|
|
| Line 1: |
Line 1: |
| − | <!--[if lt IE 8 ]><html class="no-js ie ie7" lang="en"> <![endif]-->
| + | <!--[if lt IE 8 ]><html class="no-js ie ie7" lang="en"> <![endif]--> |
| − | <!--[if IE 8 ]><html class="no-js ie ie8" lang="en"> <![endif]-->
| + | <!--[if IE 8 ]><html class="no-js ie ie8" lang="en"> <![endif]--> |
| − | <!--[if (gte IE 8)|!(IE)]><!-->
| + | <!--[if (gte IE 8)|!(IE)]><!--> |
| − | <html class="no-js" lang="en">
| + | <html class="no-js" lang="en"> |
| − | <!--<![endif]-->
| + | <!--<![endif]--> |
| − | <head>
| + | <head> |
| − | <!--- Basic Page Needs========================================================================= -->
| + | <!--- Basic Page Needs========================================================================= --> |
| − | <meta charset="utf-8">
| + | <meta charset="utf-8"> |
| − | <title>Standard</title>
| + | <title>Standard</title> |
| − | <meta name="viewport" content="width=device-width, initial-scale=1.0, maximum-scale=1.2, user-scalable=yes" />
| + | <meta name="viewport" content="width=device-width, initial-scale=1.0, maximum-scale=1.2, user-scalable=yes" /> |
| − | <meta name="description" content="Wiki of Peking iGEM 2016" />
| + | <meta name="description" content="Wiki of Peking iGEM 2016" /> |
| − | <meta name="author" content="Li Jiamian & Wang Yuqing">
| + | <meta name="author" content="Li Jiamian & Wang Yuqing"> |
| − | <meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
| + | <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> |
| − | <!-- Mobile Specific Metas===================================================================== -->
| + | <!-- Mobile Specific Metas===================================================================== --> |
| − | <meta name="viewport" content="width=device-width, initial-scale=1, maximum-scale=1">
| + | <meta name="viewport" content="width=device-width, initial-scale=1, maximum-scale=1"> |
| − | <!-- Fix Overwrite the original iGEM style=================================================== -->
| + | <!-- Fix Overwrite the original iGEM style=================================================== --> |
| − | <link href="https://2016.igem.org/Template:Peking/css/fix?action=raw&ctype=text/css" rel="stylesheet" />
| + | <link href="https://2016.igem.org/Template:Peking/css/fix?action=raw&ctype=text/css" rel="stylesheet" /> |
| − | <!-- CSS======================================================================================= -->
| + | <!-- CSS======================================================================================= --> |
| − | <link href="https://2016.igem.org/Template:Peking/css/bootstrap_min?action=raw&ctype=text/css" rel="stylesheet" />
| + | <link href="https://2016.igem.org/Template:Peking/css/bootstrap_min?action=raw&ctype=text/css" rel="stylesheet" /> |
| − | <link href="https://2016.igem.org/Template:Peking/css/style?action=raw&ctype=text/css" rel="stylesheet" />
| + | <link href="https://2016.igem.org/Template:Peking/css/style?action=raw&ctype=text/css" rel="stylesheet" /> |
| − | <!-- flexslider================================================================================ -->
| + | <!-- flexslider================================================================================ --> |
| − | <link rel="stylesheet" type="text/css" media="all" href="https://2016.igem.org/Template:Peking/css/fstyle?action=raw&ctype=text/css" />
| + | <link rel="stylesheet" type="text/css" media="all" href="https://2016.igem.org/Template:Peking/css/fstyle?action=raw&ctype=text/css" /> |
| − | <link rel='stylesheet' id='responsive-css' href='https://2016.igem.org/Template:Peking/css/responsive?action=raw&ctype=text/css' type='text/css' media='all' />
| + | <link rel='stylesheet' id='responsive-css' href='https://2016.igem.org/Template:Peking/css/responsive?action=raw&ctype=text/css' type='text/css' media='all' /> |
| − | <link rel='stylesheet' id='polaroid-slider-css' href='https://2016.igem.org/Template:Peking/css/fpolaroid?action=raw&ctype=text/css' type='text/css' media='all' />
| + | <link rel='stylesheet' id='polaroid-slider-css' href='https://2016.igem.org/Template:Peking/css/fpolaroid?action=raw&ctype=text/css' type='text/css' media='all' /> |
| − | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery?action=raw&ctype=text/javascript'></script>
| + | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery?action=raw&ctype=text/javascript'></script> |
| − | <!-- CSS======================================================================================= -->
| + | <!-- CSS======================================================================================= --> |
| − | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/default?action=raw&ctype=text/css">
| + | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/default?action=raw&ctype=text/css"> |
| − | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/layout?action=raw&ctype=text/css">
| + | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/layout?action=raw&ctype=text/css"> |
| − | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/media-queries?action=raw&ctype=text/css">
| + | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/media-queries?action=raw&ctype=text/css"> |
| − | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/priorstyle?action=raw&ctype=text/css">
| + | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/priorstyle?action=raw&ctype=text/css"> |
| | | | |
| − | </head>
| + | </head> |
| | | | |
| − | <body>
| + | <body> |
| − | <!-- Navigation -->
| + | <!-- Navigation --> |
| − | <div id="navigation" class="navbar navbar-fixed-top"> | + | <div id="navigation" class="navbar navbar-fixed-top"> |
| − | <div class="navbar-inner "> | + | <div class="navbar-inner "> |
| − | <div class="container no-padding"> | + | <div class="container no-padding"> |
| − | <a class="show-menu" data-toggle="collapse" data-target=".nav-collapse"><span class="show-menu-bar"></span> | + | <a class="show-menu" data-toggle="collapse" data-target=".nav-collapse"><span class="show-menu-bar"></span> |
| − | </a>
| + | </a> |
| − | <div id="logo" style="max-width:170px"><a class="" href="https://2016.igem.org/Team:Peking"></a></div> | + | <div id="logo" style="max-width:170px"><a class="" href="https://2016.igem.org/Team:Peking"></a></div> |
| − |
| + | |
| − | <div class="nav-collapse collapse"> | + | <div class="nav-collapse collapse"> |
| − | | + | |
| − | <li class="menu-1"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking" >Home</a></li> | + | <li class="menu-1"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking" >Home</a></li> |
| − | <li class="dropdown menu-2"><a class="dropdown-toggle" data-toggle="dropdown" href="#">Project</a> | + | <li class="dropdown menu-2"><a class="dropdown-toggle" data-toggle="dropdown" href="#">Project</a> |
| − | <ul class="dropdown-menu"> | + | <ul class="dropdown-menu"> |
| − | <li><a href="https://2016.igem.org/Team:Peking/Description" >Decription</a></li> | + | <li><a href="https://2016.igem.org/Team:Peking/Description" >Decription</a></li> |
| − | <li><a href="https://2016.igem.org/Team:Peking/Design" >Design</a></li> | + | <li><a href="https://2016.igem.org/Team:Peking/Design" >Design</a></li> |
| − | <li><a href="https://2016.igem.org/Team:Peking/Proof" >Proof of Concept</a></li> | + | <li><a href="https://2016.igem.org/Team:Peking/Proof" >Proof of Concept</a></li> |
| − | <li><a href="https://2016.igem.org/Team:Peking/Demonstrate" >Demonstrate</a></li> | + | <li><a href="https://2016.igem.org/Team:Peking/Demonstrate" >Demonstrate</a></li> |
| − | </ul>
| + | </ul> |
| − | </li>
| + | </li> |
| − | <li class="dropdown menu-3"><a class="dropdown-toggle" data-toggle="dropdown" href="#" >Parts</a> | + | <li class="dropdown menu-3"><a class="dropdown-toggle" data-toggle="dropdown" href="#" >Parts</a> |
| − | <ul class="dropdown-menu"> | + | <ul class="dropdown-menu"> |
| − | <li><a href="https://2016.igem.org/Team:Peking/Basic_Part" >Basic parts</a></li> | + | <li><a href="https://2016.igem.org/Team:Peking/Basic_Part" >Basic parts</a></li> |
| − | <li><a href="https://2016.igem.org/Team:Peking/Composite_Part" >Composite parts</a></li> | + | <li><a href="https://2016.igem.org/Team:Peking/Composite_Part" >Composite parts</a></li> |
| − | <li><a href="https://2016.igem.org/Team:Peking/Part_Collection" >Parts collection</a></li> | + | <li><a href="https://2016.igem.org/Team:Peking/Part_Collection" >Parts collection</a></li> |
| − | </ul>
| + | </ul> |
| − | </li>
| + | </li> |
| − | <li class="menu-4"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking/Human_Practices" >Practices</a></li> | + | <li class="menu-4"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking/Human_Practices" >Practices</a></li> |
| − | <li class="menu-5"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking/Collaborations" >Collaboration</a></li> | + | <li class="menu-5"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking/Collaborations" >Collaboration</a></li> |
| − | <li class="menu-6"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking/Model" >Modeling</a></li> | + | <li class="menu-6"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking/Model" >Modeling</a></li> |
| − | <li class="dropdown menu-7"><a class="dropdown-toggle" data-toggle="dropdown" href="#" >Lab</a> | + | <li class="dropdown menu-7"><a class="dropdown-toggle" data-toggle="dropdown" href="#" >Lab</a> |
| − | <ul class="dropdown-menu"> | + | <ul class="dropdown-menu"> |
| − | <li><a class="" href="https://2016.igem.org/Team:Peking/Team" >Team</a></li> | + | <li><a class="" href="https://2016.igem.org/Team:Peking/Team" >Team</a></li> |
| − | <li><a class="" href="https://2016.igem.org/Team:Peking/Attributions" >Attribution</a></li> | + | <li><a class="" href="https://2016.igem.org/Team:Peking/Attributions" >Attribution</a></li> |
| − | <li><a class="" href="https://2016.igem.org/Team:Peking/Notebook" >Notebook</a></li> | + | <li><a class="" href="https://2016.igem.org/Team:Peking/Notebook" >Notebook</a></li> |
| − | </ul>
| + | </ul> |
| − | </li>
| + | </li> |
