Difference between revisions of "Team:NKU China/Notebook"

Line 42: Line 42:
 
         }
 
         }
  
−
         #notebook .ui-tabs-panel > .p, #notebook .ui-tabs-panel > ol {
+
         #notebook .ui-tabs-panel > .p, #notebook .ui-tabs-panel > ol, #notebook .ui-tabs-panel > ul {
 
             margin: 0.8rem 1.6rem;
 
             margin: 0.8rem 1.6rem;
 
         }
 
         }
Line 124: Line 124:
 
     </style>
 
     </style>
 
     <style title="table-theme.css">
 
     <style title="table-theme.css">
 +
        /*PCR system*/
 +
        .table-theme-0 {
 +
            /*color: rgb(49,132,155);*/
 +
            background-color:transparent;
 +
            border-collapse:collapse;
 +
            /*color:blue;*/
 +
        }
 +
 +
        .table-theme-0 tr {
 +
            background-color:transparent;
 +
        }
 +
 +
        #notebook .table-theme-0 tr td {
 +
            background-color:transparent;
 +
            border:0.05rem solid white;
 +
            border-bottom-width:0.05rem;
 +
        }
 +
 +
        #notebook .table-theme-0 tr:last-child td {
 +
            border-bottom-width:0.05rem;
 +
        }
 +
 +
        #notebook .table-theme-0 caption {
 +
            border:none;
 +
            background-color:transparent;
 +
        }
 +
 +
        .table-theme-0 caption {
 +
            /*border-top-color: rgb(75,172,198);*/
 +
            /*border-bottom-color: rgb(75,172,198);*/
 +
        }
 +
 +
        .table-theme-0 table tr:last-child td {
 +
            /*border-bottom-color: rgb(75,172,198);*/
 +
        }
 +
 +
        .table-theme-0 tr:nth-child(odd) {
 +
            /*background-color: rgb(210,234,241);*/
 +
        }
 +
 +
        .table-theme-0 tr:nth-child(even) {
 +
        }
 +
 
         /*PCR system*/
 
         /*PCR system*/
 
         .table-theme-1 {
 
         .table-theme-1 {
Line 264: Line 307:
 
                 heightStyle: 'content',
 
                 heightStyle: 'content',
 
                 collapsible: true,
 
                 collapsible: true,
−
                 active: 15,
+
                 active: 13,
 
                 icons: false,
 
                 icons: false,
 
             });
 
             });
Line 273: Line 316:
 
                         event: "mouseover",
 
                         event: "mouseover",
 
                         heightStyle: 'content',
 
                         heightStyle: 'content',
−
                         active:2,
+
                         active:0,
 
                     });
 
                     });
 
                 }
 
                 }
Line 2,486: Line 2,529:
 
