Team:Paris Saclay/Experiments

Experiments

You can find here our materials and methods.

Contents

Antibiotics concentrations

The following concentrations of antibiotic were used to grow bacteria (on Petri dishes or liquid cultures):

Antibiotic Concentration (µg/mL)
Ampicillin 50
Chloramphenicol 30
Kanamycin 50
Spectinomycin 50
Streptomycin 50

Cloning PCR Products

Ligation with pJET 1.2/blunt vector

Component Volume (µL)
2x Reaction Buffer
 10
PCR product
 1
pJET 1.2/blunt cloning vector
 1
T4 DNA Ligase
 1
Nuclease-free water
 up to 19
Total Volume
 20
  1. Vortex the ligation mixture.
  2. Short spin (3- 5 seconds) of the same tube.
  3. Incubation of the ligation at RT for 5 minutes. (Note. For PCR products > 3kb, ligation can be prolonged to 30 min)
  4. The ligation mixture can be used directly for transformation. (Note. Keep the ligation mix at -20°C if transformation is postponed. Thaw on ice and mix carefully before transformation).

Heat shock competent cells

Preparation

Day 1 Inoculate cells in 3.5mL LB medium. Incubate at 37°C overnight.

Day 2 Measure culture OD at 600nm. Dilute cells in 250mL of LB medium so OD equals to 0.12. Incubate overnight at 20°C and 180rpm.

Day 3 Measure culture OD at 600nm and dilute to obtain OD600nm=0.6. Cells must be kept at 4°C during all following steps. Put on ice for 10min and centrifuge for 10min at 3000rpm and 4°C. Discard supernatant and resuspend cells in 80mL of fresh TB buffer. Keep on ice for 10min and centrifuge for 10min at 3000rpm and 4°C. Discard supernatant again and resuspend cells in 20mL of fresh TB buffer with 7% of DMSO. Keep on ice for 10min. Aliquot cells and freeze with liquid nitrogen. Keep at -80°C.

TB buffer recipe

HEPES 10mM
MnCl2 55mM
CaCl2 15mM
KCl 250mM
KOH up to pH6.7

Dissolve HEPES, CaCl2 and KCl in water. Adjust pH to 6.7 with KOH. Add MnCl2. Filter to sterilize and keep at 4°C.

Transformation

Add 1µL of plasmids to 50µL of competent cells (make a control tube without plasmid). Keep tubes on ice for 30min and heat shock at 42°C for 1min. Add 500µL of LB medium into each tube and incubate at 37°C for 1h. Spread cells on Petri dishes in duplicate and incubate at 37°C overnight.

Electro-competent cells

Preparation

Inoculate 15mL of LB with 200µL of an overnight cell culture. Incubate at 37°C and 180rpm until OD600nm reaches 0.6. Centrifuge cells for 10 minutes at 4000rpm. Wash twice with 10mL of 10% glycerol. Put cells in 200µL of 10% glycerol and use for electroporation.

Transformation

Use an Eppendorf Electroporator 2510 (tune to 2500V). Add 1µL of plasmids to 50µL of competent cells (make a control tube without plasmid). Place cells in a 1mm-cuvette, electroporate (the time constant should be close to 6ms) and recover cells with 1mL of cold LB medium. Incubate cells for 1h at 37°C. Spread cells on Petri dishes in two different concentrations and incubate at 37°C overnight.

Plasmid DNA extraction

Transfer 1.5mL of an overnight culture into an eppendorf tube. Centrifuge at 13000rpm for 1min to pellet the cells. Discard supernatant and resuspend cells in 100µL of TE buffer. Add 200µL of solution II and mix gently by inverting the tubes until lysate appears clear. Add 150µL of solution III and mixed gently. Keep the solution on ice for 10min. Centrifuge for 10min at 13000rpm and recover the supernatant. Add 100µL of phenol in each tubes to denature the proteins and vortex for 30s. Centrifuge the tubes for 7min at 13000rpm. Recover the aqueous phase. Add 2 volumes (900µL) of 100% ethanol and put at -20°C for 10min. Centrifuge the tubes again for 10min at 13000rpm. Discard supernatant and wash with 800µL of 70% ethanol to remove the remaining ions. Make sure that the pellet containing DNA remains at the bottom of the tubes. Centrifuge the tubes for 4min at 13000rpm and remove supernatants. Dry tubes in speedvac. Resuspend the pellet in 50µL of TE/RNAse. Keep the extracted plasmids at -20°C.