| − | <li class="dropdown menu-8"><a class=" colapse- menu1" data-toggle="dropdown" href="https://2016.igem.org/Team:Peking/Interlab" >Interlab</a> | + | <li class="dropdown menu-8"><a class=" dropdown- toggle" data-toggle="dropdown" href="https://2016.igem.org/Team:Peking/Interlab" >Interlab</a> |
| − | </li>
| + | </li> |
| − | </div>
| + | |
| | </div> | | </div> |
| − | </div>
| + | </div> |
| − | </div>
| + | </div> |
| − | <!--/Navigation -->
| + | </div> |
| | + | <!--/Navigation --> |
| | | | |
| | | | |
| | | | |
| | | | |
| − | <!-- Page Title======================================================================== -->
| + | <!-- Page Title======================================================================== --> |
| − | | + | |
| − | | + | |
| − | <div class="twelve columns centered text-center"> | + | <div class="twelve columns centered text-center"> |
| − | <h1>Attributions<span>.</span></h1>
| + | <h1>Interlab<span>.</span></h1> |
| − | <p class="title1" style="text-align:center">The idea of this project was conceived by the team; advisors and instructors gave advices and suggestions on the implementation of this idea.</p> | + | <p class="title1" style="text-align:center">The Peking iGEM 2016 team is participating in the third year of the iGEM Interlab study along with about 100 teams.We focused on quantify expression of GFP in common, comparable or absolute units. </p> |
| − | </div>
| + | </div> |
| − | </div>
| + | </div> |
| − | </div>
| + | </div> |
| − | <!-- Page Title End-->
| + | <!-- Page Title End--> |
| | | | |
| | | | |
| | | | |
| | | | |
| − | <style type="text/css">
| + | <style type="text/css"> |
| | | | |
| − | #primary span{
| + | #primary span{ |
| − | display:block;
| + | display:block; |
| − | word-break:break-all
| + | word-break:break-all |
| − | }
| + | } |
| | | | |
| − | #page-wrap {
| + | #page-wrap { |
| − | width: 25%;
| + | width: 25%; |
| − | margin: 0px;
| + | margin: 0px; |
| − | position: relative;
| + | position: relative; |
| − | }
| + | } |
| | | | |
| − | #sidebar {
| + | #sidebar { |
| − | width: 25%;
| + | width: 25%; |
| − | margin-left: 0px;
| + | margin-left: 0px; |
| − | }
| + | } |
| − | @media (min-width:1024px){
| + | @media (min-width:1024px){ |
| − | #sidebar{position:relative;top:120px;max-width:200px;}}
| + | #sidebar{position:relative;top:120px;max-width:200px;}} |
| − | @media (max-width: 1023px){
| + | @media (max-width: 1023px){ |
| − | #sidebar{display:none;
| + | #sidebar{display:none; |
| − | }
| + | |
| − | #page-wrap{display:none;}
| + | |
| | } | | } |
| | + | #page-wrap{display:none;} |
| | + | } |
| | | | |
| − |
| + | .classic-title { |
| − | .classic-title {
| + | margin-bottom: 16px; |
| − | margin-bottom: 16px;
| + | border-bottom: 1px solid #eee; |
| − | border-bottom: 1px solid #eee;
| + | font-weight: 300; |
| − | font-weight: 300;
| + | } |
| − | }
| + | |
| | | | |
| | | | |
| − | .classic-title span {
| + | .classic-title span { |
| − | padding-bottom: 8px;
| + | padding-bottom: 8px; |
| − | border-bottom: 1px solid #383232;
| + | border-bottom: 1px solid #383232; |
| − | font-weight: 400;
| + | font-weight: 400; |
| − | }
| + | } |
| | + | |
| | | | |
| − | </style>
| |
| | | | |
| | + | </style> |
| | | | |
| − | <script type="text/javascript">
| |
| | | | |
| | + | <script type="text/javascript"> |
| | | | |
| − | function menuFixed(id){
| |
| − | var obj = document.getElementById(id);
| |
| − | var _getHeight = obj.offsetTop;
| |
| | | | |
| − | window.onscroll = function(){
| + | function menuFixed(id){ |
| − | changePos(id,_getHeight);
| + | var obj = document.getElementById(id); |
| − | }
| + | var _getHeight = obj.offsetTop; |
| − | }
| + | |
| − | function changePos(id,height){
| + | |
| − | var obj = document.getElementById(id);var windowBottom = $(window).scrollTop() + $(window).innerHeight();
| + | |
| − | if(w>=1024){
| + | |
| − | if($(window).scrollTop() + $(window).height() > $(document).height() - 230){
| + | |
| − | $('#sidebar').fadeOut("fast");}else{$('#sidebar').fadeIn("fast");}
| + | |
| − | }
| + | |
| − | var scrollTop = document.documentElement.scrollTop || document.body.scrollTop -230;
| + | |
| − | var windowBottom = $(window).scrollTop() + $(window).innerHeight();
| + | |
| − | var w = window.innerWidth;
| + | |
| | | | |
| − | if(scrollTop < height){ obj.style.position = 'relative';
| + | window.onscroll = function(){ |
| − | }else{
| + | changePos(id,_getHeight); |
| − | obj.style.position = 'fixed'; | + | } |
| − | }
| + | } |
| − | }
| + | function changePos(id,height){ |
| − | </script>
| + | var obj = document.getElementById(id);var windowBottom = $(window).scrollTop() + $(window).innerHeight(); |
| | + | if(w>=1024){ |
| | + | if($(window).scrollTop() + $(window).height() > $(document).height() - 230){ |
| | + | $('#sidebar').fadeOut("fast");}else{$('#sidebar').fadeIn("fast");} |
| | + | } |
| | + | var scrollTop = document.documentElement.scrollTop || document.body.scrollTop -230; |
| | + | var windowBottom = $(window).scrollTop() + $(window).innerHeight(); |
| | + | var w = window.innerWidth; |
| | | | |
| − | <script type="text/javascript">
| + | if(scrollTop < height){ obj.style.position = 'relative'; |
| − | window.onload = function(){
| + | }else{ |