                         </ul>
 
                         </ul>
 
                         <div id="fragment14">
 
                         <div id="fragment14">
−
                              
+
                             <div class="p">Since the controller we constructed with GR286 did not demonstrate positive results, we decided to substitute GR286 with <i>Escherichia coli</i> whose AI-2 metabolic pathway had been elucidated as the chassis of our controller.</div>
 +
                            <ul>
 +
                                <li>
 +
                                    The strains to be constructed are shown in the tables below.
 +
                                    <div class="flex-container">
 +
                                        <div class="table-wrapper">
 +
                                            <table class="table-theme-0" style="font-weight:bold">
 +
                                                <caption>AI-2 supplier</caption>
 +
                                                <tr>
 +
                                                    <td></td>
 +
                                                    <td>LuxS</td>
 +
                                                    <td>Mtn</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td>pTrcHisB</td>
 +
                                                    <td style="font-weight:normal">Native</td>
 +
                                                    <td style="font-weight:normal">Native</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td>pLuxS</td>
 +
                                                    <td>Induced</td>
 +
                                                    <td style="font-weight:normal">Native</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td>pLuxS-Mtn</td>
 +
                                                    <td>Induced</td>
 +
                                                    <td>Induced</td>
 +
                                                </tr>
 +
                                            </table>
 +
                                        </div>
 +
                                        <div class="table-wrapper">
 +
                                            <table class="table-theme-0" style="font-weight:bold">
 +
                                                <caption>AI-2 consumer</caption>
 +
                                                <tr>
 +
                                                    <td></td>
 +
                                                    <td>LsrACDB</td>
 +
                                                    <td>LsrK</td>
 +
                                                    <td>LsrFG</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td>pTrcHisB</td>
 +
                                                    <td style="font-weight:normal">Native</td>
 +
                                                    <td style="font-weight:normal">Native</td>
 +
                                                    <td style="font-weight:normal">Native</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td>pLsrACDB</td>
 +
                                                    <td>Induced</td>
 +
                                                    <td style="font-weight:normal">Native</td>
 +
                                                    <td style="font-weight:normal">Native</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td>pLsrFG</td>
 +
                                                    <td style="font-weight:normal">Native</td>
 +
                                                    <td style="font-weight:normal">Native</td>
 +
                                                    <td>Induced</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td>pLsrK</td>
 +
                                                    <td style="font-weight:normal">Native</td>
 +
                                                    <td>Induced</td>
 +
                                                    <td style="font-weight:normal">Native</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td>pLsrACDBFG</td>
 +
                                                    <td>Induced</td>
 +
                                                    <td style="font-weight:normal">Native</td>
 +
                                                    <td>Induced</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td>pLsrACDBK</td>
 +
                                                    <td>Induced</td>
 +
                                                    <td>Constitutive</td>
 +
                                                    <td style="font-weight:normal">Native</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td>plsrACDBFGK</td>
 +
                                                    <td>Induced</td>
 +
                                                    <td>Constitutive</td>
 +
                                                    <td>Induced</td>
 +
                                                </tr>
 +
                                            </table>
 +
                                        </div>
 +
                                    </div>
 +
                                </li>
 +
                                <li>
 +
                                    The sequences of <i>lsrACDB</i>, <i>lsrFG</i>, <i>lsrK</i>, <i>luxS</i>, <i>mtn</i> gene in <i>E.coli K12</i> were searched in NCBI, and primers were designed according to the gene sequences. The primers used in the construction of AI-2 controller are shown in the table below.
 +
                                    <div class="flex-container">
 +
                                        <div class="table-wrapper">
 +
                                            <table class="table-theme-0" style="word-break:break-all">
 +
                                                <caption>Primers used in the construction of AI-2 controller</caption>
 +
                                                <tr>
 +
                                                    <td style="min-width:7.5rem">Primer name</td>
 +
                                                    <td>Sequence</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td><i>lsrACDBFG</i>1-F</td>
 +
                                                    <td>CGACGATGACGATAAGGATCCATGCAAACGAGTGATACCCGC</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td><i>lsrACDBFG</i>1-R</td>
 +
                                                    <td>TGTTTGGCGTTTCCGGCAGCGGTGCGGAGAGC</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td><i>lsrACDBFG</i>2-F</td>
 +
                                                    <td>TGTTTGGCGTTTCCGCGATTG</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td><i>lsrACDBFG</i>2-R</td>
 +
                                                    <td>GCACTCTCACACCACGTTGCATGGCGCGTTTC</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td><i>lsrACDBFG</i>3-F</td>
 +
                                                    <td>GTGGTGTGAGAGTGCTGAC</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td><i>lsrACDBFG</i>3-R</td>
 +
                                                    <td>ACCAGCTGCAGATCTCGAGCTCGTCACGGCATCAACCCATTGAAC</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td><i>lsrACDB</i>1-F</td>
 +
                                                    <td>CGACGATGACGATAAGGATCCATGCAAACGAGTGATACCCGC</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td><i>lsrACDB</i>1-R</td>
 +
                                                    <td>ACCGGAACCGCCGAGCAAACTAATGCCGCCCAGCAC</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td><i>lsrACDB</i>2-F</td>
 +
                                                    <td>CTCGGCGGTTCCGGTGCGAT</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td><i>lsrACDB</i>2-R</td>
 +
                                                    <td>ACCAGCTGCAGATCTCGAGCTCGTCAGAAATCGTATTTGCCG</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td><i>luxS</i>-F</td>
 +
                                                    <td>ATGACGATAAGGATCCGAGCTCGATGCCGTTGTTAGATAGCTTC</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td><i>luxS</i>-R</td>
 +
                                                    <td>GGACTCCCCCGGGGGACTAAATGTGCAGTTCCTGCAACTTC</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td><i>mtn</i>-F</td>
 +
                                                    <td>TCCCCCGGGGGAGTCCTCTCCCGCGTGAGAAATAC</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td><i>mtn</i>-R</td>
 +
                                                    <td>TATGGTACCAGCTGCAGATCTCTTAGCCATGTGCAAGTTTCTG</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td><i>luxS</i>-Fd</td>
 +
                                                    <td>GGAATTCCCTAAATGTGCAGTTCCTGCAACTTC</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td><i>luxS</i>-Rv</td>
 +
                                                    <td>GGGGTACCCCATGCCGTTGTTAGATAGCTTCACAG</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td><i>lsrK</i>-Fd</td>
 +
                                                    <td>GGGGTACCCCATGGCTCGACTCTTTACC</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td><i>lsrK</i>-Rv</td>
 +
                                                    <td>GGAATTCCCTATAACCCAGGCGCTTTCC</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td><i>lsrFG</i>-Fd</td>
 +
                                                    <td>CGGGATCCCGATGGCAGATTTAGACGATATTAAAGATGG</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td><i>lsrFG</i>-Rv</td>
 +
                                                    <td>GAAGATCTTCTCACGGCATCAACCCATTGAAC</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td><i>lsrK</i>-F</td>
 +
                                                    <td>AACTGCAGAACCAATGCATTGGTTTACGGCTAGCTCAGTCCTAGGTATAGTGCTAGCAAAGAGGAGAAAATGGCTCGACTCTTTACC</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td><i>lsrK</i>-R</td>
 +
                                                    <td>TTCGAACTATAACCCAGGCGCTTTCC</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td>BK-JC-F</td>
 +
                                                    <td>TTTCAGTGTATGTCGCGGATGC</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td>GK-JC-F</td>
 +
                                                    <td>TTGCGCTTCGATGTCTTACAGG</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td>pTrc-JC-F</td>
 +
                                                    <td>TGGGCACTCGACCGGAATTATC</td>
 +
                                                </tr>
 +
                                                <tr>
 +
                                                    <td>pTrc-JC-R</td>
 +
                                                    <td>GCTACTGCCGCCAGGCAAATTC</td>
 +
                                                </tr>
 +
                                            </table>
 +
 
 +
                                        </div>
 +
                                    </div>                           
 +
                                </li>
 +
                            </ul>
 
