Difference between revisions of "Team:NKU China/Notebook"
Dongzhuoer (Talk | contribs) |
Dongzhuoer (Talk | contribs) |
||
| (13 intermediate revisions by the same user not shown) | |||
| Line 57: | Line 57: | ||
margin: auto; | margin: auto; | ||
padding: 1rem; | padding: 1rem; | ||
| + | position:relative; | ||
} | } | ||
| + | |||
| + | .table-wrapper div.rbrace { | ||
| + | font-weight:100; | ||
| + | color:dodgerblue; | ||
| + | position:absolute; | ||
| + | right:6.5rem; | ||
| + | bottom:5rem; | ||
| + | font-size:4rem; | ||
| + | z-index:4; | ||
| + | } | ||
| + | |||
#notebook table { | #notebook table { | ||
| Line 67: | Line 79: | ||
} | } | ||
| − | table { | + | #notebook table { |
font-size: 1rem; | font-size: 1rem; | ||
padding: 0; | padding: 0; | ||
} | } | ||
| − | table caption { | + | #notebook table caption { |
border-top: 0.1rem solid; | border-top: 0.1rem solid; | ||
border-bottom: 0.1rem solid; | border-bottom: 0.1rem solid; | ||
| Line 81: | Line 93: | ||
} | } | ||
| − | table tr { | + | #notebook table tr { |
margin: 0; | margin: 0; | ||
padding: 0; | padding: 0; | ||
| Line 87: | Line 99: | ||
} | } | ||
| − | table td { | + | #notebook table td { |
border: none; | border: none; | ||
margin: 0; | margin: 0; | ||
| Line 107: | Line 119: | ||
width: 100%; | width: 100%; | ||
margin-bottom:0.25rem; | margin-bottom:0.25rem; | ||
| + | } | ||
| + | |||
| + | figure img.white { | ||
| + | background-color:white; | ||
} | } | ||
| Line 124: | Line 140: | ||
</style> | </style> | ||
<style title="table-theme.css"> | <style title="table-theme.css"> | ||
| − | /* | + | /**/ |
| − | .table-theme-0 { | + | #notebook .table-theme-0 { |
/*color: rgb(49,132,155);*/ | /*color: rgb(49,132,155);*/ | ||
background-color:transparent; | background-color:transparent; | ||
| Line 132: | Line 148: | ||
} | } | ||
| − | .table-theme-0 tr { | + | #notebook .table-theme-0 tr { |
background-color:transparent; | background-color:transparent; | ||
} | } | ||
| Line 149: | Line 165: | ||
border:none; | border:none; | ||
background-color:transparent; | background-color:transparent; | ||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
} | } | ||
/*PCR system*/ | /*PCR system*/ | ||
| − | .table-theme-1 { | + | #notebook .table-theme-1 { |
color: rgb(49,132,155); | color: rgb(49,132,155); | ||
} | } | ||
| − | .table-theme-1 caption { | + | #notebook .table-theme-1 caption { |
border-top-color: rgb(75,172,198); | border-top-color: rgb(75,172,198); | ||
border-bottom-color: rgb(75,172,198); | border-bottom-color: rgb(75,172,198); | ||
} | } | ||
| − | .table-theme-1 table tr:last-child td { | + | #notebook .table-theme-1 table tr:last-child td { |
border-bottom-color: rgb(75,172,198); | border-bottom-color: rgb(75,172,198); | ||
} | } | ||
| − | .table-theme-1 tr:nth-child(odd) { | + | #notebook .table-theme-1 tr:nth-child(odd) { |
background-color: rgb(210,234,241); | background-color: rgb(210,234,241); | ||
| − | |||
| − | |||
| − | |||
} | } | ||
/*PCR reaction condition*/ | /*PCR reaction condition*/ | ||
| − | .table-theme-2 { | + | #notebook .table-theme-2 { |
color: rgb(118,146,60); | color: rgb(118,146,60); | ||
| + | position:relative; | ||
} | } | ||
| − | .table-theme-2 caption { | + | #notebook .table-theme-2 caption { |
border-top-color: rgb(155, 187, 89); | border-top-color: rgb(155, 187, 89); | ||
border-bottom-color: rgb(155, 187, 89); | border-bottom-color: rgb(155, 187, 89); | ||
} | } | ||
| − | .table-theme-2 table tr:last-child td { | + | #notebook .table-theme-2 table tr:last-child td { |
border-bottom-color: rgb(75,172,198); | border-bottom-color: rgb(75,172,198); | ||
} | } | ||
| − | .table-theme-2 tr:nth-child(odd) { | + | #notebook .table-theme-2 tr:nth-child(odd) { |
background-color: rgb(230,238,213); | background-color: rgb(230,238,213); | ||
