added DpnI in the Master Mix for pSB1C3

●

Mixed 3 uL of insert DNA with 5 uL of Master mix instead of 4 uL and 4 uL

Ligation

Protocol:

●

Ligation

Edits:

●

Ligated EcoRI/PstI digested pSB1C3 with EcoRI/PstI digested TAT9

●

2 uL of each were used

Transformation

Protocol:

●

Electroporation Protocol

Edits:

●

3uL of ligation DNA was used as well as 20 uL of competent cells

Wednesday, 6/15/16

Colony PCR of DBAT small colonies

Protocol:

●

Colony PCR Protocol

DBAT-A 1:11

DBAT-B 1:4

DBAT-3 1:8, 12

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	28
3	EconoTaq	12.5	350
4	SL1	0.25	7
5	SR2	0.25	7
6	H2O	12	336
7	Total	25	700

Table22

Ran Gels:

pic order:

angelica

brandon

suzie

image-2.jpeg

image-3.jpeg

image-4.jpeg

Thursday, 6/16/16

Colony PCR for Small DBAT Colonies

Protocols:

●

Colony PCR Protocol

Controls:

GFP x100, 2.5 uL

pSMART x100, 2.5 uL

TBT Colony

Colonies:

Kan 6/7/16 DBAT A 75 uL: 1, 2, 3, 4, 5, 7, 8, 9

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	12
3	EconoTaq	12.5	150
4	SL1	0.25	3
5	SR2	0.25	3
6	H2O	12	144
7	Total	25	300

Table23

Ran Gels:

Inoculated DBAT

DBAT A6 came back sequence confirmed.

It was inoculated in 5 mL of LB + KAN

Checked gBlock Concentrations

Diluted to 4x (0.5 uL gBlock and 1.5uL pH20. Vol total = 2uL)

Multiplied read by 4 to get the following concentrations

	A	B
1	gBlock	Real Concentration (ng/uL)
2	TycA-1	48
3	TycA-2	40
4	Tax10	96
5	BAPT	32

Table24

Freezer Stocks/Minipreping/Concentration Check/Sequencing

Protocols:

●

Freezer Stocks Protocol

●

Miniprep Protocol Zyppy

●

Testing Miniprep Concentration

●

Preparation for Sequencing

Preformed on:

●

TAT9-pSB1C3 1-1

●

TAT9-pSB1C3 1-2

●

TAT9-pSB1C3 2-1

●

TAT9-pSB1C3 2-2

●

TAT9-pSB1C3 2-3

●

TAT9-pSB1C3 2-4

○

Note that there is a slim chance that 2-3 and 2-4 may have been switched within the minipreping procedure

Concentration Results:

	A	B	C	D	E	F	G
1	Sample	1-1	1-2	2-1	2-2	2-3	2-4
2	Concentration (ng/uL)	128	85	160	207	140	53

Table25

Sequencing:

●

Used primers meant for the pSB1C3 backbone (Amp 1, Amp 2)

○

Amp 1 Concentration: 51.2 µM

○

Amp 2 Concentration: 47.99 µM

●

Results (6/17): All were sequence confirmed except for TAT9-pSB1C3 1-2

Compontent Cells

Protocol:

●

Electrocompetent Cells

Edits:

●

Incorrently measured OD using 420nm instead of 600nm

●

Prematurely took out cells resulting in only one tube of comp. cells

●

Redo 6/17

Friday, 6/17/16

Control PCR

Everyone to do their own PCR to check for human error.

GFP/pSM/TBT-M/TBT-C/PAM-M/PAM-C/ProD/ProD

Make own master mix - focus on what you are doing and why

Emma

Master Mix:

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	10
3	EconoTaq	12.5	125
4	SL1	0.25	2.5
5	SR2	0.25	2.5
6	H2O	12	120
7	Total	25	250

Table26

H20 1st; SL1 2nd; SR2 3rd; ET 4th

Samples:

1=GFP

2=pSMART

3=TBT Miniprep

4=TBT Colony

5=Pam Miniprep

6=PAM Colony

7=ProD 1

8=ProD2

Master Mix was mixing by pipetting up and down

The Master Mix was not aliquoted until all four rows were being aliquoted simultaneously

Parth

Samples:

●

pSMART miniprep 1:100 dilution

●

GFP miniprep 1:100 dilution

●

TBT miniprep

●

TBT colony

●

PAM miniprep

●

PAM colony

●

ProD colony 1

●

ProD colony 2

Protocol:

●

Colony PCR Protocol

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	9
3	EconoTaq	12.5	112.5
4	SL1	0.25	2.25
5	SR2	0.25	2.25
6	H2O	12	108
7	Total	25	225

Table28

Reaction Mix

Edits to procedure: No LB was aliquoted and used, the purpose of this test was to check consistency of PCR procedure. Longest amplificant is PAM (2.5 kb); therefore, extension time was 3.5 minutes.

Results:

IMG_1939.jpg

Samples going in the same order from left to right as listed previously. Note: ProD colony 1 did not PCR correctly as there was no liquid, thus there is a gap before ProD-2.

All sizes match correctly.

Jay

Protocol:

●

Colony PCR Protocol (Edit: Extension time 3 1/2 minutes)

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	9
3	EconoTaq	12.5	112.5
4	SL1	0.25	2.25
5	SR2	0.25	2.25
6	H2O	12	108
7	Total	25	225

Table27

061716Gel.jpg

1. Ladder 2. Blank (Ladder contaminated) 3. GFP 1:100 dilution 4. pSMART 1:100 dilution 5. TBT-Miniprep (50ng/uL) 6. TBT-Colony 7. PAM-Miniprep (50ng/uL) 8. PAM-Colony 9. ProD-Colony 1 10. ProD-Colony 2 11. Ladder

Gibsons

image-5.jpeg

Saturday, 6/18/16

Competent Cell Test

Used 5 concentrations of DNA in 2 transformations each for a total of transformations

White (W) = 0.5 pg/ul

Red (R) = 5 pg/ul

Green (G) = 10 pg/ul

Orange (O) = 20 pg/ul

Yellow (Y) = 50 pg/ul

Transformed Cells using the Electroporation protocol. Used 1 uL of DNA in 20 ul of Comp Cells. Plated after recovering for three hours.

Protocols:

●

Electroporation Protocol

Transformation Results

	A	B	C
1	Sample	Voltage (V)	Time (ms)
2	W1	1710	3.9
3	W2	1710	3.8
4	R1	1700	0.7
5	R2	1710	654
6	G1	1720	4.1
7	G2	1720	4.3
8	O1	1700	0.7
9	O2	1710	654
10	Y1	1710	3.8
11	Y2	1700	654

Table30

Plated each transformation on a CM plate with 25 ul of transformed cells. The Y1 and Y2 samples were plated three times at dilutions of 25 ul, 75 ul, and 100 ul.

Results (6.19)

The colonies on each plate were counted and tabulated. The data was then transformed using the CFU equation.