                         </div>
 
                         </div>
 
                         <div id="fragment14-0">
 
                         <div id="fragment14-0">

Revision as of 06:51, 15 October 2016

50μL PCR system ×2
2× Taq Master Mix 25μL
C2-F 2μL
C2-R 2μL
p-C2 2μL
ddH2O 19μL
Total 50μL
PCR reaction condition
94oC 10 min
94oC 30 sec
58oC 15 sec 30 cycles
72oC 30 sec
72oC 10 min
16oC ∞
20μL ligation system
10× DNA Ligase Buffer 2μL
T4 DNA Ligase 1μL
pMD19 T-Simple Vector 1μL
C2-luxS 4μL
ddH2O 12μL
Total 20μL
Reaction condition: 16oC overnight
20μL digestion system
10× FastDigest Buffer 2μL
BamH Ⅰ 1μL
T-lsrACDB 1μL
ddH2O 7μL
Total 20μL
Reaction condition: 37oC for 40 min
100μL methylation system
10× BamH Ⅰ methyltransferase Buffer 10μL
BamH Ⅰ methyltransferase 1μL
S-adenosylmethionine 0.5μL
pWH-C2-luxS 80μL
ddH2O 8.5μL
Total 100μL
Reaction condition: 37oC for 1 hour
Groups divided in this experiment
GR286 wild strain as control group
GR286ΔluxS GR286 without luxS gene
pWH-luxS luxS overexpression plasmid in GR286; without induced by xylose
pWH-luxS + xyl luxS overexpression plasmid in GR286; induced by xylose
pWH1520 empty plasmid in GR286 as control group
pHT-lsrACDB lsrACDB overexpression plasmid in GR286ΔluxS
pHT-01 empty plasmid in GR286ΔluxS as control group
Selection of positive clones by colony PCR
(No.1 is positive control, No.2-6 are experimental groups. The result showed that we failed to transformed the plasmid pWH-C2-luxS into GR286)
Laboratory Notes
☞☟ Week1 (May 16–May 22)
In order to make sure the efficiency of our "consumer", we should first knock out the luxS gene in our engineering bacteria GR286(a simplified strain of Bacillus amyloliquefaciens LL3). We used a markerless gene replacement method to knock out the luxS gene.
Construction of targeting vector : the upstream and downstream of luxS gene were combined by over-lapping PCR and ligated into plasmid pKSU.
pKSU-ΔluxS was transformed into GR286, and positive clones were selected.
20μL PCR system
2× Taq Master Mix 10μL
pKSU-F 1μL
pKSU-R 1μL
Bacterium solution 1μL
ddH2O 7μL
Total 20μL
PCR reaction condition
94oC 10 min
94oC 30 sec
58oC 30 sec 30 cycles
72oC 1 min 30 sec
72oC 10 min
16oC ∞
Selection of positive clones by PCR
The transformants were cultured at 42oC with chloramphenicol to select single-crossover clones.
20μL PCR system
2× Taq Master Mix 10μL
luxS-up-F 1μL
luxS-dn-R 1μL
Bacterium solution 1μL
ddH2O 7μL
Total 20μL
PCR reaction condition
94oC 10 min
94oC 30 sec
56oC 30 sec 30 cycles
72oC 2 min
72oC 10 min
16oC ∞
Selection of single-crossover clones by PCR
(No.1-4 are single-crossover strains,
No.5 is positive control.)
☞☟ Week2 (May 23–May 29)
The single-crossover strains were then cultured in LB medium and passaged every 12 hours for 4 generations.
The last generation was cultured in medium with 5-fluorouracil to select double-crossover clones. Regretfully, we didn't get the double-crossover clones.
20μL PCR system
2× Taq Master Mix 10μL
luxS-up-F 1μL
luxS-dn-R 1μL
Bacterium solution 1μL
ddH2O 7μL
Total 20μL
PCR reaction condition
94oC 10 min
94oC 30 sec
56oC 30 sec 30 cycles
72oC 2 min
72oC 10 min
16oC ∞
Selection of double-crossover clones by PCR
(No.1-5 are experimental groups, No.6 is wild GR286. The result showed that we failed to get the double-crossover clones.)
☞☟ Week3 (May 30–Jun 05)
Transformants were cultured at 42oC with chloramphenicol again and the single-crossover clones were selected successfully.
20μL PCR system
2× Taq Master Mix 10μL
luxS-up-F 1μL
luxS-dn-R 1μL
Bacterium solution 1μL
ddH2O 7μL
Total 20μL
PCR reaction condition
94oC 10 min
94oC 30 sec
56oC 30 sec 30 cycles
72oC 2 min
72oC 10 min
16oC ∞
Selection of single-crossover clones by PCR
(No.1&2&4 are single-crossover strains,No.5 is positive control. )
The single-crossover strains were then cultured in LB medium and passaged every 12 hours for 4 generations.
The last generation was cultured in medium with 5-fluorouracil to select double-crossover clones. We finally obtained our aimed strain—GR286ΔluxS.
20μL PCR system
2× Taq Master Mix 10μL
luxS-up-F 1μL
luxS-dn-R 1μL
Bacterium solution 1μL
ddH2O 7μL
Total 20μL
PCR reaction condition
94oC 10 min
94oC 30 sec
56oC 30 sec 30 cycles
72oC 2 min
72oC 10 min
16oC ∞
Selection of ΔluxS clones by PCR
(The No.4 is the aimed strain&horbar;GR286ΔluxS)
☞☟ Week4 (Jun 06–Jun 12)
The GR286ΔluxS strain was cultured and made competent for future use.
The lsrACDB gene from Bacillus thuringiensis was cloned and ligated to T-vector.
50μL PCR system ×2
2× Taq Master Mix 25μL
lsrACDB-F 2μL
lsrACDB-R 2μL
Bacterium solution 2μL
ddH2O 19μL
Total 50μL
PCR reaction condition
94oC 10 min
94oC 30 sec
57oC 30 sec 30 cycles
72oC 4 min 30 sec
72oC 10 min
16oC ∞
20μL ligation system
10× DNA Ligase Buffer 2μL