TE buffer recipe
Tris 10mM
EDTA 55mM


Solution II recipe (lysis solution) Keep for maximum 3 weeks.
SDS 1%
NaOH 0.1M


Solution III recipe (neutralization solution) CH3COOK 3M at pH4.8.

CH3COOK 5M 60mL
CH3COOH 11.5mL
water 28.5mL


TE/RNase Use only fresh solution.

RNase (10mg/mL) 5µL
TE 1mL

DNA extraction using the Invitrogen ChargeSwitch®-Pro Plasmid Miniprep Kit

Follow the steps below to purify plasmid DNA from 1-5ml of fresh overnight cultures using a microcentrifuge. All steps are performed at room temperature.

Before Starting

  • For a new kit, add Rnase A (provided in the kit) to the Resuspension Buffer and mix.
  • If necessary, warm the Lysis Buffer to 37°C to dissolve any precipitate.

Preparing the Sample

  1. Pellet cells from 1-5 ml of overnight culture.
  2. Resuspend in 250 µL of Resuspension Buffer premixed with Rnase A. No cell clumps should remain.
  3. Add 250 µL of Lysis Buffer. Mix well by gentle inversion. Do not vortex.
  4. Incubate at room temperature for 2-5 minutes. Do not incubate more than 5 minutes.
  5. Add 250µL of Precipation Buffer, and mix well until a white precipitate is formed.
  6. Centrifuge for 10 minutes at maximum speed to pellet the debris.

Binding the DNA

  1. Carefully transfer the supernatant from Step 2.6 above onto the ChargeSwitch®-Pro MiniPrep Colum inserted in a Collection Tube.
  2. Centrifuge the column/tube at maximun speed for 30-60 seconds.
  3. Remove the column from the tube and discard the flow-through. Re-insert the column in the same tube.

Washing the Column

  1. Add 750µL of Wash Buffer 1 to the column.
  2. Centrifuge the column/tube at the maximun speed for 30-60 seconds.
  3. Remove the column from the tube and discart the flow-through. Re-insert the column in the tube;
  4. Add 250µL of Wash Buffer 2 to the column.
  5. Centrifuge the column/tube at maximun speed for 30-60 seconds.
  6. remove the column from the tube. Discard the flow-through and the Collection Tube.

Eluting the DNA

  1. Insert the column into an Elution Tube (provided in the kit).
  2. Add 50-100µL of Elution Buffer onto the column.
  3. Centrifuge the column/tube at maximun speed for 30-60 seconds.
  4. Optional:Remove the Elution Tube and transfer the eluate back onto the same column. Re-insert the column in the tube and centrifugate at maximun speed for 30-60 seconds. This step is recommended for maximun recovery.
  5. The eluate contains your purified plasmid DNA. Store DNA at 4°C or -20°C.

Plasmid digestion

Mix 10µL of extracted plasmid with 2µL of digestion buffer and 7µL of water. Add 1µL of restriction enzyme. Incubate for 1 hour at 37°C (except for fast digest enzymes which need only 5 min of incubation at 37°C). Then digestion products were migrated on an agarose gel.

gBlock plasmid insertion

The following ratio should be over 7: \[ \frac{vector\ size}{insert\ size}\times\frac{insert\ concentration}{vector\ concentration} \]

Gently centrifuge gBlocks. Add 100µL of TE buffer (final concentration should be around 10ng/µL). Vortex and incubate at 50°C for 20min. Mix 7µL of gBlocks with 1µL of extracted and linearized plasmid, 1µL of ligase and 1µL of ligase buffer. Incubate for 1h at RT.