	A	B
1	Sample	Colony #
2	W1	2
3	W2	4
4	R1	14
5	R2	6
6	G1	80
7	G2	115
8	O1	9
9	O2	38

Table31

Colonies/Plate for all but Y1 and Y2

	A	B	C
1	Dilution	Y1	Y2
2	25	20	52
3	75	53	29
4	100	33	233

Table32

Colonies/Plate of Yellow Concentration

	A	B	C	D	E
1	Sample	Colony #	Dilution (ul)	DNA Concentration (ng/ul)	CFU
2	W1	2	25	0.005	10000000
3	W2	4	25	0.005	20000000
4	R1	14	25	0.005	70000000
5	R2	6	25	0.005	30000000
6	G1	80	25	0.01	200000000
7	G2	115	25	0.01	287500000
8	O1	9	25	0.02	11250000
9	O2	38	25	0.02	47500000
10	Y1a	20	25	0.05	10000000
11	Y1b	53	75	0.05	79500000
12	Y1c	33	100	0.05	66000000
13	Y2a	52	25	0.05	26000000
14	Y2b	29	75	0.05	43500000
15	Y2c	233	100	0.05	466000000
16	Average				97660714.2857142836

Table33

Transformed Data

Plates Chilled

Plates in the incubator were taken out

Monday, 6/20

Colony PCR

Emma

samples (color, letter/number)

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	17
3	EconoTaq	12.5	212.5
4	SL1	0.25	4.25
5	SR2	0.25	4.25
6	H2O	12	204
7	Total	25	425

Table34

Thomas

samples (color, letter/number)

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	35
3	EconoTaq	12.5	437.5
4	SL1	0.25	8.75
5	SR2	0.25	8.75
6	H2O	12	420
7	Total	25	875

Table36

Parth

samples (color, letter/number)

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	35
3	EconoTaq	12.5	437.5
4	SL1	0.25	8.75
5	SR2	0.25	8.75
6	H2O	12	420
7	Total	25	875

Table35

PCR 30@98C/30@50C/3:00@72C

Controls: GFP, psmart, TBT-M, TBT-C, ProD

Master Mix for Emma's control made by Thomas

PCR machine for Emma's Samples was turned off after ten seconds due to Jay's forgotten samples

Gel Electrophoresis

	A	B	C	D	E	F	G	H	I	J
1	Well 1	Well 2	Well 3	Well 4	Well 5	Well 6	Wells 7-26	Well 27	Wells 28-35	Wells 36-50
2	GFP (PP)	ProD (PP)	TBT-Miniprep (PP)	TBT-Colony (PP)	PSmart (PP)	Ladder	Green Numbers 1-20; BAPT #2 (TL)	Ladder	Red Letters A-H; TAX10 #1 (TL)	Black Numbers 1-15; BAPT #1 (JCS)

Table37

Big Bertha Row 1

	A	B	C	D	E	F	G	H	I	J	K
1	Well 1	Well 2	Well 3	Well 4	Well 5	Wells 6-29	Wells 30-43	Well 44	Wells 45-48	Well 49	Well 50
2	GFP (EM)	PSmart (EM)	TBT-Colony (EM)	TBT-Miniprep (EM)	Ladder	Green Letters A-X; BAPT #2 (EM)	Black Letters A-N; BAPT #1 (EM)	Ladder	Blue Letters A-D; TAX10 #2 (EM)	(Evaporated) Intended for Blue Letter E; TAX10 #2 (EM)	Blue Letter F; TAX10 #2 (EM)

Table38

Big Bertha Row 2

Big Bertha.JPG

See Tables above

Angelica

Angelica.JPG

1. GFP (Version: Thomas's) 2. pSMART (Version: Thomas's) 3. TBT-Miniprep (Version: Thomas's) 4. TBT-Colony (Version: Thomas's) 5. ProD (Version: Thomas's) 6. Ladder 7-13. TAX10#2 1-7 (Blue Numbers)

Brandon

Brandon.JPG

1. Ladder 2-4. TAX10#2 8-10 (Blue Numbers) 5. ProD (Version: Emma's) 6-13. TAX10#1 1-8 (Red Numbers)

Suzie

Suzie.JPG

1. Ladder 2-9. TAX10#1 10-17 (Red Numbers) 10. Blank 11. TAX10#1 9 (Red Number)

Tuesday, 6/21

Minipreps/Concentration Check/Sequencing

Protocols:

●

Miniprep Protocol Zyppy

●

Testing Miniprep Concentration

●

Preparation for Sequencing

Samples:

○

BAPT #1 (A, B)

○

TAX10 #2 (2, 3, 4)

○

TAX10 #2 (A, F)

○

BAPT #2 (C, D, F, R, X)

Results

A

B

C

D

E

F

G

H

I

J

K

L

M

1

Sample

BAPT#1-A

BAPT#1-B

BAPT#2-C

BAPT#2-D

BAPT#2-F

BAPT#2-R

BAPT#2-X

TAX10#2-A

TAX10#2-F

TAX10#2-2

TAX10#2-3

TAX10#2-4

2

Conc

123

60

67

61

66

56

54

50

52

49

54

41

Table42

Sent in for sequencing

Wednesday, 6/22

Colony PCR on TycA

4:30 elongation 30 s Elongation/Denaturation

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	53
3	EconoTaq	12.5	662.5
4	SL1	0.25	13.25
5	SR2	0.25	13.25
6	H2O	12	636
7	Total	25	1325

Table43

Gel Electrophoresis for TycA

Angelica

TycA62216Angelica.jpg

1. Ladder 2. GFP 3. pSMART 4-10: TycA yi 1-7 11-13: TycA san 11-13

Brandon

TycA62216Brandon.jpg

1. Ladder 2. TBT Mini Prep 3. TBT Colony 4-11. TycA er 1-8 12. Empty 13. TycA san 14

Suzie

TycA62216Suzie.jpg

1. Ladder 2. PAM Mini Prep 3. PAM Colony 4-11. TycA #2 1-8

Mike

TycA62216Mike.jpg

1. Ladder 2. ProD 3. ProD 4-13. TycA san 1-10

Inoculations were made of samples:

●

TycA san: 1, 10

●

TycA er: 6, 8

●

TycA yi: 4, 2

●

TycA #2: 4, 5

Inoculations placed in 5 mL of LB+KAN and

Transformations

Transformed several samples into cells. All samples used 1ul of DNA and 20 ul of Comp Cells.

Transformations were recovered for 2 hours and then 75 uL was plated onto a KAN Plate. Another set of plates was made after 4 hours of recovery with a 5:95 ratio of cells to LB.