T4 DNA Ligase 1μL
pMD19 T-Simple Vector 1μL
lsrACDB 3μL
ddH2O 13μL
Total 20μL
Reaction condition: 16oC overnight
The T-lsrACDB was transformed into DH5α and plate was coated, and then positive clones were selected.
20μL PCR system
2× Taq Master Mix 10μL
M13F 1μL
M13R 1μL
Bacterium solution 1μL
ddH2O 7μL
Total 20μL
PCR reaction condition
94oC 10 min
94oC 30 sec
59oC 30 sec 30 cycles
72oC 4 min 30 sec
72oC 10 min
16oC ∞
Selection of positive clones by PCR
(No. 3&4 are positive results)
After restriction enzyme digestion verification, the positive clones were then sequenced. Unfortunately, the sequencing result showed some mutations inside the target gene.
20μL digestion system
10× FastDigest Buffer 2μL
BamH Ⅰ 1μL
T-lsrACDB 1μL
ddH2O 7μL
Total 20μL
Reaction condition: 37oC for 40 min
Restriction enzyme digestion verification
(No.1 are lsrACDB fragement, No.2 are linearized T-vector.)
The gene cloning process was repeated but there were still some mutations.
We finally decided to request the gene company to synthesize the lsrACDB gene.
☞☟ Week5 (Jun 13–Jun 19)
This week, we started to construct another controller―supplier.
A strong promoter C2 was cloned from former kit and luxS gene was cloned from GR286.
50μL PCR system ×2
2× Taq Master Mix 25μL
C2-F 2μL
C2-R 2μL
p-C2 2μL
ddH2O 19μL
Total 50μL
PCR reaction condition
94oC 10 min
94oC 30 sec
58oC 15 sec 30 cycles
72oC 30 sec
72oC 10 min
16oC ∞
50μL PCR system ×2
2× Taq Master Mix 25μL
luxS-F 2μL
luxS-R 2μL
Bacterium solution 1μL
GR286 2μL
ddH2O 19μL
Total 50μL
PCR reaction condition
94oC 10 min
94oC 30 sec
59oC 30 sec 30 cycles
72oC 30 sec
72oC 10 min
16oC ∞
PCR cloning product of promoter C2 and gene luxS
(NO.1&2 are C2, No.3&4 are luxS)
Two segments were fused together by fusion PCR and ligated into T-vector. After that, the vector was transformed into DH5α.
50μL PCR system ×2
2× Taq Master Mix 25μL
C2-F 2μL
luxS-R 2μL
C2 2μL
luxS 2μL
ddH2O 17μL
Total 50μL
PCR reaction condition
94oC 10 min
94oC 30 sec
59oC 30 sec 30 cycles
72oC 40 sec
72oC 10 min
16oC ∞
20μL ligation system
10× DNA Ligase Buffer 2μL
T4 DNA Ligase 1μL
pMD19 T-Simple Vector 1μL
C2-luxS 4μL
ddH2O 12μL
Total 20μL
Reaction condition: 16oC overnight
Positive clones were selected by colony PCR.
20μL PCR system
2× Taq Master Mix 10μL
M13-F 1μL
M13-R 1μL
Bacterium solution 1μL
ddH2O 7μL
Total 20μL
PCR reaction condition
94oC 10 min
94oC 30 sec
59oC 30 sec 30 cycles
72oC 40 sec
72oC 10 min
16oC ∞
PCR cloning product of promoter C2 and gene luxS
4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
20μL digestion system
10× FastDigest Buffer 2μL
BamH Ⅰ 1μL
T-lsrACDB 1μL
ddH2O 7μL
Total 20μL
Reaction condition: 37oC for 40 min
Restriction enzyme digestion verification
(No.1 are linearized T-vector, No.2 are C2-luxS fragment.)
☞☟ Week6 (Jun 20–Jun 26)
The sequencing result showed that there was a correct strain and thus it could be used for the following experiments. We obtained the correct plasmid T-C2-luxS from DH5α. Then the fragment C2-luxS was obtained by digestion and gel extraction.
40μL digestion system
10× FastDigest Buffer 4μL
BamH Ⅰ 2μL
T-C2-luxS 25μL
ddH2O 9μL
Total 20μL
Reaction condition: 37oC for 40 min
The C2-luxS fragment was ligated to linearized plasmid pWH1520, and then the ligation product was transformed into DH5α.
20μL ligation system
10× DNA Ligase Buffer 2μL
T4 DNA Ligase 1μL
pMD19 T-Simple Vector 1μL
C2-luxS 5μL
ddH2O 11μL
Total 20μL
Reaction condition: 16oC overnight
The plasmid pWH-C2-luxS was extracted from DH5α. To prevent the plasmid from DAM&DCM methylation, we transformed it into E.coli JM110.
The plasmid pWH-C2-luxS was extracted from JM110,and then it was treated with BamH Ⅰ methylase.
100μL methylation system
10× BamH Ⅰ methyltransferase Buffer 10μL
BamH Ⅰ methyltransferase 1μL
S-adenosylmethionine 0.5μL
pWH-C2-luxS 80μL
ddH2O 8.5μL
Total 100μL
Reaction condition: 37oC for 1 hour
The plasmid was transformed into GR286 by electroporation.[Failed]
Selection of positive clones by colony PCR
(No.1 is positive control, No.2-6 are experimental groups. The result showed that we failed to transformed the plasmid pWH-C2-luxS into GR286)
☞☟ Week7 (Jun 27–Jul 03)
This week, we tried to use different voltages to transform the plasmid. Sadly, all of these attempts rendered negative results.
We considered whether the luxS gene is toxic for GR286, and the bacteria tends to reject the gene when a strong promoter is inserted upstream of it. So, we planned to use inducible promoter to reconstruct our expression vector.
The plasmid pWH1520 contains a strong xylA promoter originating from Bacillus megaterium, and transcription initiated by this promoter is xylose-inducible. Also, the gene of interest carries its own ribosome binding sequence (RBS) and translation initiation codon. Based on these points, we redesigned primers.