| − | menuFixed('sidebar');
| + | obj.style.position = 'fixed'; |
| − | }
| + | } |
| − | </script>
| + | } |
| | + | </script> |
| | | | |
| | + | <script type="text/javascript"> |
| | + | window.onload = function(){ |
| | + | menuFixed('sidebar'); |
| | + | } |
| | + | </script> |
| | | | |
| − | </script>
| |
| | | | |
| | + | </script> |
| | | | |
| | | | |
| Line 178: |
Line 178: |
| | | | |
| | | | |
| − | <div id="page-content" class="row page">
| |
| − | <div id="primary" class="twelve columns">
| |
| − |
| |
| − | <section>
| |
| − | <div class="row">
| |
| − |
| |
| − |
| |
| − | <div class="three columns">
| |
| − | <div id="page-wrap">
| |
| − | <div id="sidebar" style="color:#000000">
| |
| | | | |
| − | <h4>Attributions</h4>
| + | <div id="page-content" class="row page"> |
| − | <ul>
| + | <div id="primary" class="twelve columns"> |
| − | <li><a href="#members">Members'</a></li>
| + | |
| − | <li><a href="#acknowledgement">Acknowledgement</a></li>
| + | <section> |
| − | <li><a href="#sponsors">Sponsors</a></li> | + | <div class="row"> |
| − | </ul>
| + | |
| − | </ul>
| + | |
| − | </div>
| + | <div class="three columns"> |
| − | </div>
| + | |
| | + | <div id="sidebar" style="color:#000000"> |
| | | | |
| − |
| + | <h4>Methods</h4> |
| | + | <ul> |
| | + | <li><a href="#background">Background</a></li> |
| | + | <li><a href="#design">Design</a></li> |
| | + | <li><a href="#materials">Materials</a></li> |
| | + | <li><a href="#protocol">Protocol</a></li> |
| | + | </ul> |
| | + | <h4>Results</h4> |
| | + | <ul> |
| | + | <li><a href="#sequencing">Sequencing</a></li> |
| | + | <li><a href="#data">Data</a></li> |
| | + | </ul> |
| | + | </ul> |
| | + | </div> |
| | + | </div> |
| | + | |
| | + | |
| | + | </div> |
| | + | |
| | + | |
| | + | |
| | + | <div class="nine columns"> |
| | + | |
| | + | <div> |
| | + | <a id="background"></a> |
| | + | <h3 class="classic-title";"><span>Background</span></h3> |
| | + | <p>“All of the 2016 iGEM teams are invited and encouraged to participate in the Third International InterLaboratory Measurement Study in synthetic biology.” Our team took part in this study which aimed to standardize the measurements of fluorescence in different labs. The main task was to quantify expression of GFP in common, comparable or absolute units. In our case, we measured fluorescence using plate reader. |
| | + | </p> |
| | + | </div> |
| | + | |
| | + | <div> |
| | + | <a id="design"></a> |
| | + | <h3 class="classic-title";"><span>Design</span></h3> |
| | + | <p>Fluorescence is widely used as a proxy for promoter activity by expressing fluorescent proteins such as green fluorescent protein (GFP). While this is an indirect measurement, it provides a useful insight into expression levels and has the significant advantage that it can be monitored continuously without disrupting cells. |
| | + | </p> |
| | + | <p>Fluorescence/OD600 is routinely used to give an adjustment of the relative expression per cell.</p> |
| | + | <p>We aim to do this using the supplied FITC as a standard reference material. You will measure the fluorescence of your instrument using a dilution series of this reference material to construct a standard curve. We have previously performed this standard curve on our own instrument alongside a standard curve for purified GFP. Using these standard curves alongside your own standard curve for FITC it is thus possible to transform your relative measurements of fluorescence into absolute measurements of GFP molecules.</p> |
| | + | <p>However, we aim to control for instrument variability, at least to some degree, by measuring a standard scattering solution of a mono-dispersed silica suspension (LUDOX). The objective is to see if a simple, single fixed-point measurement can be used as a ratiometric adjustment to provide greater uniformity in fluorescence/OD600 measurements across sites.</p> |
| | </div> | | </div> |
| | | | |
| − |
| |
| | | | |
| − | <div class="nine columns"> | + | |
| − |
| + | |
| − | <div>
| + | <h3 class="classic-title";"><span>Materials and methods</span></h3> |
| − | | + | <h5>Used plasmids</h5> |
| − | <h3 class="classic-title";"><span>Member’s Attributions</span></h3>
| + | <p style="margin:0 0 0 0">• Plasmid DNA (100 pg/uL in 10uL of Buffer EB)</p> |
| − | <p>All the data presented on this wiki was measured, collected, and analyzed by the team members. All the plasmids directly involved in the data presented on this wiki were constructed by the team members. The idea conceiving, content planning, execution, and result analysis of human practice were all done by the team members. The following is the detailed attribution:
| + | <div style="padding-left:20px"> |
| − | </p>
| + | <p> |
| − | <p>
| + | o Test Device 1: J23101.B0034.E0040.B0015 in pSB1C3<br> |
| − | <strong>LI Cheng</strong> is the team leader of Peking iGEM 2016. He participated in conceiving the project, took charge of troubleshooting, and managed the experiments, guaranteeing the normal operation of the lab.<br/>
| + | o Test Device 2: J23106.B0034.E0040.B0015 in pSB1C3<br> |