	A	B	C	D
1	DNA Sample	Cell Sample	Volts	Tims (ms)
2	DBAT #1	286	1700	3.7
3	DBAT #2	286	1710	3.8
4	DBAT EV #1	286	1700	3.6
5	DBAT EV #2	286	1710	3.8
6	BadA EV #1	286	1710	3.7
7	BadA EV #2	286	1710	3.7
8	DBAT #1	E.Cloni	1720	4
9	DBAT #2	E.Cloni	1720	4

Table44

Restriction Digest

Protocol:

●

Digest

Edits:

●

Digested pSB1C3 (45 ng/uL) and DBAT (70ng/uL) with EcoRI-HF and PstI-HF

●

Added DpnI in the Master Mix for pSB1C3

●

Mixed 3 uL of insert DNA with 5 uL of Master mix instead of 4 uL and 4 uL

Ligation

Protocol:

●

Ligation

Edits:

●

Ligated EcoRI/PstI digested pSB1C3 with EcoRI/PstI digested DBAT

●

2 uL of each were used

Transformation

Protocol:

●

Electroporation Protocol

Edits:

●

3uL of ligation DNA was used as well as 20 uL of competent cells

Thursday, 6/23

Minipreps/Concentration Check/Sequencing (Nisa)

Protocols:

●

Miniprep Protocol Zyppy

●

Testing Miniprep Concentration

●

Preparation for Sequencing

Samples:

●

TycA EV-6

●

TycA San 1, 10

Results

	A	B	C	D
1	Sample	TycA EV-6	TycA San-1	TycA San-10
2	Conc	41	9	55

Table45

Made Plates of 286 (Parth & Nisa)

Made plates of 286

●

1 with 25 uL concentration spread out

●

2 by streaking into single colonies

Inoculations (Parth)

Made Inoculations of DBAT-pSB1C3 #1 (A-E)

Friday, 6/24

Freezer Stocks/Miniprep/Concentration Check/Sequencing (Nisa)

Protocols:

●

Freezer Stocks Protocol (750 uL)

●

Miniprep Protocol Zyppy (50 uL elution buffer)

●

Testing Miniprep Concentrations

●

Preparation for Sequencing

Samples:

●

DBAT-pSB1C3 #1 (A-E)

Results

	A	B	C	D	E	F
1	Sample	DBAT-pSB1C3#1-A	DBAT-pSB1C3#1-B	DBAT-pSB1C3#1-C	DBAT-pSB1C3#1-D	DBAT-pSB1C3#1-E
2	Conc	31	84	51	47	56

Table29

Gibson Transformations

Samples:

●

TAX10-1B

●

TAX10-2B

Saturday, 6/25

Colony PCR on TAX10 Plates 1B & 2B

3:00 elongation

38 Reactions: 17 colonies from 1B, 13 colonies from 2B, 1 uL GFP, 1 uL pSMART, 1 uL TBT miniprep, 1 TBT colony, 1 uL BadA miniprep, 1 BadA colony, 2 ProD colonies

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	40
3	EconoTaq	12.5	500
4	SL1	0.25	10
5	SR2	0.25	10
6	H2O	12	480
7	Total	25	1000

Table39

Gel Electrophoresis

Angelica

	A	B	C	D	E
1	Well 1	Well 2	Well 3	Wells 4-12	Well 13
2	Ladder	GFP	pSMART	TAX10 Plate 1B #1-9	Blank

Table40

Angelica62516.jpg

Brandon

	A	B	C	D	E
1	Well 1	Well 2	Well 3	Wells 4-11	Wells 12-13
2	Ladder	TBT Miniprep	TBT Colony	TAX10 Plate 1B #10-17	Blank

Table41

Brandon62516.jpg

Suzie

	A	B	C	D	E
1	Well 1	Wells 2-3	Wells 4-10	Well 11	Wells 12-13
2	Ladder	ProD Colonies	TAX10 Plate 2B #1-7	Blank	TAX10 Plate 2B #5-6

Table46

Suzie62516.jpg

Mike

	A	B	C	D	E	F	G
1	Well 1	Well 2	Well 3	Wells 4-5	Well 6	Wells 7-10	Wells 11-13
2	Ladder	BadA Miniprep	BadA Colony	TAX10 Plate 2B #8-9	Blank	TAX10 Plate 2B #10-13	Blank

Table47

Mike62516.jpg

Tuesday, 6/28

Digest/Ligation/Transformation of TAX10+ pSB1C3 (Parth)

Protocols:

●

Digest

○

Edits: 2uL pSB1C3+2uL dH2O, 1uL TAX10+3uLdH2O to make the amounts equimolar for the ligation

○

TAX10 taken was directly from gBlock

●

Ligation

○

Two attempts at ligation (Samples: #1, #2)

●

Transformation

○

Edits: Plated Sample #1 @ 75uL and 25uL, Plated Sample #2 once @ 75 uL

Result: Failure, no colonies grew

Thursday, 6/30

Splitting pSmart into Pieces before Gibson

PCR

●

2 reactions: 1) linear pSmart (17 ng/uL), 1/2 forward primer, 1/2 reverse primer; 2) linear pSmart (17 ng/uL), 2/2 forward primer, 2/2 reverse primer

●

63 degrees Celsius annealing temperature

	A	B	C	D
1
2	Thing	1 rxn	2.2
3	Q5-2xMM	25	55
4	Forward Primer	2.5	5.5	(not mixed)
5	Reverse Primer	2.5	5.5	(not mixed)
6	DNA	1	2.2
7	H2O	19	41.8
8	Total	50	110

Table48

Master Mix

Gel Electrophoresis

PSmartChew063016.jpg

Ladder, Reaction 1, Reaction 2

Monarch PCR DNA Cleanup (see protocol)

●

Concentration Check: Piece 1 @ 61 ng/uL; Piece 2 @ 91 ng/uL

●

Conversions: Piece 1 @ 0.1098 picomoles/uL; Piece 2 @ 0.1452 picomoles/uL

●

(Conversion from ng/uL to picomoles/uL: x1000/(bp length x 650))

10 uL Dilutions to 0.020 picomoles/uL for Gibson Reaction

●

Concentration Check: Piece 1 @ 12 ng/uL; Piece 2 @ 14 ng/uL

●

Conversions: Piece 1 @ 0.0216 picomoles/uL; Piece 2 @ 0.0223 picomoles/uL

Friday, 7/1

Gibson Reaction with (TAX10+ pSMART 1/2+ pSMART 2/2)

Protocol:

●

Gibson Protocol

Samples:

●

TAX10

○

1 µL TAX10 from gBlock

○

1 µL pSMART 1/2 dilution

○

1 µL pSmart 2/2 dilution

○

2 µL dH₂O

○

5 µL Gibson HiFi Master Mix

●

Control

○

1 µL pSMART 1/2 dilution

○

1 µL pSmart 2/2 dilution

○

3 µL dH₂O

○

5 µL Gibson HiFi Master Mix

Electroporation

●

TAX10 #1: 1620 V, 2.5 ms; TAX10 #2: 1620 V, 654 ms; TAX10 #3: 654 ms (voltage not recorded)

●

Put for recovery in Lynch Lab shaker around 11:45 AM

Plating

●

After 3 PM

●

2 plates of each TAX10, 80 uL each (some plates soft)

●

Put in incubator at 37 degrees Celsius for 20 hours

Saturday, 7/2

Colony PCR on TAX10 Plates 1B, 2B, 3A

3:00 elongation

60 Reactions: 16 colonies from 1B, 16 colonies from 2B, 16 colonies from 3A, 3 x 1 uL GFP, 3 x 1 uL pSMART, 3 x 1 uL TBT miniprep, 3 x 1 TBT colony

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	66
3	EconoTaq	12.5	825
4	SL1	0.25	16.5
5	SR2	0.25	16.5
6	H2O	12	792
7	Total	25	1650