☞☟ Week8 (Jul 04–Jul 10)
luxS gene was cloned from GR286 using our new primers.
50μL PCR system ×2
2× Taq Master Mix 25μL
YD-luxS-F 2μL
YD-luxS-R 2μL
Bacterium solution 2μL
ddH2O 19μL
Total 50μL
PCR reaction condition
94oC 10 min
94oC 30 sec
58oC 30 sec 30 cycles
72oC 40 sec
72oC 10 min
16oC ∞
PCR cloning product of gene luxS
The luxS fragment was purified by gel extraction, and ligated into linearized pWH1520. Then the vector was transformed into DH5α.
40μL digestion system ×2
10× FastDigest Buffer 4μL
BamH Ⅰ 2μL
pWH1520 25μL
ddH2O 9μL
Total 40μL
Reaction condition: 37oC for 40 min
20μL ligation system
10× DNA Ligase Buffer 2μL
T4 DNA Ligase 1μL
linearized pWH1520 1μL
luxS 3μL
ddH2O 13μL
Total 20μL
Reaction condition: 16oC overnight
Positive clones were selected by colony PCR.
20μL PCR system
2× Taq Master Mix 10μL
pWH-F 1μL
pWH-R 1μL
Bacterium solution 1μL
ddH2O 7μL
Total 20μL
PCR reaction condition
94oC 10 min
94oC 30 sec
58oC 30 sec 30 cycles
72oC 40 sec
72oC 10 min
16oC ∞
Selection of positive clones by colony PCR
4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
20μL digestion system
10× FastDigest Buffer 2μL
BamH Ⅰ 1μL
pWH-luxs 10μL
ddH2O 7μL
Total 20μL
Reaction condition: 37oC for 40 min
Restriction enzyme digestion verification
(No.1 are linearized pWH1520, No.2 are luxS fragments.)
☞☟ Week9 (Jul 11–Jul 17)
The sequencing result showed there's three positive strains. So one positive strain was chosen to be used for the following experiments. The pWH-luxS plasmid was extracted from the chosen strain. To prevent the plasmid from DAM&DCM methylation, we transformed it into E.coli JM110.
the plasmid pWH-luxS was extracted from JM110,and it was treated withBamH Ⅰ methylase.
100μL methylation system
10× BamH Ⅰ methyltransferase Buffer 10μL
BamH Ⅰ methyltransferase 1μL
S-adenosylmethionine 0.5μL
pWH-C2-luxS 80μL
ddH2O 8.5μL
Total 100μL
Reaction condition: 37oC for 1 hour
The plasmid was transformed into GR286 by electroporation, and positive clones were selected.
Selection of positive clones by colony PCR
The construction of supplier was accomplished!
☞☟ Week10 (Jul 18–Jul 24)
We have received the product of synthetic lsrACDB gene. We first used restriction-ligation method to ligate lsrACDB to plasmid pWH1520, but we failed to select positive after several tries.
20μL ligation system
10× DNA Ligase Buffer 2μL
T4 DNA Ligase 1μL
linearized pWH1520 1μL
lsrACDB 3μL
ddH2O 13μL
Total 20μL
Reaction condition: 16oC overnight
Considering that the lsrACDB gene is a large fragment (4500bp), we used ClonExpress technique to clone the gene again to improve the efficiency of ligation. The lsrACDB sequence was divided into two parts and they were cloned separately. Then the two segments were ligated to the plasmid pWH1520 and the recombinant vector was transformed into DH5α. After that, verification PCR was used to select the positive clones. However, we didn't get a good result.
Selection of positive clones by colony PCR
(No.6 is positive control, No.1-5 are experimental groups)
☞☟ Week11 (Jul 25–Jul 31)
We learnt a new method called circular polymerase extension cloning (CPEC) for high-throughput cloning of complex and combinatorial DNA libraries, and we decided to use this method to try to ligate our lsrACDB gene. It's encouraging that we succeeded to ligate the lsrACDB gene to the plasmid pHT-01.
Selection of positive clones by colony PCR
(No.3-6 are positive clones)
Restriction enzyme digestion verification
(No.2&3 are positive results.)
☞☟ Week12 (Aug 1–Aug 7)
Since we have already successfully constructed "supplier" and part of "consumer", we decided to measure the growth curve to explore the function of our "controller".
Groups divided in this experiment
GR286 wild strain as control group
GR286ΔluxS GR286 without luxS gene
pWH-luxS luxS overexpression plasmid in GR286; without induced by xylose
pWH-luxS + xyl luxS overexpression plasmid in GR286; induced by xylose
pWH1520 empty plasmid in GR286 as control group
pHT-lsrACDB lsrACDB overexpression plasmid in GR286ΔluxS
pHT-01 empty plasmid in GR286ΔluxS as control group
OD600 of different groups at specific times
Growth curve of GR286 and GR286ΔluxS
Growth curve of pWH-luxS, pWH-luxS + xyl and pWH1520
Growth curve of pHT-lsrACDB and pHT-01
Cultured media of our supplier was tested for the presence of AI-2 by inducing luminescence of Vibrio harveyi reporter strain BB170.
Fluorescence intensity of different groups at specific times
Relative fluorescence intensity of different groups
☞☟ Week13 (Aug 8–Aug 14)
For our consumer, we should also overexpress the lsrK and lsrFG gene for phosphorylating and degrading phosphorylated AI-2. We used ClonExpress technique to clone the two genes and ligate them to plasmid pHT-01 successfully.