| − | <strong>YANG Xiaoyu</strong> was committed to ameliorate the paired dCas9 (PC) reporter system, namely, to enhance the sensitivity and robustness. Early in the project, he was also responsible for information gathering, experiment design, and lab management<br/>
| + | o Test Device 3: J23117.B0034.E0040.B0015 in pSB1C3<br> |
| | + | o Positive Control Device: I20270 in pSB1C3 Also located in Kit Plate 3, well 8P<br> |
| | + | o Negative Control Device: R0040 in pSB1C3 Also located in Kit Plate 2, well 6F<br> |
| | + | </p> |
| | + | </div> |
| | + | |
| | | | |
| − | <strong>BAI Ke</strong> was in charge of Human Practice and also worked in the wet lab to construct and prepare plasmids for gRNA in vitro transcription.<br/>
| + | <h5>Used strain</h5> |
| − | <strong>DONG Yiming</strong>
| + | <p>• <i>Escherichia coli</i> TOP10</p> |
| − | was responsible for designing and manufacturing the portable electronic device that convert optical signal into analogue electrical signal.<br/>
| + | |
| − | <strong>LI Yuexuan</strong> worked as the financial manager of the team. She was also responsible for plasmid construction and submission.<br/>
| + | <h5>Used material</h5> |
| − | <strong>YANG Changru</strong> was in charge of building <i>M.tuberculosis</i>-sensing system using Molecule Beacon. He was also engaged in the protein purification of dCas9 fusion proteins.<br/>
| + | <p> |
| − | <strong>ZHAO Shijun</strong> was in charge of measuring the luminescence intensity of PC reporter system. She analyzed the entire experimental data.<br/>
| + | • FITC Standard: one tube with dried down FITC for creating a FITC standard<br> |
| − | <strong>LV Nayun</strong> helped to complete the plasmid construction of sgRNA and was in part responsible for human practice.<br/>
| + | • LUDOX: one tube with 30% colloidal silica suspended in 1mL of water<br> |
| − | <strong>WANG Dingyu</strong> was in charge of the construction of CRISPR gRNA as well as RNA scaffold in the beginning. Later she was working on the purification of dCas9 fusion protein.<br/>
| + | • 1xPBS (phosphate buffered saline)<br> |
| − | <strong>LI Jiamian</strong> took the task of cloning dCas9-luciferase. She was also responsible for the testing of PC reporter system.<br/>
| + | • Terrific broth (at half strength: 0.5x TB) or can use LB (Luria Bertani) media as an alternative<br> |
| − | <strong>WEI Jingyi</strong> participated in plasmid construction, protein purification, and wiki building. She was also the designer of our PowerPoint slides.<br/>
| + | • Chloramphenicol (stock concentration 25 mg/mL dissolved in EtOH)<br> |
| − | <strong>WANG Yuqing</strong> was in charge of Modeling. His main task was to computationally search for the suitable guide sequences. Also, he was the lab manager for the normal operation of our lab.<br/>
| + | • 50 ml Falcon tube (or equivalent) or 250 ml shake flask for cell growth<br> |
| − | <strong>TENG Huaiyuan</strong>was in charge of Modeling. His main task was to computationally search for the suitable guide sequences. Also, he was the lab manager for the normal operation of our lab.<br/>
| + | • 1.5 ml eppendorf tubes for sample storage<br> |
| − | </p>
| + | • Ice bucket with ice<br> |
| − | </div>
| + | • Pipettes<br> |
| − |
| + | • 96 well plate <br> |
| − | <div>
| + | </p> |
| − | <a id="acknowledgement"></a>
| + | |
| − | <h3 class="classic-title";"><span>Acknowledgement</span></h3>
| + | <h5>Used machines</h5> |
| − | <p> We'd like to thank all those who have helped us over the summer, without whose sincere support The Uranium Reaper Project goals would have not been achieved. | + | |
| − | </p>
| + | • Thermo VARIOSKAN FLASH<br> |
| − |
| + | • MAPADA UV-3100PC SPECTROPHOTOMETER<br> |
| − | <h4>General support</h4>
| + | • YKKY（FM40）<br> |
| − | <p><strong>Prof. OUYANG Qi, Prof. LOU Chunbo, Dr. ZHANG Haoqian</strong> and other teachers helped us during our brainstorming and gave us useful suggestions.<br>
| + | • AISITE electro-heating standing-temperature cultivator<br> |
| − | <strong>Prof. OUYANG Qi</strong> and<strong> Prof. LIU Chunli</strong> kindly provided the laboratory to us for experiments.
| + | • HONOUR INCURATOR SHAKER<br> |
| − | </p>
| + | |
| | + | </p> |
| | | | |
| − | <h4>Materials support</h4>
| + | <h5>Used software</h5> |
| − | <p ><strong>Dr. ZHANG Wenbing</strong> provided us with the plasmid of 3B(Tri-SpyCatcher within 15X linker).<br> | + | |
| − | <strong> Prof. ZHOU Lu</strong> provided us with Uranyl-binding Protein, also called SUP.<br>
| + | • Microsoft Excel<br> |
| − | <strong>Prof. LIU Chunli</strong>allowed us to use his lab to do experiments on uranyl ion. The uranyl nitrate solution and Arsenazo III was provided by Prof. LIU.<br>
| + | |
| − | <strong>Prof. LOU Chunbo</strong> provided us with the strain B.Subtilis and mSA, heavy metal ions binding proteins: lead-binding protein, mercury-binding protein and cadmium-binding protein.<br>
| + | </p> |
| − | <strong>Dr. DU Pei</strong> provided the beads to us and gave us experimental guidance.<br>
| + | |
| − | <strong>BIT-China</strong> gave us the important Interlab kit.