List of plasmids constructed

Plasmid name Backbone Insert Insert size (bp)
pPS16_001
 pUC19 gBlock 1.1 960
pPS16_002
 pUC19 gBlock 1.2 960
pPS16_003
 pUC19 gBlock 2.1 1023
pPS16_004
 pUC19 gBlock 2.2 808
pPS16_005
 pUC19 gBlock 3.1 960
pPS16_006
 pUC19 gBlock 3.2 960
pPS16_007
 pUC19 gBlock 4.1 706
pPS16_008
 pUC19 gBlock 4.2 1288
pPS16_009
 pUC19 gBlock GFP 1-9 862
pPS16_010
 pUC19 gBlock ATG linker RFB 374
pPS16_011
 pUC19 gBlock detection 1020
pPS16_012
 pUC19 gBlock St sgRNA 310
pPS16_013
 pUC19 gBlock ATG linker FKBP 419
pPS16_014
 pUC19 gBlock Nm sgRNA 362
pPS16_015
 pUC19 gBlock spacer1 900
pPS16_016
 pSB1C3 gBlock 1.1 + gblock 1.2 + gblock 2.1 + gblock 2.2 5715
pPS16_017
 pSB1C3 gBlock 3.1 + gblock 3.2 + gblock 4.1 + gblock 4.2 5835
pPS16_018
 pSB1C3 gBlock ATG linker FKBP + GFP 10 2784
pPS16_019
 pSB1C3 gBlock ATG linker FRB + GFP 11 2754
pPS16_020
 pSB1C3 gBlock GFP 1-9 2889
pPS16_021
 pSB1C3 gBlock ATG linker FRB + GFP 11 + gBlock ATG linker FKBP + GFP 10 3468
pPS16_022
 pSB1C3 gBlock ATG linker FRB + GFP 11 + GFP 1.9 3574
pPS16_023
 pSB1C3 gBlock ATG linker FRB + GFP 11 + gBlock ATG linker FKBP + GFP 10 + gBlock GFP 1-9 4287

List of BioBrick constructed

BioBrick name Plasmid name Backbone Insert Insert size (bp)
[http://parts.igem.org/Part:BBa_K2039000 BBa_K2039000] pPS16_018
 pSB1C3 gBlock ATG linker FKBP + GFP 10 2784
[http://parts.igem.org/Part:BBa_K2039001 BBa_K2039001] pPS16_019
 pSB1C3 gBlock ATG linker FRB + GFP 11 2754
[http://parts.igem.org/Part:BBa_K2039002 BBa_K2039002] pPS16_021
 pSB1C3 gBlock ATG linker FRB + GFP 11 + gBlock ATG linker FKBP + GFP 10 3468

List of plasmids used for the characterization of the previous part, BBa_K13372001

Construction Plasmid name
[http://parts.igem.org/Part:BBa_K1372001 BBa_K13372001] pSB1C3
pcl_TAA pcl99
pcl_TAG pcl99
pcl_Tq pcl99

DNA electrophoresis on agarose gel

Gel preparation

Mix agarose and TAE buffer to get a final concentration of 0.8%(w/v). Microwave for 1-2min in order to melt the agarose. Let cool down for 10min and add BET up to 5µg/mL. This solution can be kept at 61°C. Pour the solution into the casting tray. Place the comb and let cool down for about 30min. Place the gel in an electrophoresis unit full of TAE and load the samples plus a ladder. Migrate at 100V for 20min. Visualize DNA fragments with UV light.