Restriction enzyme digestion verification
(No.1&3&4 are positive results. )
We co-cultured the supplier with BB170 and tested the fluorescence intensity to explore the function of supplier. (negative result)
Fluorescence intensity of BB170 and co-culture medium
☞☟ Week14 (Aug 15–Aug 21)
Since the controller we constructed with GR286 did not demonstrate positive results, we decided to substitute GR286 with Escherichia coli whose AI-2 metabolic pathway had been elucidated as the chassis of our controller.
  • The strains to be constructed are shown in the tables below.
    AI-2 supplier
    LuxS Mtn
    pTrcHisB Native Native
    pLuxS Induced Native
    pLuxS-Mtn Induced Induced
    AI-2 consumer
    LsrACDB LsrK LsrFG
    pTrcHisB Native Native Native
    pLsrACDB Induced Native Native
    pLsrFG Native Native Induced
    pLsrK Native Induced Native
    pLsrACDBFG Induced Native Induced
    pLsrACDBK Induced Constitutive Native
    plsrACDBFGK Induced Constitutive Induced
  • The sequences of lsrACDB, lsrFG, lsrK, luxS, mtn gene in E.coli K12 were searched in NCBI, and primers were designed according to the gene sequences. The primers used in the construction of AI-2 controller are shown in the table below.
    Primers used in the construction of AI-2 controller
    Primer name Sequence
    lsrACDBFG1-F CGACGATGACGATAAGGATCCATGCAAACGAGTGATACCCGC
    lsrACDBFG1-R TGTTTGGCGTTTCCGGCAGCGGTGCGGAGAGC
    lsrACDBFG2-F TGTTTGGCGTTTCCGCGATTG
    lsrACDBFG2-R GCACTCTCACACCACGTTGCATGGCGCGTTTC
    lsrACDBFG3-F GTGGTGTGAGAGTGCTGAC
    lsrACDBFG3-R ACCAGCTGCAGATCTCGAGCTCGTCACGGCATCAACCCATTGAAC
    lsrACDB1-F CGACGATGACGATAAGGATCCATGCAAACGAGTGATACCCGC
    lsrACDB1-R ACCGGAACCGCCGAGCAAACTAATGCCGCCCAGCAC
    lsrACDB2-F CTCGGCGGTTCCGGTGCGAT
    lsrACDB2-R ACCAGCTGCAGATCTCGAGCTCGTCAGAAATCGTATTTGCCG
    luxS-F ATGACGATAAGGATCCGAGCTCGATGCCGTTGTTAGATAGCTTC
    luxS-R GGACTCCCCCGGGGGACTAAATGTGCAGTTCCTGCAACTTC
    mtn-F TCCCCCGGGGGAGTCCTCTCCCGCGTGAGAAATAC
    mtn-R TATGGTACCAGCTGCAGATCTCTTAGCCATGTGCAAGTTTCTG
    luxS-Fd GGAATTCCCTAAATGTGCAGTTCCTGCAACTTC
    luxS-Rv GGGGTACCCCATGCCGTTGTTAGATAGCTTCACAG
    lsrK-Fd GGGGTACCCCATGGCTCGACTCTTTACC
    lsrK-Rv GGAATTCCCTATAACCCAGGCGCTTTCC
    lsrFG-Fd CGGGATCCCGATGGCAGATTTAGACGATATTAAAGATGG
    lsrFG-Rv GAAGATCTTCTCACGGCATCAACCCATTGAAC
    lsrK-F AACTGCAGAACCAATGCATTGGTTTACGGCTAGCTCAGTCCTAGGTATAGTGCTAGCAAAGAGGAGAAAATGGCTCGACTCTTTACC
    lsrK-R TTCGAACTATAACCCAGGCGCTTTCC
    BK-JC-F TTTCAGTGTATGTCGCGGATGC
    GK-JC-F TTGCGCTTCGATGTCTTACAGG
    pTrc-JC-F TGGGCACTCGACCGGAATTATC
    pTrc-JC-R GCTACTGCCGCCAGGCAAATTC
  1. Construction of pLuxS-Mtn
luxS gene was cloned from E.coli K12.
50μL PCR system ×2
PrimeSTAR Max Premix(2×) 25μL
luxS-F 2μL
luxS-R 2μL
E.coli K12 2μL
ddH2O 19μL
Total 50μL
PCR reaction condition
94oC 10 min
94oC 30 sec
63oC 30 sec 30 cycles
72oC 30 sec
72oC 10 min
16oC ∞
PCR cloning product of gene luxS
50μL PCR system ×2
PrimeSTAR Max Premix(2×) 25μL
mtn-F 2μL
mtn-R 2μL
E.coli K12 2μL
ddH2O 19μL
Total 50μL
PCR reaction condition
94oC 10 min
94oC 30 sec
63oC 30sec 30 cycles
72oC 45 sec
72oC 10 min
16oC ∞
PCR cloning product of gene mtn
ClonExpress technique was used to ligate luxS and mtn genes to plasmid pTrcHisB. The recombinant vector pTrc-luxS-mtn was transformed into E.coli K12. After that, verification PCR was performed to select the positive clones.
20μL PCR system
PrimeSTAR Max Premix(2×) 10μL
pTrc-JC-F 1μL
pTrc-JC-R 1μL
Bacterium solution 1μL
ddH2O 7μL
Total 20μL
PCR reaction condition
94oC 10 min
94oC 30 sec
58oC 30sec 30 cycles
72oC 1 min 30 sec
72oC 10 min
16oC ∞
Selection of positive clones by PCR
(NO.3&5&8 are positive results)
3 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
20μL digestion system
10× FastDigest Buffer 2μL
Sac Ⅰ 1μL
Bgl Ⅱ 1μL
pTrc-luxS-mtn 6μL
ddH2O 10μL
Total 20μL
Reaction condition: 37oC for 40 min
Restriction enzyme digestion verification
(No.1 are linearized pTrcHisB, No.2 are luxS-mtn fragment. )
☞☟ Week15 (Aug 22–Aug 28)
  1. Construction of pLuxS
  2. Construction of pLsrACDB
  3. Construction of pLsrACDBFG
luxS gene was cloned from E.coli K12.
50μL PCR system ×2
PrimeSTAR Max Premix(2×) 25μL
luxS-Fd 2μL
luxS-Rv 2μL
E.coli K12 2μL
ddH2O 19μL
Total 50μL
PCR reaction condition
94oC 10 min
94oC 30 sec
60oC 30 sec 30 cycles
72oC 30 sec
72oC 10 min
16oC ∞
PCR cloning product of gene luxS
The luxS gene was purified by gel extraction. Then, both the luxS segment and pTrcHisB vector were treated with restriction enzyme. After that, luxS gene was ligated to linearized pTrcHisB, and the ligation product was transformed into E.coli K12.
40μL digestion system ×2
10× FastDigest Buffer 4μL
Kpn Ⅰ 2μL
EcoR Ⅰ 2μL
luxS 25μL
ddH2O 7μL
Total 40μL
Reaction condition: 37oC for 40 min
40μL digestion system ×2