| + | |
| − | </p>
| + | |
| | | | |
| − | <h4>Experiment equipment support</h4>
| + | <h5>Used methods</h5> |
| − | <p> <strong>Prof. OUYANG Qi</ strong> lent the Akta Pure to us for all proteins purification.< br> | + | <p style="margin:0 0 0 0"> • Calibration</ p> |
| − | <strong>Prof. CHANG Zengyi</strong> and <strong>Dr. WANG Qingsong</strong> provided us with Scanner and helped with the setup and scan of gels.<br>
| + | <div style="padding-left:45px"> |
| − | <strong>Prof. LIU Chunli</strong> provided us with Geiger counter to test the radiation level in and around our lab.<br>
| + | <p> |
| − | <strong>Core Facilities</strong>, School of Life Sciences, Peking University,assisted us with ITC.<br>
| + | o OD600 Reference point<br> |
| − | <strong>the State Key Laboratory of environmental simulation and pollution control</strong> provided the Aurora M90 mass spectrograph.
| + | o FITC fluorescence standard curve<br> |
| − | </p>
| + | o Test Device 3: J23117.B0034.E0040.B0015 in pSB1C3<br> |
| | + | </p> |
| | + | </div> |
| | + | <p style="margin:0 0 0 0">• Cell measurement</p> |
| | + | <div style="padding-left:45px"> |
| | + | <p> |
| | + | o Transformation<br> |
| | + | o Measurements <br> |
| | + | </p> |
| | + | </div> |
| | | | |
| − | <h4>Theoretical guidance</h4>
| |
| − | <p> <strong>ZHANG Yihao</strong> and <strong>WANG Yu</strong>,The wiki designers of Peking iGEM 2015,gave us many suggestions about wiki building.<br>
| |
| − | <strong>Dr. YU Daqi</strong> of Prof. OUYANG Qi’s lab helped us a lot in experimental operating and data analysis.<br>
| |
| − | <strong>Prof. ZHANG Wenbing, Prof. LOU Chunbo</strong> and <strong>Dr. YU Daqi</strong> kindly helped our team with modeling of the project.<br>
| |
| − | <strong>Prof. OUYANG Qi, Prof. LOU Chunbo, Dr. ZHANG Haoqian</strong> and <strong>ZHANG Yihao</strong>,the instructors, coached us for the presentation.<br>
| |
| − | <strong>Prof. LAI Luhua</strong> and <strong>Prof. RAO Yi</strong> participated in our presentation rehearsal and gave suggestions for revisions.
| |
| − | </p>
| |
| − |
| |
| − | <h4>Synthetic biology course</h4>
| |
| − | <p>From March to June, an introductory course of synthetic biology was hold by College of Life Sciences, Peking University.During the course, the teachers, also the instructors gave us kind guidance and judged our project design. In late June, we started in the lab to start our project.
| |
| − | </p>
| |
| − | </div>
| |
| − |
| |
| | | | |
| − | | + | </div> |
| − | | + | |
| − | <h3 class="classic-title";"><span>Sponsors</span></h3> | + | |
| − | | + | |
| − | <ul class="footer-social">
| + | <h3 class="classic-title";"><span>Protocols</span></h3> |
| − | <li class="col-md-6" id="PKU-administration" style="margin-bottom:25px;max-width:300px">
| + | <div style=" padding- left: 45px"> |
| − | <a href="http://dean.pku.edu.cn/pkudean/index.html"><img src="https://static.igem.org/mediawiki/2016/2/2e/T--Peking--images_sponsors_PKU_Administration.png"></a>
| + | < p><a href=" #">>> Calibration</a>< br> |
| − | </li>
| + | <a href=" #">>> Cell measurement</a></ p> |
| − | <li class="col-md-6" id="PKU-SLS" style="margin-bottom:25px;max-width:300px">
| + | |
| − | <a href=" http://www.bio.pku.edu.cn/"> <img src="https://static.igem.org/mediawiki/2016/7/74/T--Peking--images_sponsors_PKU_SLS.png"> </a> | + | |
| − | </li>
| + | |
| − | <li class="col-md-6" id="IMCAS" style="margin-bottom:25px;max-width:300px">
| + | |
| − | <a href="http://english.im.cas.cn/"><img src="https://static.igem.org/mediawiki/2016/7/77/T--Peking--images_sponsors_PKU_IMCAS.png"></a>
| + | |
| − | </li>
| + | |
| − | <li class="col-md-6" id="PKU-CQB" style="margin-bottom:25px;max-width:300px">
| + | |
| − | <a href=" http://cqb.pku.edu.cn/en/"> <img src="https://static.igem.org/mediawiki/2016/8/8e/T--Peking--images_sponsors_PKU_CQB.png"> </a> | + | |
| − | </li>
| + | |
| − | <!--<li class="col-md-6" id="BluePha" style="margin-bottom:25px; max-width:300px">
| + | |
| − | <a href="http://www.bluepha.com/"><img src="images/PKU/Bluepha-logo.png"></a>
| + | |
| − | </li>-->
| + | |
| − | <li class="col-md-6" id="PKU-CCME" style="margin-bottom:25px;max-width:300px">
| + | |
| − | <a href="http://www.chem.pku.edu.cn/index.php?styleid=2"><img src="https://static.igem.org/mediawiki/2016/b/ba/T--Peking--images_sponsors_PKU_CCME.png"></a>
| + | |
| − | </li>
| + | |
| − | </ul>
| + | |
| | </div> | | </div> |
| − | </div>
| |
| − | </div> <!-- row End -->
| |
| − |
| |
| | | | |
| − | </section> <!-- section end --> | + | |
| − | </div> <!-- primary end -->
| + | <h3 class="classic-title";"><span>Description</span></h3> |
| − | </div> <!-- page-content End-->
| + | <p>Plasmids containing promoters and GFP were taken from The 2016 DNA Distribution Kit and all devices were transformed into E.coli. Fluorescence of colonies was checked up under UV light. </p> |
| − | </div> <!-- Content End-->
| + | <p>5 ml of liquid LB-M medium with chloramphenicol were inoculated with two chosen colonies of each device. Liquid cultures were incubated for 16~18 hours in HONOUR INCURATOR SHAKER placed in incubator. OD of these cultures was measured by MAPADA UV-3100PC SPECTROPHOTOMETER and diluted to 0.02. Fluorescence of biological and also technical replicates was measured using Thermo VARIOSKAN FLASH following our protocol. |