Table49

Master Mix

Gel Electrophoresis

Angelica

	A	B	C	D	E	F
1	Well 1	Well 2	Well 3	Well 4	Well 5	Wells 6-13
2	Ladder	GFP (JCS)	PSmart (JCS)	TBT-Miniprep (JCS)	TBT-Colony (JCS)	TAX10 Plate 1B #1-8

Table50

Angelica7216.jpg

Brandon

	A	B	C	D	E	F
1	Well 1	Wells 2-9	Well 10	Well 11	Well 12	Well 13
2	Ladder	TAX10 Plate 1B #9-16	GFP (NV)	PSmart (NV)	TBT-Miniprep (NV)	TBT-Colony (NV)

Table51

Brandon7216.jpg

Suzie

	A	B
1	Well 1	Wells 2-13
2	Ladder	TAX10 Plate 2B #1-12

Table52

Suzie7216.jpg

Mike

	A	B	C	D	E	F	G
1	Well 1	Wells 2-5	Well 6	Well 7	Well 8	Well 9	Wells 10-13
2	Ladder	TAX10 Plate 2B #13-16	GFP (PP)	PSmart (PP)	TBT-Miniprep (PP)	TBT-Colony (PP)	TAX10 Plate 3A #1-4

Table53

Mike7216.jpg

Ed-Ward

	A	B
1	Well 1	Wells 2-13
2	Ladder	TAX10 Plate 3A #5-16

Table54

Ed-Ward7216.jpg

Tuesday, 7/5

Running Controls for Cutting pSmart into Pieces before Gibson

PCR

●

4 reactions: 1) 1 uL linear pSmart (1:10 dilution of 17 ng/uL), 2.5 uL 1/2 forward primer, 2.5 uL 1/2 reverse primer, 19 uL PICO water, 25 uL Q5-2xMM; 2) 1 uL linear pSmart (1:10 dilution of 17 ng/uL), 2.5 uL 2/2 forward primer, 2.5 uL 2/2 reverse primer, 19 uL PICO water, 25 uL Q5-2xMM; 3) 1 uL linear pSmart (1:100 dilution of 17 ng/uL), 2.5 uL 1/2 forward primer, 2.5 uL 1/2 reverse primer, 19 uL PICO water, 25 uL Q5-2xMM; 4) 1 uL linear pSmart (1:100 dilution of 17 ng/uL), 2.5 uL 2/2 forward primer, 2.5 uL 2/2 reverse primer, 19 uL PICO water, 25 uL Q5-2xMM

●

63 degrees Celsius annealing temperature

●

Q5 PCR protocol on old PCR machine

Gel Electrophoresis

PSmartSplit7516.jpg

Ladder, Reaction 1 (10 uL dilution), Reaction 2 (10 uL dilution), Reaction 1 (100 uL dilution), Reaction 2 (100 uL dilution)

Monarch PCR DNA Cleanup (see protocol)

●

Concentration Check: 10 uL dilution Piece 1 @ 23 ng/uL; 10 uL dilution Piece 2 @ 33 ng/uL; 100 uL dilution Piece 1 @ 24 ng/uL; 100 uL dilution Piece 2 @ 38 ng/uL

●

Conversions: Piece 1 @ 0. picomoles/uL; Piece 2 @ 0. picomoles/uL

●

(Conversion from ng/uL to picomoles/uL: x1000/(bp length x 650))

10 uL Dilutions to 0.020 picomoles/uL for Gibson Reaction

●

Concentration Check: Piece 1 @ 12 ng/uL; Piece 2 @ 15 ng/uL

●

Conversions: Piece 1 @ 0.0 picomoles/uL; Piece 2 @ 0.0 picomoles/uL

Gibson Reactions

Protocol:

●

Gibson Protocol

Samples:

●

Control: Pieces

○

1 µL pSmart 1/2 100 uL dilution

○

1 µL pSmart 2/2 100 uL dilution

○

3 µL dH₂O

○

5 µL Gibson HiFi Master Mix

●

Control: Full

○

1 µL pSmart 17 ng/uL dilution

○

4 µL dH₂O

○

5 µL Gibson HiFi Master Mix

●

Control: Fake Pieces

○

1 µL pSmart 1/2 100 uL dilution

○

1 µL pSmart 2/2 100 uL dilution

○

8 µL dH₂O

●

Control: Fake Full

○

1 µL pSmart 17 ng/uL dilution

○

9 µL dH₂O

Electroporation

●

Gibson Pieces, Fake Pieces, Fake Full (Gibson Full did not electroporate)

●

1 uL Gibson, 35 uL electrocompetent cells, electroporate, 250 uL LB Broth

●

Put for recovery in original shaker at 37 degrees Celsius around 6 PM

Plating

●

After 9 PM

●

2 plates of each, 35 and 80 uL

●

Put in incubator at 37 degrees Celsius

Restriction Digest

Protocol:

●

Digest

Edits:

●

Digested pSB1C3 (45 ng/uL) and DBAT (40ng/uL) with EcoRI-HF and PstI-HF

●

Added DpnI in the Master Mix for pSB1C3

Ligation

Protocol:

●

Ligation

Edits:

●

Ligated EcoRI/PstI digested pSB1C3 with EcoRI/PstI digested TAT9

●

2 uL of each were used

Thursday, 7/7

Transformed water, new dilution linear DNA, and gibson on new dilution linear DNA into E Cloni

Plated 35 uL and 80 uL of each

After 20 hours, only growth on fake 35 uL plate > 2 small colonies

Friday, 7/8

Chewed up 1:100 dilution of new psmart dilution into pieces with Q5 PCR

PSmartChew7816.jpg

Piece 1 @ 18 ng/uL, Piece 2 @ 40 ng/uL >> Diluted: Piece 1 @ 12 ng/uL, Piece 2 @ 15 ng/ul

2 Gibsons: control with no insert and TBT insert

Transformed Gibsons at 2:30 PM: TBT @ 1660 V, 3.2 ms; control @ 1660 V, 3.1 ms

Plated 35 uL TBT, 80 uL TBT, 50 uL control around 9:30 PM

Sunday, 7/10

Colony PCR on DBAT pSB1C3

3:00 elongation, ran initially with normal protocol (50°C annealing) for about 30 cycles, then ran on another PCR with 59°C annealing

10 Reactions: 4 colonies from 2A, 4 colonies from 2B, 2 from 1

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	12
3	EconoTaq	12.5	150
4	Amp1	0.25	3
5	Amp2	0.25	3
6	H2O	12	144
7	Total	25	300

Table55

Master Mix

Colony PCR on Thomas' Plates (Nisa)

3:00 elongation

7 Reactions: GFPA, GFPB, badA-B, TAT-9, DBAT

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	7
3	EconoTaq	12.5	87.5
4	SL1	0.25	1.75
5	SR2	0.25	1.75
6	H2O	12	84
7	Total	25	175