| − | |||
| − | |||
| − | |||
} | } | ||
/*ligation system*/ | /*ligation system*/ | ||
| − | .table-theme-3 { | + | #notebook .table-theme-3 { |
color: rgb(95, 73, 122); | color: rgb(95, 73, 122); | ||
} | } | ||
| − | .table-theme-3 caption { | + | #notebook .table-theme-3 caption { |
border-top-color: rgb(128, 100, 162); | border-top-color: rgb(128, 100, 162); | ||
border-bottom-color: rgb(128, 100, 162); | border-bottom-color: rgb(128, 100, 162); | ||
} | } | ||
| − | .table-theme-3 table tr:last-child td { | + | #notebook .table-theme-3 table tr:last-child td { |
border-bottom-color: rgb(128, 100, 162); | border-bottom-color: rgb(128, 100, 162); | ||
} | } | ||
| − | .table-theme-3 tr:nth-child(odd) { | + | #notebook .table-theme-3 tr:nth-child(odd) { |
background-color: rgb(223, 215, 232); | background-color: rgb(223, 215, 232); | ||
| − | |||
| − | |||
| − | |||
} | } | ||
/*digestion system*/ | /*digestion system*/ | ||
| − | .table-theme-4 { | + | #notebook .table-theme-4 { |
color: rgb(148, 54, 52); | color: rgb(148, 54, 52); | ||
} | } | ||
| − | .table-theme-4 caption { | + | #notebook .table-theme-4 caption { |
border-top-color: rgb(192, 80, 77); | border-top-color: rgb(192, 80, 77); | ||
border-bottom-color: rgb(192, 80, 77); | border-bottom-color: rgb(192, 80, 77); | ||
} | } | ||
| − | .table-theme-4 table tr:last-child td { | + | #notebook .table-theme-4 table tr:last-child td { |
border-bottom-color: rgb(192, 80, 77); | border-bottom-color: rgb(192, 80, 77); | ||
} | } | ||
| − | .table-theme-4 tr:nth-child(odd) { | + | #notebook .table-theme-4 tr:nth-child(odd) { |
background-color: rgb(239, 211, 210); | background-color: rgb(239, 211, 210); | ||
| − | |||
| − | |||
| − | |||
} | } | ||
/*methylation system*/ | /*methylation system*/ | ||
| − | .table-theme-5 { | + | #notebook .table-theme-5 { |
color: rgb(227, 108, 10); | color: rgb(227, 108, 10); | ||
} | } | ||
| − | .table-theme-5 caption { | + | #notebook .table-theme-5 caption { |
border-top-color: rgb(247, 150, 70); | border-top-color: rgb(247, 150, 70); | ||
border-bottom-color: rgb(247, 150, 70); | border-bottom-color: rgb(247, 150, 70); | ||
} | } | ||
| − | .table-theme-5 table tr:last-child td { | + | #notebook .table-theme-5 table tr:last-child td { |
border-bottom-color: rgb(247, 150, 70); | border-bottom-color: rgb(247, 150, 70); | ||
} | } | ||
| − | .table-theme-5 tr:nth-child(odd) { | + | #notebook .table-theme-5 tr:nth-child(odd) { |
background-color: rgb(253, 228, 208); | background-color: rgb(253, 228, 208); | ||
| − | |||
| − | |||
| − | |||
} | } | ||
/*Groups divided*/ | /*Groups divided*/ | ||
| − | .table-theme-6 { | + | #notebook .table-theme-6 { |
color: rgb(0, 0, 0); | color: rgb(0, 0, 0); | ||
} | } | ||
| − | .table-theme-6 caption { | + | #notebook .table-theme-6 caption { |
border-top-color: rgb(0, 0, 0); | border-top-color: rgb(0, 0, 0); | ||
border-bottom-color: rgb(0, 0, 0); | border-bottom-color: rgb(0, 0, 0); | ||
} | } | ||
| − | .table-theme-6 table tr:last-child td { | + | #notebook .table-theme-6 table tr:last-child td { |
border-bottom-color: rgb(0, 0, 0); | border-bottom-color: rgb(0, 0, 0); | ||
} | } | ||
| − | .table-theme-6 tr:nth-child(odd) { | + | #notebook .table-theme-6 tr:nth-child(odd) { |
background-color: rgb(192, 192, 192); | background-color: rgb(192, 192, 192); | ||
| − | |||
| − | |||
| − | |||
} | } | ||
</style> | </style> | ||
<script title="ready-js"> | <script title="ready-js"> | ||
$(function () { | $(function () { | ||
| − | + | adjust_figure(1.2); | |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
$("#accordion").accordion({ | $("#accordion").accordion({ | ||
| Line 307: | Line 285: | ||
heightStyle: 'content', | heightStyle: 'content', | ||