| | + | </p> |
| | + | |
| | + | <h3 class="classic-title";"><span>Results</span></h3> |
| | + | <a id="sequencing"></a> |
| | + | <h5>Sequencing</h5> |
| | + | <p> • Device 1: J23101+I13504<br> |
| | + | • Device 2: J23106+I13504<br> |
| | + | • Device 3: J23117+I13504<br> |
| | + | • Positive Control Device: I20270 in pSB1C3<br> |
| | + | • Negative Control Device: R0040 in pSB1C3 </p> |
| | + | <p> |
| | + | >BBa_J23101 Part-only sequence (35 bp)<br> |
| | + | <span style="padding-left:45px">Tttacagctagctcagtcctaggtattatgctagc</span></p><p> |
| | + | >BBa_J23106 Part-only sequence (35 bp)<br> |
| | + | <span style="padding-left:45px">Tttacggctagctcagtcctaggtatagtgctagc</span></p><p> |
| | + | >BBa_J23117 Part-only sequence (35 bp)<br> |
| | + | <span style="padding-left:45px">Ttgacagctagctcagtcctagggattgtgctagc</span></p><p> |
| | + | >BBa_I13504 Part-only sequence (875 bp)<br> |
| | + | <span style="padding-left:45px">Aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata</span></p><p> |
| | + | >BBa_I20270 Part-only sequence (919 bp)<br> |
| | + | <span style="padding-left:45px">Ttgatggctagctcagtcctaggtacaatgctagctactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata</span></p><p> |
| | + | >BBa_R0040 Part-only sequence (54 bp)<br> |
| | + | <span style="padding-left:45px">tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac</span> |
| | + | </p></p> |
| | + | |
| | + | <a id="data"></a> |
| | + | <h5>Data</h5> |
| | + | <p><b>2.1 OD600 Reference Point</b></p> |
| | + | <p><b>2.2 FITC Standard Curve</b></p> |
| | + | <p><b>2.3 Normalisation</b></p> |
| | + | <p><b>2.4 Cell Measurement</b></p> |
| | + | |
| | + | |
| | + | <h5>Discussion</h5> |
| | + | <p>It is noticeable that the promoter of the Device 1 is strongest followed by the promoter of the Device 2 and Device 3.</p> |
| | + | |
| | + | <h3 class="classic-title";"><span>Appendix</span></h3> |
| | + | <p>Individuals responsible for conducting InterLab study |
| | + | • Dong Yiming measured the devices. |
| | + | • Li Cheng processed the data. |
| | + | </p> |
| | + | |
| | + | |
| | + | |
| | + | </div> |
| | + | </div> <!-- row End --> |
| | + | |
| | + | |
| | + | </section> <!-- section end --> |
| | + | </div> <!-- primary end --> |
| | + | </div> <!-- page-content End--> |
| | + | </div> <!-- Content End--> |
| | | | |
| | | | |
| Line 317: |
Line 376: |
| | | | |
| | | | |
| − | <!-- footer============================================================================== -->
| + | <!-- footer============================================================================== --> |
| − | <style>
| + | <style> |
| − | footer .copyright span:before {
| + | footer .copyright span:before { |
| − | content: "|";
| + | content: "|"; |
| − | padding-left: 10px;
| + | padding-left: 10px; |
| − | padding-right: 12px;
| + | padding-right: 12px; |
| − | color: #b4bbbb;
| + | color: #b4bbbb; |
| − | }
| + | } |
| − | footer .copyright span:after {
| + | footer .copyright span:after { |
| − | content: "|";
| + | content: "|"; |
| − | padding-left: 10px;
| + | padding-left: 10px; |
| − | padding-right: 12px;
| + | padding-right: 12px; |
| − | color: #b4bbbb;
| + | color: #b4bbbb; |
| − | }
| + | } |
| − | </style>
| + | </style> |
| − | <footer id="page-footer">
| + | <footer id="page-footer"> |
| − | | + | |
| − | <div class="twelve columns" > | + | <div class="twelve columns" > |
| − | | + | |
| − | <!--<li>© 2014 Sparrow</li> -->
| + | <!--<li>© 2014 Sparrow</li> --> |
| − | <li><a href="2016.igem.org/Team:Peking">Home</a> <a href="mailto:pkuigem2016@126.com">Contact</a></li> | + | <li><a href="2016.igem.org/Team:Peking">Home</a> <a href="mailto:pkuigem2016@126.com">Contact</a></li> |
| − | <span> ©2016 PEKING IGEM. All Rights Reserved.</span>
| + | <span> ©2016 PEKING IGEM. All Rights Reserved.</span> |
| − | <li><a href="http://getbootstrap.com/2.3.2/">Based on Bootstrap</a></li> | + | <li><a href="http://getbootstrap.com/2.3.2/">Based on Bootstrap</a></li> |
| − | </ul>
| + | </ul> |
| − | </div>
| + | </div> |
| − | <div id="go-top" style="display: block;"><a title="Back to Top" href="#">Go To Top</a></div> | + | <div id="go-top" style="display: block;"><a title="Back to Top" href="#">Go To Top</a></div> |
| − | </div>
| + | </div> |
| − | </footer> <!-- Footer End-->
| + | </footer> <!-- Footer End--> |
| | | | |
| | | | |
| − | <!-- Java Script======================================================================= -->
| + | <!-- Java Script======================================================================= --> |
| − | <script>window.jQuery || document.write('<script src="https://2016.igem.org/Template:Peking/Javascript/jquery_1_10_2_min?action=raw&ctype=text/javascript"><\/script>')</script>
| + | <script>window.jQuery || document.write('<script src="https://2016.igem.org/Template:Peking/Javascript/jquery_1_10_2_min?action=raw&ctype=text/javascript"><\/script>')</script> |
| − | <script type="text/javascript" src="https://2016.igem.org/Template:Peking/Javascript/jquery_migrate_1_2_1_min?action=raw&ctype=text/javascript"></script>
| + | <script type="text/javascript" src="https://2016.igem.org/Template:Peking/Javascript/jquery_migrate_1_2_1_min?action=raw&ctype=text/javascript"></script> |