Table56

Monday, 7/11

2-piece PSmart Gibson Attempt w/TBT

●

1.5 uL 1/2 PSM, 1.5 uL 2/2 PSM, 2 uL TBT, 5uL Hi-Fi: 1660 V, 3.1 ms

●

2 uL Full PSM, 3 uL PICO water, 5 uL Hi-Fi: 1670 V, 3.2 ms

●

1.5 uL 1/2 PSM, 1.5 uL 2/2 PSM, 2 uL PICO water, 5 uL Hi-Fi: 1660 V, 3.0 ms

All recovered for 3 hours and plated 2 x 80 uL of each at 2:30 PM

Q5 Mutagenesis

Hydrated and suspended the new oligos in 100uM aliquots. Diluted to 10uM for the reaction. Protocol:

Q5 Hot Start Hi-Fi 2X Master Mix - 12.5 uL

10uM Forward - 1.25 uM

10uM Reverse Primer - 1.25 um

Template (BadA at 2 ng/uL. TBT at 3 ng/uL) - 1 uL

Water to 25uL toatl volume - 9 uL

PCR machine:

Saved as "BadA Mut Q5" under "CT001243 Root"

Gel for 35min > single band in each well > PCR products can be used directly for KLD reaction

1 uL of kinase, ligase, and DpnI each mixed together for KLD mix

1 uL KLD mix, 1 uL ligase buffer, 2 uL PCR product mixed in each reaction tube

Tubes incubated at room temperature for an hour

BadA and TBT from each tube transformed: BadA @ 1650 V, 3.1 ms; TBT @ 1630 V, 2.8 ms

Recovered for 1.5 hours

Plated 10 uL, 100 uL of each at 8:10 PM

Colony PCR of DBAT pSB1C3 (Nisa)

3:00 elongation

	A	B	C
1			(# col +3 control)
2	Thing	1 rxn	12
3	EconoTaq	12.5	150
4	Amp1	0.25	3
5	Amp2	0.25	3
6	H2O	12	144
7	Total	25	300

Table73

Ladder (too faint), pSB1C3+RFP (too faint), DBATxpSB1C3 75-2 (EV), DBATxpSB1C3 2A 1-4. 2B 1-4, 1-1

DBATpSB1C3 7.11.16

Inoculations of DBAT pSB1C3 (Nisa)

Inoculated 2A3-4, 2B1, 1-1

Transformation of pSB1C3xE. cloni (Nisa)

Took 2 ug of pSB1C3+RFP (from iGEM kit) and transformed 35 uL E. cloni

Let recover for 1.5 hr outside and 1 hr in incubator

Plated on CM plate diluted to 5:95 at 25 uL and 75 uL

Tuesday, 7/12

Q5 PCR to Cut Mismatched Base Pairs of Homology from PSmart

	A	B	C
1		1 rxn	3.3
2	Q5-2xMM	25	82.5
3	1/2 PSM Forward Primer	2.5	8.25
4	2/2 PSM Reverse Primer	2.5	8.25
5	PICO Water	19	62.7
6		49	161.7

Table57

3 reactions: 15 ng/uL PSM, 1:10 dilution, 1:100 dilution

Ladder and three reactions run in that order on gel

PSmartFix71216.jpg

Colony PCR to Assess Success of 2-Piece PSmart Gibson with TBT

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	24.2
3	EconoTaq	12.5	302.5
4	SL1	0.25	6.05
5	SR2	0.25	6.05
6	H2O	12	290.4
7	Total	25	605

Table58

22 rxns: Plate A colonies #1-18, GFP, PSM, TBT-C, TBT-M

Suzie: Ladder, TBT-M, TBT-C, Colonies #1-10 - No positive screens

Suzie 2: Ladder, TBT-M, TBT-C, GFP, PSM, Colonies #11-18 - see below

Suzie2071216.jpg

Colony 17 incoluated at 6:15 PM (faint band at TBT level in image)

Miniprep/Concentration Check/Sequencing of DBAT pSB1C3 (Parth, Nisa)

Samples:

●

DBATxpSB1C3 2A3-4, 2B1, 1-1

Protocols:

●

Miniprep Protocol Zyppy

●

Testing Miniprep Concentrations

●

Preparation for Sequencing

Miniprep Edit: Used a 50 uL elution

	A	B	C	D	E	F
1	Sample:	DBATxpSB1C3 2A3	2A4	2B1	1-1
2	Concentration (ng/uL)	99	60	61	48

Table61

Results of Testing DNA Concentration

Wednesday, 7/13

Q5 PCR to Cut Mismatched Base Pairs of Homology from PSmart

	A	B	C
1		1 rxn	4.4
2	Q5-2xMM	25	110
3	1/2 PSM Forward Primer	2.5	11
4	2/2 PSM Reverse Primer	2.5	11
5	PICO Water	19	83.6
6		49	215.6

Table59

4 reactions: 15 ng/uL PSM, 1:5 dilution, 1:10 dilution, 1:100 dilution

Ladder, 3 ng original psmart control, four reactions run in that order on gel

PSMMismatchCut071316.jpg

Inoculations of DBAT pSB1C3 (Nisa)

Inoculated 2A3-4, 2B1, 1-1

Inoculations of pSB1C3xE. cloni (Nisa)

Inoculated 3 colonies from 75 uL plate

Thursday, 7/14

Testing Full PSmart w/o Mismatched Tail for Gibsons

Decided to use 1:100 dilution PCR products for Gibsons > PCR Cleanup done, product @ 41 ng/uL, diluted to .016 picomoles/uL (tailless psm)

15 ng/uL actually 19 ng/uL Psmart, diluted to .016 picomoles/uL

TBT at 48 ng/uL, diluted to .032 picomoles/uL

3 Gibson reactions

●

Tailless psm, TBT > transformation 1: 1660 V, 654 ms; transformation 4: 1680 V, 3.6 ms

●

Tailless psm > transformation 2: 1680 V, 3.5 ms

●

19ng/uL psm, TBT > transformation 3: 1690 V, 654 ms

3 hour recovery, plated 2 x 80 uL of each reaction at 6:50 PM

Q5 PCR to Cut Mismatched Base Pairs of Homology from LCKan PSmart

	A	B	C
1		1 rxn	3.3
2	Q5-2xMM	25	82.5
3	1/2 PSM Forward Primer	2.5	8.25
4	2/2 PSM Reverse Primer	2.5	8.25
5	PICO Water	19	62.7
6		49	161.7

Table60

3 reactions: 50 ng/uL LCKan PSM, 1:10 dilution, 1:100 dilution

Ladder, 10 ng original psmart control, three reactions run in that order on gel

LCKanMismatchCut071416.jpg

Miniprep/Concentration Check of pSB1C3 (Nisa)

Samples:

●

pSB1C3xE. cloni 1, 2

Protocols:

●

Miniprep Protocol Zyppy

●

Testing Miniprep Concentrations

●

Preparation for Sequencing

Miniprep Edit: Used a 30 uL elution

	A	B	C	D
1	Sample:	1	2
2	Concentration (ng/uL)	138	185

Table69

Results of Testing DNA Concentration

Restriction Digest of pSB1C3

Protocol:

●

Digest

Edits:

●

Digested pSB1C3 (samples from above) with EcoRI-HF and PstI-HF

Inoculations of pSB1C3xE. cloni (Nisa)

