Difference between revisions of "Team:Chalmers Gothenburg/Project/Constructs"

Line 12: Line 12:
 
   </head>
 
   </head>
  
−
   <body class="project">
+
   <body><div class="project">
−
 
+
−
<!--<div class="column full_size judges-will-not-evaluate">
+
−
<h3>★  ALERT! </h3>
+
−
<p>This page is used by the judges to evaluate your team for the <a href="https://2016.igem.org/Judging/Awards#SpecialPrizes">Best Model award</a>. </p>
+
−
 
+
−
 
+
−
<p> Delete this box in order to be evaluated for this medal. See more information at <a href="https://2016.igem.org/Judging/Pages_for_Awards/Instructions"> Instructions for Pages for awards</a>.</p>
+
−
</div>-->
+
 
      
 
      
 
     <div id="header_navbar_wrapper">
 
     <div id="header_navbar_wrapper">
Line 338: Line 330:
 
          
 
          
  
−
 
+
</div></body>
  
  
 
</html>
 
</html>

Revision as of 16:37, 15 October 2016

Chalmers Gothenburg iGEM 2016

PROJECT
Constructs
Table 1. Primers used for linearizing pNF
Primers Sequence (5’ → 3’)
pNF FW GTTCACTGGCCGTCGTTTTAC
pNF RV CATGCAAGCTTGGCGTAATC
Table 2. Primers used for generating the fragments for the ArgH knock-out and AckA insertion. Uppercase characters hybridize to the template, while the lowercase characters contain the overlapping overhang to the fragment within the parenthesis in the primer name. The numbering of the primers indicates which constructs it can be used for.
Primers Sequence (5’ → 3’)
1,5 ArgH Up FW (pNF) accatgattacgccaagcttgcatgCGCCTGTTATAACACCCC
1,5 ArgH Up RV (KmR) gctctagagtgatagaattcGGGATTTCGTTGTGATAGTTAG
1 Kmr FW (argH) ttgctaactatcacaacgaaatcccGAATTCTATCACTCTAGAGCCAGG
1 Kmr RV (pTrc) attctgcctcgtgatacgcctaggtCGCTACTAGTACAACAAAGCCA
1,2, pTrc FW (KmR) gctttgttgtactagtagcgACCTAGGCGTATCACGAGG
1,2, pTrc RV (AckA) ttgagaatcaggaatttcatTCTAGATTTCTCCTCTTTTGTGTG
1 AckA FW (pTrc) tcacacaaaagaggagaaatctagaATGAAATTCCTGATTCTCAATGC
1 AckA RV (argH) aacctgggcatatctccacaccaatAGCCTAATTCAACATTTATCTTCAC
1 ArgH Dw FW (AckA) gataaatgttgaattaggctATTGGTGTGGAGATATGCC
1,5 ArgH Dw RV (pNF) cgttgtaaaacgacggccagtgaacCACCTTTTAAAAGAATGGCG
Table 3. Primers used for generating the fragments for the GlnA knock-out and AckA insertion. Uppercase characters hybridize to the template, while the lowercase characters contain the overlapping overhang to the fragment within the parenthesis in the primer name. The numbering of the primers indicates which constructs it can be used for.
Primers Sequence (5’ → 3’)
Table 4. Primers used for generating the fragments for the Acs knock-out and mRFP1 insertion. Uppercase characters hybridize to the template, while the lowercase characters contain the overlapping overhang to the fragment within the parenthesis in the primer name. The numbering of the primers indicates which constructs it can be used for.
Primers Sequence (5’ → 3’)
Table 5. Primers used for generating the fragments for the Acs knock-out and pta insertion. Uppercase characters hybridize to the template, while the lowercase characters contain the overlapping overhang to the fragment within the parenthesis in the primer name. The numbering of the primers indicates which constructs it can be used for.
Primers Sequence (5’ → 3’)
Table 6. Primers used for generating the fragments for the ArgH knock-out. Uppercase characters hybridize to the template, while the lowercase characters contain the overlapping overhang to the fragment within the parenthesis in the primer name. The numbering of the primers indicates which constructs it can be used for.
Primers Sequence (5’ → 3’)
Table 7. Primers used for generating the fragments for the GlnA knock-out. Uppercase characters hybridize to the template, while the lowercase characters contain the overlapping overhang to the fragment within the parenthesis in the primer name. The numbering of the primers indicates which constructs it can be used for.
Primers Sequence (5’ → 3’)
Table 8. Primers used for generating the fragments for the Acs knock-out. Uppercase characters hybridize to the template, while the lowercase characters contain the overlapping overhang to the fragment within the parenthesis in the primer name. The numbering of the primers indicates which constructs it can be used for.
Primers Sequence (5’ → 3’)