Polymerase chain reaction

List of PCR primers

Name Description Sequence 5'→3'
iPS120 Reverse primer amplification gBlock 1-1 TCCAGGATGCGCAGGTTGTTCAGCTTG
iPS121 Forward primer amplification gBlock 1-2 GCAAGGCAGCGAGAGACCCCTGAC
iPS122 Reverse primer amplification gBlock 1-2 TCGCTGCCCAGCACCAGCACCTTG
iPS123 Forward primer amplification gBlock 2-1 GCTGCCCTTCAGCCGCACCTGGGAC
iPS124 Reverse primer amplification gBlock 2-1 TTCTGCACCTGCTCCACGCGCACGG
iPS125 Forward primer amplification gBlock 2-2 GACCGGCGTGTGGGTGCGCAACC
iPS126 Reverse primer amplification gBlock 3-1 GGCACGGTCAGGTTGTTCAGGTCGTTC
iPS127 Forward primer amplification gBlock 3-2 CACCGAGACCAAGAAGCTGAGCAAGG
iPS128 Reverse primer amplification gBlock 3-2 CTGTCGTCGAAGGTGATGCTCAGG
iPS129 Forward primer amplification gBlock 4-1 GCTGCCTGTACACCGGCAAGACCATC
iPS130 Reverse primer amplification gBlock 4-1 AACAGGATGCTGTCCTCGAACTCC
iPS131 Forward primer amplification gBlock 4-2 CAGCTACCAGGTGGACAGCAAGTTC
iPS132 Forward primer amplification St guide TTGACAGCTAGCTCAGTCCTAGGTATAATG
iPS133 Reverse primer amplification Nm guide CTAGCACTATCAGCGTTATTTAGCG
iPS134 Forward primer sequencing Cas plasmids from Addgene TTTACGGGCATGCATAAGGCTCG
iPS135 Reverse primer sequencing Cas plasmids from Addgene GTACCTAGGACTGAGCTAGCCG
iPS136 Reverse primer sequencing DS-SPCasN- from Addgene CTGCATGAAGTTCCGGTTGGC
iPS137 Forward primer sequencing DS-SPCasN- from Addgene GAAACAGCTCAAGAGGCGCCG
iPS138 Prefix GAATTCGCGGCCGCTTCTAGAG
iPS139 Suffix CTGCAGCGGCCGCTACTAGTA
iPS140 Primer to amplify gBlock 1.1 if prefix missed GAATTCGCGGCCGCTTCTAGAGTTGACAGCTAGCTCAGTCCT
iPS141 Primer to amplify gBlock 2.2 terminator and add Gibson sequence CCAAAGCTGGACTTCTAATAACGCTGATAGTGCTAGTGTAGATCGC
iPS142 Primer to amplify 2.2 and add linker TEV ACCCTGGAAGTACAGGTTTTCACCACCAGAACCACCACCACCGCGCACAGGAGGGCGCTTCTT
iPS143 Primer to amplify 3.1 and add linker TEV TGAAAACCTGTACTTCCAGGGTGGTTCTGGTGGTGGTGGTTCTAGCGACCTGGTGCTGGGC
iPS144 Primer to amplify 4.2 and add Gibson sequence CTATCAGCGTTATTAGAAGTCCAGCTTTGGCTTGTCTCC
iPS145 Forward primer to amplify FKBP and add Gibson sequence GAGAAATACTAGATGATGGGTGTTCAGGTTGAAAC
iPS146 Reverse primer to amplify FKBP and add Gibson sequence TCCACCTCCTACATCTTCCAGTTTCAGCAGTTCAAC
iPS147 Gibson to amplify linker L30 in gBlock 2.2 and add Gibson sequence CTGCTGAAACTGGAAGATGTAGGAGGTGGAGGT
iPS148 Gibson to amplify promoter in gBlock 1.1 and add Gibson sequence CTGAACACCCATCATCTAGTATTTCTCCTCTTTATTATTGTAC
iPS149 Forward primer to amplify FRB and add Gibson sequence GAGAAATACTAGATGATCCTGTGGCACGAAATG
iPS150 Reverse primer to amplify FRB and add Gibson sequence ATCGGATCCGAGCTCTTTAGAGATACGACGGAAAACG
iPS151 Primer to amplify linker L30 in gBlock 4.2 and add Gibson sequence CCGTCGTATCTCTAAAGAGCTCGGATCCGATGTA
iPS152 Primer to amplify promoter in gBlock 3.1 and add Gibson sequence GTGCCACAGGATCATCTAGTATTTCTCCTCTTTATTATTGTAC
iPS153 Forward primer to amplify gBlock detection CGAGTCCCTAAACCCTAACCCTAACCCTAACCC
iPS154 Reverse primer to amplify gBlock detection GCTAACTTAGTTCCAATCCATAAGACACCATTACT
iPS155 Forward primer to amplify gBlock spacer TGGATTGGAACTAAGTTAGCCTAGAGAATC
iPS156 Reverse primer to amplify gBlock spacer TAGCTGTCAATCGACTGCAATTCATTATGT
iPS157 Forward primer to amplify gBlock Nm sgRNA TTGCAGTCGATTGACAGCTAGCTCAGTCCT
iPS158 Reverse primer to amplify gBlock Nm sgRNA TAGCTGTCAACACTAGCACTATCAGCGTTATTTAGC
iPS159 Forward primer to amplify gBlock St sgRNA AGTGCTAGTGTTGACAGCTAGCTCAGTCCTAGGTATA
iPS160 Reverse primer to amplify gBlock St sgRNA GATGCCTCTACGCAGAAAGGCCCACCCG
iPS161 Forward primer to amplify plasmid pZA11 CCTTTCTGCGTAGAGGCATCAAATAAAACGAAA
iPS162 Reverse primer to amplify plasmid pZA11 GGTTAGGGTTTAGGGACTCGAGGTGAAG
iPS163 Reverse primer for construction pZA11-detection-sg RNA St & Nm GAAGCATTCCCGGGTTACAC
iPS164 Forward primer for construction pZA11-detection-sg RNA St & Nm - 50 bp GTGTAACCCGGGAATGCTTCCAACCACAGGCTAGATCTGT
iPS165 Forward primer for construction pZA11-detection-sg RNA St & Nm - 75 bp GTGTAACCCGGGAATGCTTCCGAGATATGGTTGCTAGATACG
iPS166 Forward primer for construction pZA11-detection-sg RNA St & Nm - 100 bp GTGTAACCCGGGAATGCTTCACCTCCAGATCGATTTTATCGG
iPS167 Forward primer for construction pZA11-detection-sg RNA St & Nm - 150 bp GTGTAACCCGGGAATGCTTCTGAGTCTATTACGACTTCAAGGC
iPS168 Forward primer for pSB1C3 verification (iGEM) CCACCTGACGTCTAAGAAAC
iPS169 Reverse primer for pSB1C3 verification (iGEM) GTATTACCGCCTTTGAGTGA
iPS170 Primer to verify gBlobk 2.1 - 2.2 junction GGTCACATGGAGACCGTGAAG
iPS171 Primer to verify gBlobk 4.1 - 4.2 junction TAGCCAGCTGAACCTGTGGA
iPS172 Primer to amplify pSB1C3 and add Gibson sequence TACTAGTAGCGGCCGCTG
iPS173 Primer to correct mutation 1 dCas9 St - GFP 11 and add Gibson sequence TGAACAACCTGACCGTGCCCACCGAGACCAAGAAGCTGAG
iPS174 Primer to correct mutation 1 dCas9 St - GFP 11 and add Gibson sequence CTCAGCTTCTTGGTCTCGGTGGGCACGGTCAGGTTGTTCA
iPS175 Primer to correct mutation 2 dCas9 St - GFP 11 and add Gibson sequence TCGAGGACAGCATCCTGTTCAGCTACCAGGTGGACAGCAA
iPS176 Primer to correct mutation 2 dCas9 St - GFP 11 and add Gibson sequence TTGCTGTCCACCTGGTAGCTGAACAGGATGCTGTCCTCGA
iPS83 4bases_Prefix ATTCGAATTCGCGGCCGCTTCTAGAG
iPS84 4bases_suffix AGTACTGCAGCGGCCGCTACTAGTA
iPS41 PSB1C3 amplification GCCGCTGCAGTCCGGCAAAAAA
iPS42 PSB1C3 amplification ATGAATTCCAGAAATCATCCTTAGCG
Ptet_R Primer for Gibson assembly plasmid TTCTGCTGATGTGCTCAGTATC
Link-TDdcas_F Primer for Gibson assembly link-TDdcas TGAAAACCTGTACTTCCAGGGTGGTTCTG
GTGGTGGTGGTTCTAAGAAGGAGATCAA
Ter_TDdcas_R Primer for Gibson assembly TDdcas-Ter CTTTAATGAATTCGGTCAGTGCGAGGAAT
GGTCAAGGTCCCAG
Tet-SPdcas_F Primer for Gibson assembly Tet-SPdcas GATACTGAGCACATCAGCAGGAACTTTTA
CTAGAGGAGGAGGCA
Link-SPdcas_R Primer for Gibson assembly SPdcas-link CACCCTGGAAGTACAGGTTTTCACCACCA
GAACCACCACCACCGTCTCCACCGAGCT
Ptet_F Primer for Gibson assembly plasmid CGCACTGACCGAATTCATTAAAG
1152_pheoF Forward primer amplification pUC19 insert GAATTCGAGCTCGGTACCC
1151_pheoR Reverse primer amplification pUC19 insert AAGCTTGCATGCCTGCAG