10× FastDigest Buffer 4μL
Kpn Ⅰ 2μL
EcoR Ⅰ 2μL
pTrcHisB 20μL
ddH2O 12μL
Total 40μL
Reaction condition: 37oC for 40 min
20μL ligation system
10× DNA Ligase Buffer 2μL
T4 DNA Ligase 1μL
linearized pTrcHisB 1μL
luxS 3μL
ddH2O 13μL
Total 20μL
Reaction condition: 16oC overnight
Verification PCR was performed to select the positive clones.
20μL PCR system ×2
2× Taq Master Mix 10μL
pTrc-JC-F 1μL
pTrc-JC-R 1μL
Bacterium solution 1μL
ddH2O 7μL
Total 20μL
PCR reaction condition
94oC 10 min
94oC 30 sec
58oC 30sec 30 cycles
72oC 50 sec
72oC 10 min
16oC ∞
Selection of positive clones by PCR
One positive strain was chosen to be cultured overnight and plasmid was extracted. After restriction enzyme digestion verification, the positive clone was sequenced.
20μL digestion system
10× FastDigest Buffer 2μL
Kpn Ⅰ 1μL
EcoR Ⅰ 1μL
pTrc-luxS 6μL
ddH2O 10μL
Total 20μL
Reaction condition: 37oC for 40 min
Restriction enzyme digestion verification
(No.1 is linearized pTrcHisB &plus; luxS, No.2 is plasmid pTrc-luxS. )
The lsrACDBFG sequence was divided into three parts and they were cloned separately. Then the three segments were ligated to the linearized pTrcHisB by ClonExpress technique, and the recombinant vector was transformed into DH5α.
50μL PCR system ×2
PrimeSTAR Max Premix(2×) 25μL
lsrACDB1-F 2μL
lsrACDB1-R 2μL
E.coli K12 2μL
ddH2O 19μL
Total 50μL
50μL PCR system ×2
PrimeSTAR Max Premix(2×) 25μL
lsrACDB2-F 2μL
lsrACDB2-R 2μL
E.coli K12 2μL
ddH2O 19μL
Total 50μL
PCR reaction condition
94oC 10 min
94oC 30 sec
60oC 30 sec 30 cycles
72oC 2 min 20 sec
72oC 10 min
16oC ∞
PCR cloning product of segment lsrACDB1,lsrACDB12
Verification PCR was performed to select the positive clones.
Selection of positive clones by PCR
4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
20μL digestion system
10× FastDigest Buffer 2μL
BamH Ⅰ 1μL
Sac Ⅰ 1μL
pTrc-lsrACDB 6μL
ddH2O 10μL
Total 20μL
Reaction condition: 37oC for 40 min
Restriction enzyme digestion verification
The lsrACDBFG sequence was divided into three parts and they were cloned separately. Then the three segments were ligated to the linearized pTrcHisB by ClonExpress technique, and the recombinant vector was transformed into DH5α.
50μL PCR system ×2
PrimeSTAR Max Premix(2×) 25μL
lsrACDBFG1-F 2μL
lsrACDBFG1-R 2μL
E.coli K12 2μL
ddH2O 19μL
Total 50μL
50μL PCR system ×2
PrimeSTAR Max Premix(2×) 25μL
lsrACDBFG2-F 2μL
lsrACDBFG2-R 2μL
E.coli K12 2μL
ddH2O 19μL
Total 50μL
50μL PCR system ×2
PrimeSTAR Max Premix(2×) 25μL
lsrACDBFG3-F 2μL
lsrACDBFG3-R 2μL
E.coli K12 2μL
ddH2O 19μL
Total 50μL
PCR reaction condition
94oC 10 min
94oC 30 sec
58oC 30 sec 30 cycles
72oC 2 min
72oC 10 min
16oC ∞
PCR cloning product of segment lsrACDBFG1,lsrACDBFG2, lsrACDBFG3
Verification PCR was performed to select the positive clones.
Selection of positive clones by PCR
4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
20μL digestion system
10× FastDigest Buffer 2μL
BamH Ⅰ 1μL
Sac Ⅰ 1μL
pTrc-lsrACDB 6μL
ddH2O 10μL
Total 20μL
Reaction condition: 37oC for 40 min
Restriction enzyme digestion verification
(No.1-4 are linearized pTrcHisB &plus; lsrACDBFG, No.5 is plasmid pTrc-lsrACDBFG.)
☞☟ Week16 (Aug 29–Sep 04)
  1. Construction of pLsrFG
  2. Construction of pLsrACDBK
  3. Construction of pLsrACDBFGK
lsrFG gene was cloned from E.coli K12.
50μL PCR system ×2
PrimeSTAR Max Premix(2×) 25μL
lsrFG-Fd 2μL
lsrFG-Rv 2μL
E.coli K12 2μL
ddH2O 19μL
Total 50μL
PCR reaction condition
94oC 10 min
94oC 30 sec
58oC 30 sec 30 cycles
72oC 1 min 15 sec
72oC 10 min
16oC ∞
PCR cloning product of gene lsrFG
The lsrFG gene was purified by gel extraction. Then, both the lsrFG segment and pTrcHisB vector were treated with restriction enzyme. After that, lsrFG gene was ligated to linearized pTrcHisB, and the ligation product was transformed into E.coli K12.
40μL digestion system ×2
10× FastDigest Buffer 4μL
BamH Ⅰ 2μL
Bgl Ⅱ 2μL
lsrFG 25μL
ddH2O 7μL
Total 40μL
Reaction condition: 37oC for 40 min
40μL digestion system ×2
10× FastDigest Buffer 4μL
BamH Ⅰ 2μL
Bgl Ⅱ 2μL
pTrcHisB 20μL
ddH2O 12μL
Total 40μL
Reaction condition: 37oC for 40 min
20μL ligation system
10× DNA Ligase Buffer 2μL
T4 DNA Ligase 1μL
pMD19 T-Simple Vector 1μL
luxSFG 3μL
ddH2O 13μL
Total 20μL
Reaction condition: 16oC overnight
Verification PCR was performed to select the positive clones.
20μL PCR system ×2
2× Taq Master Mix 10μL
pTrc-JC-F 1μL
pTrc-JC-R 1μL
Bacterium solution 1μL
ddH2O 7μL
Total 20μL
PCR reaction condition
94oC 10 min
94oC 30 sec
58oC 30 sec 30 cycles
72oC 1 min 30 sec
72oC 10 min
16oC ∞
Selection of positive clones by PCR
(NO. 1&3 are positive results)
Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
20μL digestion system
10× FastDigest Buffer 2μL
BamH Ⅰ 1μL
Bgl Ⅱ 1μL
pTrc-lsrFG 6μL
ddH2O 10μL
Total 20μL
Reaction condition: 37oC for 40 min