Inoculated 3 colonies from 75 uL plate

Friday, 7/15

LCAmp Transformations

●

TAX10: 1660 v, 3.1 ms; plated 2 x 70 uL and 1 x 20 uL plates

●

Real control: 1650 V, 654 ms; plated 2 x 70 uL

●

(Not LCAmp but done with same batch) Fake tailless PSM control: 1670 V, 3.5 ms; plated 2 x 70 uL

●

Plated at around 8 PM

Miniprep/Concentration Check of pSB1C3 (Nisa)

Samples:

●

pSB1C3xE. cloni 2, 3

Protocols:

●

Miniprep Protocol Zyppy

●

Testing Miniprep Concentrations

●

Preparation for Sequencing

Miniprep Edit: Used a 30 uL elution

	A	B	C	D
1	Sample:	2	3
2	Concentration (ng/uL)	151	142

Table70

Results of Testing DNA Concentration

Colony PCR on DBAT pSB1C3 (Nisa)

3:00 elongation

	A	B	C
1			(# col +2 control)
2	Thing	1 rxn	12
3	EconoTaq	12.5	150
4	Amp1	0.25	3
5	Amp2	0.25	3
6	H2O	12	144
7	Total	25	300

Table68

Master Mix for 12 reactions: Sequence confirmed DBAT-pSB1C3 (75-2), Seq. confirmed EV DBAT-pSB1C3 miniprep, 2A 1-4, 2B 1-4, 1- 1,2

7-15 DBAT-pSB1C3.jpg

Nisa071516-1.jpg

Ran extra positive control

Saturday, 7/16

Colony PCR on LCAmp 20 uL Plate Colonies

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	13.2
3	EconoTaq	12.5	165
4	SL1	0.25	3.3
5	SR2	0.25	3.3
6	H2O	12	158.4
7	Total	25	330

Table62

Master Mix for 12 reactions: PSM, GFP, TBT-M, TBT-C, 8 colonies

Run at 8 PM and left overnight

Sunday, 7/17

Gel of PCR products run at 6 PM

LCKANTry071716.jpg

Ladder, PSM, GFP, TBT-M, TBT-C, LCAmp + TAX10 Colonies 1-8 (All negative)

Inoculations of DBAT pSB1C3 (Nisa)

Inoculated 4 colonies DBAT pSB1C3 1-2. 2A3, 2A4, 2B2

Monday, 7/18

Endura Competent Cells Transformations

●

LC Amp + TAX10 in Broth: 1710 V, 4.3 ms - plated 2 x 50 uL + 2 x 10 uL

●

LC Amp + TAX10 in Endura Special Recovery (875 uL): 1680 V, 3.5 ms - plated 2 x 50 uL + 2 x 10 uL

●

LC Amp Control: 1690 V, 3.8 ms - plated 50 uL, 10 uL

●

FAKE LC Amp Control: 1670 V, 3.2 ms - plated 50 uL, 10 uL

> 2 hour recovery, plated around 6 PM

Miniprep/Concentration Check of DBAT pSB1C3 (Nisa)

Samples:

●

DBAT pSB1C3 1-2

●

2A3

●

2A4

●

2B2

Protocols:

●

Miniprep Protocol Zyppy

●

Testing Miniprep Concentrations

●

Preparation for Sequencing

Miniprep Edit: Used a 40 uL elution

	A	B	C	D	E
1	Sample:	DBAT pSB1C3 1-2	2A3	2A4	2B2
2	Concentration (ng/uL)	69	65	85	27

Table71

pSB1C3 Purification and Concentration Check (Nisa)

Protocol:

●

Gel Purification

Edits:

●

Started with 1,500 ng of pSB1C3

●

Used 6 uL elution buffer

Results:

Combined from 5 samples into 3 samples of pSB1C3

	A	B	C	D
1	Sample:	1	2	3
2	Concentration (ng/uL)	12	10	9

Table75

Tuesday, 7/19

Colony PCR of 10 uL LCAmp Endura Plates

	A	B	C
1			(# reactions x 1.1)
2	Thing	1 rxn	33
3	MM	12.5	412.5
4	SL1 (3.2 uM)	7.8125	257.8125
5	SR2 (100 uM)	0.25	8.25
6	H2O	4.4375	146.4375

Table63

Master Mix

2:45 Elongation

Brandon

Ladder, GFP, PSM, Blank, 1, 2, 3, 4, Blank, 10, 38, 39, 40

BrandonEndura071916.jpg

Suzie

Ladder, TBT-M, TBT-C, Blank, 17, 18, 19 20, Blank, 2, 3, 4, 5

SuzieEndura071916.jpg

Mike

Ladder, BadA-M, BadA-C, Blank, 16, 17, 18, 19, Blank, 28, 31, 32, 39

MikeEndura071916.jpg

GBlock Amplification PCR

	A	B	C
1			(# reactions x 1.1)
2	Thing	1 rxn	4.4
3	Q5-2xMM	25	110
4	Forward Primer (10 uM)	2.5	11
5	Reverse Primer (10 uM)	2.5	11
6	PICO H2O	19	83.6
7	Total	49	215.6

Table64

Master Mix: 49 uL added to 1 uL of DNA for each reaction

0:55 Elongation

GBlockAmp071916.jpg

Ladder, BAPT (5 ng/uL), 1:10 BAPT, TAX10 (9 ng/uL), 1:10 TAX10

Colony + Miniprep PCR on DBAT pSB1C3 (Nisa)

3:00 elongation

	A	B	C
1			(# col +3 control)
2	Thing	1 rxn	10
3	EconoTaq	12.5	125
4	Amp1	0.25	2.5
5	Amp2	0.25	2.5
6	H2O	12	120
7	Total	25	250

Table72

Master Mix for 12 reactions: Sequence confirmed DBAT-pSB1C3 (75-2) colony, Seq. confirmed EV DBAT-pSB1C3 miniprep, Seq. confirmed EV DBAT-pSB1C3 colony, Miniprep: 1-2, 2A3, 2A4, 2B2, Colony: 1-2, 2A4, 2B2

7-19 Colony Miniprep PCR of DBAT-pSB1C3.jpg

Only had bands on colonies, including negative control

Wednesday, 7/20

Temperature Gradient PCR for GBlock Amplification

	A	B	C
1			(# reactions x 1.1)
2	Thing	1 rxn	4.4
3	Q5-2xMM	25	110
4	Forward Primer (10 uM)	2.5	11
5	Reverse Primer (10 uM)	2.5	11
6	PICO H2O	19	83.6
7	Total	49	215.6

Table65

Master Mix: 49 uL added to 1 uL of DNA for each reaction

1:05 Elongation

GBlockAmplification72016.jpg

Ladder, BAPT @ 63°C Annealing, BAPT @ 60.8°C Annealing, BAPT @ 58.4°C Annealing, BAPT @ 57°C Annealing, Blank, BAPT @ 60.8°C Annealing (redone)

Inoculations

From Endura 10 uL plates: Red #38 & #1 + Blue #3 & #28 > Inoculated in LB + Amp @ 4 PM, left in shaker