PCR with Taq PCRx DNA Polymerase (recombinant) or DreamTaq DNA Polymerase from ThermoFisher Scientific

  • Prepare enough PCR master mix for the number of colonies analyzed plus one extra. Mix the following reagents :
Components Volume
10x Taq buffer with KCl 2µL
MgCl2 (25mM) 1.2µL
dNTP (10mM) 2µL
Primers mix (10µM each) 1.2µL
Taq DNA polymerase 0.1µL
Nuclease-free water up to 20µL
Total volume 20µL

or

Components Volume
10X DreamTaq Green Buffer 2.5µL
dNTP (10mM) 2.5µL
Primers mix (10µM each) 1µL
DreamTaq DNA polymerase 0.13µL
Nuclease-free water up to 25µL
Total volume 25µL
  • Mix gently and aliquot 20μL or 25μL of the mix into the PCR tubes on ice.
  • Pick up an individual colony with a sterile pipette tip and resuspend it in 20μL or 25μL of the PCR master mix (or take 1μL of liquid preculture). Make a short strike with the same tip over culture plate to save the clone for repropagation.
  • Perform PCR as follow (annealing temperature can be calculated here):
Step Temperature Time
Initial denaturation 95°C 3min
30 cycles 94°C 30sec
Tannealing 30sec
72°C 1min/kb
Final Extension 72°C 7min
Hold 4°C $\infty$