Restriction enzyme digestion verification
lsrK gene was cloned from E.coli K12.
50μL PCR system ×2
PrimeSTAR Max Premix(2×) 25μL
lsrK-F 2μL
lsrK-R 2μL
E.coli K12 2μL
ddH2O 19μL
Total 50μL
PCR reaction condition
94oC 10 min
94oC 30 sec
55oC 30 sec 30 cycles
72oC 1 min 40 sec
72oC 10 min
16oC ∞
PCR cloning product of gene lsrK
The lsrK gene was purified by gel extraction. Then, both the lsrK segment and pTrc-lsrACDB vector were treated with restriction enzyme. After that, lsrK gene was ligated to linearized pTrc-lsrACDB, and the ligation product was transformed into E.coli K12.
40μL digestion system ×2
10× FastDigest Buffer 4μL
Pst Ⅰ 2μL
BstB Ⅰ 2μL
lsrK 25μL
ddH2O 7μL
Total 40μL
Reaction condition: 37oC for 40 min
40μL digestion system ×2
10× FastDigest Buffer 4μL
Pst Ⅰ 2μL
BstB Ⅰ 2μL
pTrc-lsrACDB 25μL
ddH2O 7μL
Total 40μL
Reaction condition: 37oC for 40 min
20μL ligation system
10× DNA Ligase Buffer 2μL
T4 DNA Ligase 1μL
linearized pTrc-lsrACDB 1μL
lsrK 3μL
ddH2O 13μL
Total 20μL
Reaction condition: 16oC overnight
Verification PCR was performed to select the positive clones.
20μL PCR system ×2
2× Taq Master Mix 10μL
BK-JC-F 1μL
pTrc-JC-R 1μL
Bacterium solution 1μL
ddH2O 7μL
Total 20μL
PCR reaction condition
94oC 10 min
94oC 30 sec
58oC 30 sec 30 cycles
72oC 2 min
72oC 10 min
16oC ∞
Selection of positive clones by PCR
(NO. 1&3 are positive results)
Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
20μL digestion system
10× FastDigest Buffer 2μL
Pst Ⅰ 1μL
BstB Ⅰ 1μL
pTrc-lsrACDBK 6μL
ddH2O 10μL
Total 20μL
Reaction condition: 37oC for 40 min
Restriction enzyme digestion verification
lsrK gene was cloned from E.coli K12.
50μL PCR system ×2
PrimeSTAR Max Premix(2×) 25μL
lsrK-F 2μL
lsrK-R 2μL
E.coli K12 2μL
ddH2O 19μL
Total 50μL
PCR reaction condition
94oC 10 min
94oC 30 sec
55oC 30 sec 30 cycles
72oC 1 min 40 sec
72oC 10 min
16oC ∞
PCR cloning product of gene lsrK
The lsrK gene was purified by gel extraction. Then, both the lsrK segment and pTrc-lsrACDBFG vector were treated with restriction enzyme. After that, lsrK gene was ligated to linearized pTrc-lsrACDBFG, and the ligation product was transformed into E.coli K12.
40μL digestion system ×2
10× FastDigest Buffer 4μL
Pst Ⅰ 2μL
BstB Ⅰ 2μL
lsrK 25μL
ddH2O 7μL
Total 40μL
Reaction condition: 37oC for 40 min
40μL digestion system ×2
10× FastDigest Buffer 4μL
Pst Ⅰ 2μL
BstB Ⅰ 2μL
pTrc-lsrACDBFG 20μL
ddH2O 12μL
Total 40μL
Reaction condition: 37oC for 40 min
20μL ligation system
10× DNA Ligase Buffer 2μL
T4 DNA Ligase 1μL
linearized pTrc-lsrACDFGB 1μL
lsrK 3μL
ddH2O 13μL
Total 20μL
Reaction condition: 16oC overnight
Verification PCR was performed to select the positive clones.
20μL PCR system ×2
2× Taq Master Mix 10μL
GK-JC-F 1μL
pTrc-JC-R 1μL
Bacterium solution 1μL
ddH2O 7μL
Total 20μL
PCR reaction condition
94oC 10 min
94oC 30 sec
58oC 30 sec 30 cycles
72oC 2 min
72oC 10 min
16oC ∞
Selection of positive clones by PCR
(NO.3 is positive result)
Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
20μL digestion system
10× FastDigest Buffer 2μL
Pst Ⅰ 1μL
BstB Ⅰ 1μL
pTrc-lsrACDBKFGK 6μL
ddH2O 10μL
Total 20μL
Reaction condition: 37oC for 40 min
Restriction enzyme digestion verification
☞☟ Week17 (Sep 05–Sep 11)
  1. Construction of pLsrK
lsrK gene was cloned from E.coli K12.
50μL PCR system ×2
PrimeSTAR Max Premix(2×) 25μL
lsrK-Fd 2μL
lsrK-Rv 2μL
E.coli K12 2μL
ddH2O 19μL
Total 50μL
PCR reaction condition
94oC 10 min
94oC 30 sec
55oC 30 sec 30 cycles
72oC 1 min 40 sec
72oC 10 min
16oC ∞
PCR cloning product of gene lsrK
The lsrK gene was purified by gel extraction. Then, both the lsrK segment and pTrc-lsrACDBFG vector were treated with restriction enzyme. After that, lsrK gene was ligated to linearized pTrc-lsrACDBFG, and the ligation product was transformed into E.coli K12.
40μL digestion system ×2 ×2
10× FastDigest Buffer 4μL
Kpn Ⅰ 2μL
EcoR Ⅰ 2μL
lsrK 25μL
ddH2O 7μL
Total 40μL
Reaction condition: 37oC for 40 min
40μL digestion system ×2 ×2
10× FastDigest Buffer 4μL
Pst Ⅰ 2μL
BstB Ⅰ 2μL
pTrc-HisB 20μL
ddH2O 12μL
Total 40μL
Reaction condition: 37oC for 40 min
20μL ligation system
10× DNA Ligase Buffer 2μL
T4 DNA Ligase 1μL
linearized pTrcHisB 1μL
lsrK 3μL
ddH2O 13μL
Total 20μL
Reaction condition: 16oC overnight
Verification PCR was performed to select the positive clones.
20μL PCR system ×2
2× Taq Master Mix 10μL
pTrc-JC-F 1μL
pTrc-JC-R 1μL
Bacterium solution 1μL
ddH2O 7μL
Total 20μL
PCR reaction condition
94oC 10 min
94oC 30 sec
58oC 30 sec 30 cycles
72oC 2 min
72oC 10 min
16oC ∞
Selection of positive clones by PCR
4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
20μL digestion system
10× FastDigest Buffer 2μL
Kpn Ⅰ 1μL
EcoR Ⅰ 1μL
pTrc-lsrK 6μL
ddH2O 10μL
Total 20μL
Reaction condition: 37oC for 40 min
Restriction enzyme digestion verification