Thursday, 7/21

Troubleshooting GBlock Amplification, feat. Adim

	A	B	C
1			(# reactions x 1.1)
2	Thing	1 rxn	4.4
3	Q5-2xMM	12.5	55
4	Forward Primer (10 uM)	1.25	5.5
5	Reverse Primer (10 uM)	1.25	5.5
6	PICO H2O	4	17.6
7	GC Enhancer	5	22
8	Total	24	105.6

Table66

Master Mix: 24 uL added to 1 uL of DNA for each reaction

3:00 Elongation

Suzie

GBlock1Amp72116.jpg

Ladder, BAPT @ 63°C Annealing, BAPT @ 60.8°C Annealing, BAPT @ 58.4°C Annealing, BAPT @ 57°C Annealing

	A	B
1
2	Thing	1 rxn
3	Q5-2xMM	12.5
4	Forward Primer (10 uM)	1.25
5	Reverse Primer (10 uM)	1.25
6	PICO H2O	8
7	Total	23

Table67

Added to 2 uL of DNA for reaction

3:00 Elongation

GBlock2Amplify072116.jpg

Ladder, BAPT @ 63°C Annealing

Note: 15 uL of 5 ng/uL BAPT left

Friday, 7/22

Transformations of Q5 Mutagenesis S.C. Products into DLF-00286

●

TBT: 1630 V, 654 ms

●

BadA: 1670 V, 3.0 ms

> Plated each of 75 uL and 5 uL recovery:95 uL LB broth mixtures on LB+KAN plates for both transformations at 8 PM

Monday, 7/25

Thursday, 7/28

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	2
3	MM	12.5	25
4	Amp2_F	0.25	0.5
5	SR2	0.25	0.5
6	H2O	12	24

Table74

Mini Prep Protocol

Introduction

sdfghjkl;

Materials

• Mini Prep Kit
• Spin Columns
• Neutralize (B3) Buffer - 4 C fridge
• Epi Tubes

Procedure

• Before Beginning

1. All centrifugation steps should be carried out at 13,000 RPM

2. Add 4 volumes of ethanol (>= 95%) to one volume of Plasmid Wash Buffer 2.

3. If precipitate has formed in Lysis Buffer (B2), incubate at 30-37 degrees C, inverting periodically to dissolve.

4. Store Plasmid Neutralization Buffer (B3) at 4 degrees C.

• Miniprep

5. Pellet 1-5 ml bacterial culture by centrifugation for 8 minutes at 3500 rpm. Discard supernatant.

6. Resuspend pellet in 200 ul Plasmid Resuspension Buffer (B1 - pink). Vortex or pipet to ensure cells are completely resuspended. There should be no visible clumps.

7. Add 200 ul Plasmid Lysis Buffer (B2 - blue).

8. Gently invert tube 5-6 times.

9. Incubate at room temperature for 1 minute.

00:01:00

10. Color should change to dark pink, and solution will become transparent and viscous. Do not vortex.

11. Add 400 ul of of Plasmid Neutralization Buffer (B3 - yellow).

12. Gently invert tube until neutralized.

13. Incubate at room temperature for 2 minutes.

00:02:00

14. Sample is neutralized when color is uniformly yellow and precipitate forms. Do not vortex.

15. Centrifuge lysate for 2-5 minutes.

16. Carefully transfer supernatant to the spin column.

17. Centrifuge for 1 minute. Discard flow-through.

18. Re-insert column in the collection tube and add 200 uL of Plasmid Wash Buffer 1.

19. Centrifuge for 1 minute. Discarding the flow-through is optional.

20. Add 400 uL of Plasmid Wash Buffer 2 and centrifuge for 1 minute.

21. Transfer column to a clean 1.5 mL microfuge tube. Use care to ensure that the tip of the column does not come into contact with the flow-through. If there is any doubt, re-spin the column for 1 minute.

• When centrifuging with the epi tubes, cross the lids together to prevent them from breaking off. If there is an odd number then the last one should stick out sideways. Don't place the lids up or down as they can break off during centrifugation.

22. CRITICAL

    Add >= 30 uL DNA Elution Buffer to the center of the matrix. Wait for 1 minutes.

00:01:00

23. Spin for 1 minute to elute DNA.

• Usually add 50 uL of Elution Buffer

• Nuclease-free water (pH 7-8.5) can also be used to elute the DNA

• Yield may slightly increase if a larger volume of DNA Elution Buffer is used. But the DNA will be less concentrated. For larger size DNA, (>= 10 kb) heating the elution buffer to 50 degrees C to use can improve yield.

Gibson Protocol

Introduction

Gibsons ligate plasmids and vectors together.

Materials

• Vector
• Insert
• Water
• 2X Hi-Fi
• PCR Tubes

Procedure

• Amounts

1. 1.5 uL of vector

2. 5 uL of mix (2X Hi-fi Gibson Master Mix)

3. 1.5 uL of inserts

4. Add enough water so that the total volume becomes 10uL

• Order

5. Mix in the PCR Tube

• Insert

• Vector

• Mix

• Water

Colony PCR

Introduction

Get started by giving your protocol a name and editing this introduction.

Materials

Procedure

1. Prepare econotaq master mix with oligos to amplify the region of interest (https://www.lucigen.com/docs/manuals/MA038-EconoTaq-PLUS.pdf)

	A	B	C
1			(# col +1 control)
2	Thing	1 rxn	10
3	EconoTaq	12.5	125
4	SL1	0.25	2.5
5	SR2	0.25	2.5
6	H2O	12	120
7	Total	25	250

Table1

• CRITICAL

  COPY AND PASTE TABLE, INSERT NUMBER OF REACTIONS DESIRED AND TABLE WILL AUTO CALC VALUES

2. Aliquot out master mix + oligos into a sufficient number of PCR tubes to test colonies

3. If your backbone + insert plates have many more colonies than your backbone only or insert only, you will need to test fewer colonies than if you have lots of colonies on your control plates

4. Also include a control reaction with parent plasmid only

5. Aliquot out some LB (+ antibiotic) into another set of tubes,one for each colony you are testing

6. Pick a colony from your transformation plate with a sterile pipette tip

7. Dab the colony into the PCR tube with the econotaq master mix

8. Dab it again in the tube with LB

9. Run the PCR according to manufacturer’s protocol, but with a long (5 min) initial melting step at 95-98

• NOTE: If you are including miniprepped DNA in the PCR reaction, dilute to 50 ng/uL.

• Thermocycler Protocol

10. Start: 98C for 10 min.

11. Cycle (x35)

12. Melt 98C for 45s

13. Anneal 50C for 45s

14. Extend 72C for ___

15. Time = (1 min / kbase)*length(longest amplificant)

16. 4C for inf

• NOTE: When dealing with DNA samples instead of colony samples. Use 3 uL of 1ng/uL DNA

• If DNA sample is poor, use at most 50 ng/uL concentration

Freezer Stocks Protocol

Introduction

Get started by giving your protocol a name and editing this introduction.