PCR with Q5® High-Fidelity 2X Master Mix from NEB

  • Prepare enough PCR master mix for the number of colonies analyzed plus one extra. For each 25μl of reaction, mix the following reagents :
Components Volume
Q5 High-Fidelity 2X Master Mix 12.5µL
Primers mix (10µM each) 2.5µL
Template DNA (from extractions) 1µL
Nuclease-free water up to 25µL
Total volume 25µL
  • Mix gently and aliquot 25μl of the mix into the PCR tubes on ice.
  • Perform PCR as follow (annealing temperature can be calculated [http://tmcalculator.neb.com/#!/ here]):
Step Temperature Time
Initial denaturation 98°C 3min
30 cycles 98°C 10sec
Tannealing 20sec
72°C 30sec/kb
Final Extension 72°C 2min
Hold 4°C $\infty$

PCR with Phusion High-Fidelity DNA Polymerase from ThermoFisher Scientific

  • Prepare enough PCR master mix for the number of colonies analyzed plus one extra. For each 50μl of reaction, mix the following reagents :
Components Volume
Buffer 5x HF 10µL
dNTP (10mM) 1µL
Primers mix (10µM each) 5µL
Template DNA (from extractions) 1µL
Phusion DNA polymerase 0,25 µL
Nuclease-free water up to 50µL
Total volume 50µL
  • Mix gently and aliquot 50μl of the mix into the PCR tubes on ice.
  • Perform PCR as follow (annealing temperature can be calculated here):
Step Temperature Time
Initial denaturation 98°C 30sec
30 cycles 98°C 10sec
Tannealing 30sec
72°C 30sec/kb
Final Extension 72°C 7min
Hold 4°C $\infty$

PCR clean-up with NucleoSpin Gel and PCR Clean-up

Adjuste DNA binding condition

PCR sample must have 50-100µL and if not, water is added. 1 volume of sample was mixed with 2 volumes of Buffer NT1.

Binding the DNA

NucleoSpin gel and PCR Clean-up column were placed into collection tube (2mL). The sample are centrifuged at 11,000rpm for 30s. The flow-through is discarded and the column put back into the collection tube.

Wash silica membrane

700µL of Buffer NT3 is added in each column. The tubes were centrifuged at 11,000 rpm for 30s. The flow-through is discarded and the column put back into the collection tube. This step is repeated another time.

Dry silica membrane

The tubes were centrifuged 1min at 11,000 rpm to removed completely.

Elute DNA

The NuleoSpin gel and PCR clean-up column were put into new tube (1.5mL) and 30*L of Buffer NE was added. The tube were left incubated for 1 at RT and then centrifuged 1min at 11,000 rpm.

DNA extraction from agarose gels with NucleoSpin Gel and PCR Clean-up

Excise DNA fragment/solubilize gel slice

Take a clean scalpel to excise the DNA fragment from an agarose gel. Remove all excess agarose.

Determine the weight of the gel slice and transfer it to a clean tube. For each 100 mg of agarose gel<2% add 200µL Butter NT1.

For gels containing >2%, double the volume of Buffer NT1.

Incubate sample for 5-1à min at 50°C. Vortex the sample briefly every 2-3 min until the gel slice is completely dissolved!

Bind DNA

Place a NucleoSPin Gel and PCR Clean-Up Column into a Collection Tube (2mL) and load up to 700µL sample.

Centrifuge for 30s at 11 000x g. Discard flow-through and place the column nack into the collection tube.

PCR sample must have 50-100µL and if not, water is added. 1 volume of sample was mixed with 2 volumes of Buffer NT1.

Wash silica membrane

Add 700µL Buffer NT3 to the NucleoSpin Gel and PCR Clean-up Column. Centrifuge for 30s at 11 000 x g. Discard flow-through and place the column back into the collection tube.

Recommended: Repeat previous washing step to minimize chaotropic salt carry-over and low A260/A260.

Dry silica membrane

Centrifuge for 1 min at 1 000 x g to remove Buffer NT3 completely. Make sure the spin column does not come in contact with the flow-through while removing it from the centrifuge and the collection tube.