| | | | |
| − | <script src="https://2016.igem.org/Template:Peking/Javascript/jquery_flexslider?action=raw&ctype=text/javascript"></script>
| + | <script src="https://2016.igem.org/Template:Peking/Javascript/jquery_flexslider?action=raw&ctype=text/javascript"></script> |
| − | <script src="https://2016.igem.org/Template:Peking/Javascript/doubleaptogo?action=raw&ctype=text/javascript"></script>
| + | <script src="https://2016.igem.org/Template:Peking/Javascript/doubleaptogo?action=raw&ctype=text/javascript"></script> |
| − | <script src="https://2016.igem.org/Template:Peking/Javascript/init?action=raw&ctype=text/javascript"></script>
| + | <script src="https://2016.igem.org/Template:Peking/Javascript/init?action=raw&ctype=text/javascript"></script> |
| | | | |
| − | <!--quotations from flexslider: start-->
| + | <!--quotations from flexslider: start--> |
| − | <script src='https://2016.igem.org/Template:Peking/Javascript/modernizr_js?action=raw&ctype=text/javascript'></script>
| + | <script src='https://2016.igem.org/Template:Peking/Javascript/modernizr_js?action=raw&ctype=text/javascript'></script> |
| − | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery_polaroid?action=raw&ctype=text/javascript'></script>
| + | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery_polaroid?action=raw&ctype=text/javascript'></script> |
| − | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery_easing?action=raw&ctype=text/javascript'></script>
| + | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery_easing?action=raw&ctype=text/javascript'></script> |
| − | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery_transform_0_8_0_min?action=raw&ctype=text/javascript'></script>
| + | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery_transform_0_8_0_min?action=raw&ctype=text/javascript'></script> |
| − | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery_preloader?action=raw&ctype=text/javascript'></script>
| + | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery_preloader?action=raw&ctype=text/javascript'></script> |
| − | <!--quotations from flexslider: end-->
| + | <!--quotations from flexslider: end--> |
| | | | |
| − | <!--quotations from black: start-->
| + | <!--quotations from black: start--> |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery?action=raw&ctype=text/javascript"></script>
| + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery?action=raw&ctype=text/javascript"></script> |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_sticky?action=raw&ctype=text/javascript"></script>
| + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_sticky?action=raw&ctype=text/javascript"></script> |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_easing_1_3_pack?action=raw&ctype=text/javascript"></script>
| + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_easing_1_3_pack?action=raw&ctype=text/javascript"></script> |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/bootstrap_min?action=raw&ctype=text/javascript"></script>
| + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/bootstrap_min?action=raw&ctype=text/javascript"></script> |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_patallax_1_1_3?action=raw&ctype=text/javascript"></script>
| + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_patallax_1_1_3?action=raw&ctype=text/javascript"></script> |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/appear?action=raw&ctype=text/javascript"></script>
| + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/appear?action=raw&ctype=text/javascript"></script> |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/modernizr?action=raw&ctype=text/javascript"></script>
| + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/modernizr?action=raw&ctype=text/javascript"></script> |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_prettyPhoto?action=raw&ctype=text/javascript"></script>
| + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_prettyPhoto?action=raw&ctype=text/javascript"></script> |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/isotope?action=raw&ctype=text/javascript"></script>
| + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/isotope?action=raw&ctype=text/javascript"></script> |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_bxslider_min?action=raw&ctype=text/javascript"></script>
| + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_bxslider_min?action=raw&ctype=text/javascript"></script> |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_cycle_all?action=raw&ctype=text/javascript" ></script>
| + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_cycle_all?action=raw&ctype=text/javascript" ></script> |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_maximage?action=raw&ctype=text/javascript"></script>
| + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_maximage?action=raw&ctype=text/javascript"></script> |
| − | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/scripts?action=raw&ctype=text/javascript "></script>
| + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/scripts?action=raw&ctype=text/javascript "></script> |
| − | <!--quotations from black: end-->
| + | <!--quotations from black: end--> |
| | | | |
| | | | |
| − | </body>
| + | </body> |