Materials

• Cryotubes
• 20% Glycerol
• Culture Samples

Procedure

• Labeling And Database

1. Label each cryotube tube with pGEM___

• The number after the pGEM corresponds to the plasmid database

2. Update the Plasmid Database with the number of the tube, the sample name, and where the sample came from

• Stocks

3. In a cryotube, add 750 mL of culture solution to 750 mL of 20% glycerol

4. Gently pipette up and down

5. Store in -80 C freezer in the yellow box (if storage location changes update the database)

Preparation for Sequencing

Introduction

How to prepare mini prepped DNA to be sent off for sequencing. The sequencing place used will do overnight sequencing. If the sample is got to them by 5 pm, they will have sequences back by 9 am the next morning.

Materials

• Mini prepped DNA
• Epi tubes (medium sized)

Procedure

• Preparation

1. Verify concentrations of the plasmid DNA samples

• DNA:

2. 8 uL of 100 ng/uL DNA per reaction

3. 2.2 x 8uL DNA per sample goes into each sequencing tube

• Reason: we have two primers

• Primers:

4. Two tubes, 1 per primer

5. Per reaction: 5 uL of 5 uMol

6. Calculate final volumes and concentrations to reach the above specifications and pipette

7. Send off for sequencing

Digest

Introduction

Get started by giving your protocol a name and editing this introduction.

Materials

• Restriction Enzymes
• CutSmart (10x)
• dH₂O
• DNA
• Ice

Procedure

• Restriction Digest

1. Create Master Mix ON ICE (25 uL total= 5 reactions)

• 5 uL of CutSmart

• 0.5 uL of Enzyme 1

• 0.5 uL of Enzyme 2

• 19 uL of dH₂O

2. Mix with DNA ON ICE (total of 8 uL)

• 4 uL of DNA

• 4 uL of Master Mix

3. Digest for 30 minutes at 37°C

4. Heat kill enzymes for 20 minutes at 80°C

• Example: pSB1C3

5. Create Master Mix ON ICE (25 uL total= 5 reactions)

• 5 uL of CutSmart

• 0.5 uL of EcoRI-HF

• 0.5 uL of PstI-HF

• 0.5 uL of DpnI (to specially methylate the RFP insert)

• 18.5 uL of dH₂O

6. Mix with DNA ON ICE (total of 8 uL)

• 4 uL of Backbone

• 4 uL of Master Mix

7. Digest for 30 minutes at 37°C

8. Heat kill enzymes for 20 minutes at 80°C

iGEM Oligos

Made with Benchling

Project: Duke iGEM 2016

Authors: Adam Yaseen

Date: 2016-06-07

Tuesday, 6/7/16

	A	B	C	D
1	ID#	Date	Description	Sequence
2	oIG01	6/7/2016	PAM additional sequencing primer	GTGACGATGTTGAGGTCCCT
3	oIG02	6/7/2016	TycA additional sequencing primer B	CGACACCCGCACAATTACG
4	oIG03	6/7/2016	TycA additional sequencing primer A	AAGGGCACAATGTTAGAGCA
5	oIG04	6/7/2016	TycA additional sequencing primer C	GCGATTGAGGCTGAAACCC
6	oIG05	6/7/2016	badA additional sequencing primer	GGCTGTACTCAAGTGGCTCT
7	oIG06	6/21/2016	badA point mutagenic forward primer	CAACTTACCTgATCGTGTACG
8	oIG07	6/21/2016	badA supporting mutagenic reverse primer	GACAAGAAAATATGCAGCATC
9	oIG08	6/21/2016	TBT insert mutagenic forward primer	tCAAATCCCGCATCTTGAC
10	oIG09	6/21/2016	TBT supporting mutagenic reversre primer	AATTTTCGTTAAGAGCAAACTTG
11	oIG10	6/22/2016	pSMART 1/2 Gibson forward primer	acgaattctctagatatcgctca
12	oIG11	6/22/2016	pSMART 1/2 Gibson reverse primer	tcgtccaacatcaatacaacct
13	oIG12	6/22/2016	pSMART 2/2 Gibson forward primer	ttgacgaggggaaattaatagg
14	oIG13	6/22/2016	pSMART 2/2 Gibson reverse primer	aagcttgatatcattcaggacga
15	oIG14	7/11/2016	G-block F	GGCTCGTCCTGAATGATATCA
16	oIG15	7/11/2016	G-block R	TCAGTATTGAGCGATATCTAGAGAATTC
17	oIG16	7/18/2016	TycA 1/2 R	ttgctcGATTGTCGGATAATTCAGAAGGTC
18	oIG17	7/18/2016	TycA 2/2 F	GGACCTTCTGAATTATCCGACA
19	oIG18	7/18/2016	TycA M1 F, fixing for golden gate	gaggAAGTACCAAAGCAACCCATAATAAG
20	oIG19	7/18/2016	TycA M1 R	CGAGACCTTTGTATTAAGAAACTATTAAG
21	oIG20	7/18/2016	TycA M2 F, fixing for golden gate	gcttTGAGACCGGCTTATCGGT
22	oIG21	7/18/2016	TycA M2 R	ACTAGTTCAGCGTAAAGTATTTG
23	oIG22	7/20/2016	G-Block M F	TGAGGCTCGTCCTGAATGATATCAAGCTTGAATTCGGAATTC,GAGGTGCGTAATTGTGCTGA
24	oIG23	7/20/2016	G-Block M R	TCAGTATTGAGCGATATCTAGAGAATTCGTCCTGCAG,CTTTTGGGTATAGCGTCGTGG
25	oIG24	7/20/2016	Tax10 M R	TCAGTATTGAGCGATATCTAGAGAATTCGTCCTGCAG,AGTACCGGTCTCATAGTGATCT
26	oIG25	7/22/2016	pSB1C3 F	TGCCACCTGACGTCTAAGAA
27	oIG26	7/22/2016	pSB1C3 R	TTGAGTGAGCTGATACCGCT
28	oIG27	7/26/2016	Amp2 F	GTAGCGGCCGCTGCAG
29	oIG28	7/26/2016	Amp1 R	AGAAGCGGCCGCGAATTC
30	oIG29	9/21/2016	pSB1C3 5' M F	CTGCAGTCCGGCAAAAAA
31	oIG30	9/21/2016	pSB1C3 5' M R	TACTAGTATATAAACGCAGAAAG
32	oIG31	9/21/2016	badA RBS M F	gtatcgattaaataaggaggaataaaccATGAACGCTGCTGCCGTA
33	oIG32	9/21/2016	bada RBS M R	attaatatatacctctttaattttctagaTTTGTATTAAGAAACTATTAAGCCTGTGAG
34	oIG33	9/21/2016	pSB1C3 3' M F	TCTAGAGCAATACGCAAAC
35	oIG34	9/21/2016	pSB1C3 3' M R	GAATTCCAGAAATCATCCTTAG
36	oIG35	9/21/2016	DBAT RBS M F	gtatcgattaaataaggaggaataaaccATGGCCGGATCTACCGAG
37	oIG36	9/21/2016	DBAT RBS M R	attaatatatacctctttaattttctagaAAGCGGAGACCTTTGTATTAAG
38	oIG37	9/21/2016	BAPT RBS M F	gtatcgattaaataaggaggaataaaccATGAAGAAGACTGGGAGTTTC
39	oIG38	9/21/2016	BAPT RBS M R	attaatatatacctctttaattttctagaAGCGCGAGACCTTTGTAT
40

Table1