Elute DNA

Place the NucleoSpin Gel and PCR Clean-up Column into a new 1.5mL microcentrifuge tube. Add 15-30µL Buffer NE and incubate at room temperature (18-25°C) for 1 min. Centrifuge for 1 min at 11 000 x g.

Protein extraction from bacterial liquid culture for Western Blot

Mesure the OD of 1 mL overnight cell diluated at 1/10 with LB (make a blank with 1 mL LB). Once the OD is obtained for 1 mL culture, centrifuge 500 µL of culture for 10 minutes at maximum speed. The flow-through is discarded and lysis buffer for Western Blot is added in order to obtain 20 OD.

  • Volume of lysis buffer to be added: V = ODmeasured x 0,5 / 20
  • Lysis buffer for Western Blot (SDS 1%, Tris-HCl, DTT, pH = 6.8, bromophenol blue)


Then, put the sample 3 minutes at 95°C. If the middle is too sticky (there is a lot of DNA in E. coli), add 1 μl of MgCl2 and 1 μl of benzoate nuclease (Novgen) and put the middle at 37°C for 10 to 30 minutes.

Protein electrophoresis using the ThermoFisher Mini Gel Tank® device

Prepare gel cassette

1. Cut open the gel cassette pouch and remove the cassette.

2. Remove the cassette from the pouch and rinse it with deionized water.

3. Remove the gel comb by sliding the comb up one side at a time.

4. Remove the tape covering the slot at the lower portion of the cassette.

5. Use a pipette and rinse the wells 3 times with 1X running buffer Bolt® LDS Sample Buffer. Invert the gel and shake gently between rinses to remove buffer.

6. Fill the sample wells with running buffer Bolt® LDS Sample Buffer.

Assemble Mini Gel Tank and start electrophoresis

1. Place the base on a flat surface and snap the electrophoresis tank into the base.

2. Place the cassette clamp into the appropriate chamber of the electrophoresis tank with the anode connector (–) aligned to the center.

3. Fill the chamber with 1x running buffer Bolt® LDS Sample Buffer to the level of the cathode.

4. Place a gel cassette into a chamber with the wells facing towards you. Hold the cassette in a raised position, and close the clamp by moving the cam handle forward to secure the cassette.

5. Make sure that the wells are completely filled with 1X running buffer Bolt® LDS Sample Buffer. Load your samples and markers.

6. Hold the cassette and release the cassette clamp. Gently lower the cassette so that it rests on the bottom of the chamber, and close the cassette clamp.

7. Add 1X running buffer to the level of the fill line. Any excess buffer will spill over into the overflow compartment.

8. Fit your power supply with Novex® Power Supply Adapters if your power supply is not designed for use with covered or retractable power leads.

9. If only running one gel, make sure the unused chamber does not contain a cassette clamp.

10. Place the lid on the electrophoresis tank. The lid can only be firmly seated if all the connectors are properly aligned. If the lid is not properly seated, power will not be properly supplied to the system.

11. With the power off, connect the electrode cords to power supply {red to (+) jack, black to (–) jack}.

12. Turn on the power.

13. Set the power supply according to the type of buffer and number of mini gels you are using (refer to the instructions supplied with your mini gel).

Protein transfert using the ThermoFisher iBlot 2 Dry Blotting System®

Assembling the iBlot® 2 Transfer Stack

1. Open the lid of the device using the latch. Ensure the blotting surface is clean.

2. Unseal the iBlot® 2 Transfer Stack.

3. Separate the Top Stack and set it to one side of the bench with the transfer gel layer facing up. Keep the Bottom Stack in the transparent plastic tray.

4. Remove and discard the white separator from the Top Stack.

5. Place the Bottom Stack with the tray directly on the blotting surface. Align the tray on the blotting surface according to the type of iBlot® 2 Transfer Stack being used. The electrical contacts on the tray should be aligned with the corresponding electrical contacts on the blotting surface of the iBlot® 2 Gel Transfer Device.

6. Ensure there are no bubbles between the membrane and the transfer stack. Remove any trapped air bubbles using the Blotting Roller.

7. Open the gel cassette and immerse the pre-run gel briefly in deionized water (1–10 seconds) to facilitate easy positioning of the gel on top of the transfer membrane.

