Team:Groningen/Labjournal/PrimerList

CryptoGE®M
Team
Project
Biology
Computing
Human Practice
Acknowledgements

Primer List

No.Primer nameSequence 5'-3'Tm[°C]
1F-key sequenceCGGAATTCGCGGCCGCTTCTAGAGG67.9
2R-key sequenceGCCTGCAGCGGCCGCTACTAGTACC68.0
3F-message sequenceGCGTCGACGACCAAGCCTGCAAAAAC65.4
4R-message sequenceGCAAGCTTGTCGGTGGGTGCAATGC65.2
5F-qnrs1 e.coliGCAAGCTTGAATTCGCGGCCGCTTC67.6
6R-qnrs1 e.coliGCGGTACCCTGCAGCGGCCGCTACTAG70.9
7F-qnrs1 optimizedGCAAGCTTGAATTCGCGGCCGCTTC67.6
8R-qnrs1 optimizedGCGGTACCCTGCAGCGGCCGCTACTAG70.9
9amyE-prefixGCGGAATTCGCGGCCGCTTCTAGATGTTTGCAAAACGATTCAAAAC73.6
10amyE-suffixCGTACTAGTAGCGGCCGCTGCAGTCAATGGGGAAGAGAACCGCTTAAGC77.1
11F-gfp insertGCAGATCTAAATTGAATTCAACGCTCGAATGC65.0
12R-gfp insertGCGCTAGCATTACGCCAAGCTTGAATCTTGCTTG71.2
13F message sequencingGCGCGTACGATCTTTCAGCCGACTC65.9
14R message sequencingGCGCCGCGTTTCGGTGATGAAGAT65.3
15F key only amplifyGCGGACCAGCTCATGATTCTCAC60.9
16R key only amplifyGCGAGGAGGCTTACTTGTCTGCTTTCTTC65.9
17amyE int checkCTCTGCCAAGTTGTTTTGATAGAGTG59.2
18key only + prefixGAATTCGCGGCCGCTTCTAGAGGACCAAGCCTGCAAAAC73.6
19key only + suffixCTGCAGCGGCCGCTACTAGTAGTCGGTGGGTGCTATGGAGCGACAGAA78.3
20message prefixGAATTCGCGGCCGCTTCTAGAGGACCAAGCCTGCAAAAACAAAG74.4
21message suffixCTGCAGCGGCCGCTACTAGTAGTCGGTGGGTGCAATGCTTC76.0
22pATPI+prefixGCGAATTCGCGGCCGCTTCTAGAGTATAGGTGAAAATGTGAACATTC72.9
23pATPI+suffixCTGCAGCGGCCGCTACTAGTACAATTATCTGTCTCCTGATGAA73.0
24prefix sfGFP(Sp)GAATTCGCGGCCGCTTCTAGATGTCAAAAGGAGAAGAACTTTTTAC71.3
25suffix sfGFP(Sp)CTGCAGCGGCCGCTACTAGTACATTATTATTTATAAAGTTCGTCCATAC71.0
26VF2TGCCACCTGACGTCTAAGAA55.4
27VRATTACCGCCTTTGAGTGAGC55.4
28nucA+prefixGAATTCGCGGCCGCTTCTAGATGAAAAAGATTTGGCTGGCGCTGGCTG77.4
29nucA+suffixCTGCAGCGGCCGCTACTAGTATTATTGACCTGAATCAGCGTTGTC74.2
30Gb_insert_F2GTACATCTTTGTAACTTTATTATACGACTGGGCCTTTCGTTTTATCTGTTG72.0

*prefix and suffix are underlined

Oop top

×

Loading ...