8. Shake off excess water, and place the pre-run gel on the transfer membrane of the Bottom stack as described:

• 1 midi gel on an iBlot® 2 Regular Transfer Stack • 2 mini gels (head-to-head) on an iBlot® 2 Regular Transfer Stack • 1 mini gel on an iBlot® 2 Mini Transfer Stack

9. Use the Blotting Roller to remove any air bubbles between the gel and the membrane.

10. Soak the iBlot® Filter Paper (use the appropriate filter paper for the size of the gel) in a clean container of deionized water.

11. Place the presoaked iBlot® Filter Paper on the pre-run gel. Use the Blotting Roller to remove any air bubbles between the filter paper and gel.

12. Take the Top Stack from the bench and place it on top of the presoaked filter paper with the copper electrode facing up (and transfer gel layer facing down). Remove any air-bubbles using the Blotting Roller.

13. Place the iBlot®2 Absorbent Pad on top of the iBlot® 2 Transfer Stack such that the electrical contacts are aligned with the corresponding electrical contacts on the blotting surface of the iBlot® 2 Gel Transfer Device.

14. Use the Blotting Roller to flatten any protrusions in the transfer stack.

15. Close the lid.

Performing blotting

After assembling the iBlot® 2 Gel Transfer Stack, perform blotting as described below. Perform blotting within 10– 15 minutes of assembling the stacks with the gel.

1. Close the iBlot® 2 Gel Transfer Device lid by pressing down firmly with two hands on the sides of the lid. Make sure the latch is secure, and ensure that the correct Method is selected.

2. Touch the Start icon on the screen to begin the transfer.

3. At the end of the transfer, the current automatically shuts off and the iBlot® 2 Gel Transfer Device signals the end of transfer with repeated beeping sounds, and a message on the digital display.

4. Touch the Done icon to stop the beeping.

5. Proceed to Disassembling the iBlot® 2 Transfer Stack.

Disassembling the iBlot® 2 Transfer Stack

To obtain good transfer and detection results, open the device and disassemble the stack within 30 minutes of ending the blotting procedure.

1. Open the lid of the iBlot® 2 Gel Transfer Device.

2. Discard the iBlot® 2 Absorbent Pad and Top Stack.

3. Carefully remove and discard the gel and filter paper (if used) as shown below. Remove the transfer membrane from the stack and proceed with the blocking procedure or stain the membrane (see next page for details).

4. Discard the Bottom stack.

Western-Blot using the Bind™ Flex Western Device

Prepare iBind™ Flex Card

1. Open the lid of the iBind™ Flex Western Device.

2. Verify the Midi Insert is inserted in the iBind™ Flex Western Device.

3. Open the packaging for the iBind™ Flex Card.

4. Hold the iBind™ Flex Card by the Stack, and remove the card from the packaging.

5. Place the iBind™ Flex Card on the Stage.

6. Pipette 10 mL of 1X iBind™ Flex/ iBind™ Flex FD Solution evenly across the Flow Region.

7. Pipette 2 mL of 1X iBind™ Flex/ iBind™ Flex FD Solution so that it pools at the center of the membrane region on the iBind™ Flex Card.

Place membrane on iBind™ Flex Card

1. Place the membrane on top of the pooled solution with the protein-side down, and the low molecular weight protein region closest to the Stack.

2. Use the blotting roller to remove any air bubbles between the membrane and the iBind™ Flex Card.

3. Make sure that the the membrane is within the boundaries of the membrane region. No part of the membrane should be directly under the Midi Insert.

4. Lower the lid of the iBind™ Flex Western Device and close the latch handle to lock the lid.

Add solutions to wells

1. Open the Well Cover and add solutions sequentially to the iBind™ Flex Wells starting with row 1:

Row Solution Volume per Well
1 Diluted primary antibody 4 ml
2 1X iBind™ Flex/ iBind™ Flex FD Solution 4 mL
2 Diluted secondary antibody 4 ml
4 1X iBind™ Flex/ iBind™ Flex FD Solution 12 ml

2. Close the Well Cover and write the start time of incubation on the lid of the iBind™ Flex Western device.

3. Incubate 2.5 hours or longer.

4. Open the Well Cover to verify that row 4 is completely empty (indicating that the run is over) before releasing the latch handle and opening the lid.

5. After incubation, rinse the membrane twice in 20 mL of distilled water for 2 minutes, and proceed to the appropriate detection protocol.

6.Discard iBind™ Flex Card after use.





Université Paris Sud
91405 Orsay, France
Copyright © 2016 iGEM Paris Saclay. All rights reserved All inspirations encouraged.
*This wiki was conceived during long nights of work and a great coffee experience in the beautiful Orsay, France.