collapsible: true, | collapsible: true, | ||
| − | active: | + | active: 18, |
icons: false, | icons: false, | ||
}); | }); | ||
| Line 316: | Line 294: | ||
event: "mouseover", | event: "mouseover", | ||
heightStyle: 'content', | heightStyle: 'content', | ||
| − | active: | + | active:2, |
}); | }); | ||
} | } | ||
| Line 491: | Line 469: | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td>pWH-<i>luxS</i> | + | <td>pWH-<i>luxS</i> + xyl</td> |
<td><i>luxS</i> overexpression plasmid in GR286; induced by xylose</td> | <td><i>luxS</i> overexpression plasmid in GR286; induced by xylose</td> | ||
</tr> | </tr> | ||
| Line 516: | Line 494: | ||
</div> | </div> | ||
<div id="particles-js"></div> | <div id="particles-js"></div> | ||
| − | <script | + | <script src="https://2016.igem.org/Template:NKU_China/js/particlesJS?action=raw&ctype=text/javascript"></script> |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
<div class="main" id="notebook"> | <div class="main" id="notebook"> | ||
<div class="h1">Laboratory Notes</div> | <div class="h1">Laboratory Notes</div> | ||
| Line 697: | Line 555: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table1-2-2"> | <table class="table-theme-2" id="table1-2-2"> | ||
| + | |||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
<tr> | <tr> | ||
| Line 738: | Line 598: | ||
</figure> | </figure> | ||
</div> | </div> | ||
| − | |||
</div> | </div> | ||
<div id="fragment1-4"> | <div id="fragment1-4"> | ||
| Line 775: | Line 634: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table1-3-2"> | <table class="table-theme-2" id="table1-3-2"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 871: | Line 731: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table2-2-2"> | <table class="table-theme-2" id="table2-2-2"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 963: | Line 824: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table3-1-2"> | <table class="table-theme-2" id="table3-1-2"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 1,046: | Line 908: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table3-3-2"> | <table class="table-theme-2" id="table3-3-2"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 1,146: | Line 1,009: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table4-2-2"> | <table class="table-theme-2" id="table4-2-2"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 1,249: | Line 1,113: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table4-3-2"> | <table class="table-theme-2" id="table4-3-2"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 1,400: | Line 1,265: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table5-1-2"> | <table class="table-theme-2" id="table5-1-2"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 1,468: | Line 1,334: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table5-1-4"> | <table class="table-theme-2" id="table5-1-4"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 1,550: | Line 1,417: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table5-2-2"> | <table class="table-theme-2" id="table5-2-2"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 1,653: | Line 1,521: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table5-3-2"> | <table class="table-theme-2" id="table5-3-2"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 1,971: | Line 1,840: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table8-1-2"> | <table class="table-theme-2" id="table8-1-2"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 2,115: | Line 1,985: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table8-3-2"> | <table class="table-theme-2" id="table8-3-2"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 2,410: | Line 2,281: | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td>pWH-<i>luxS</i> | + | <td>pWH-<i>luxS</i> + xyl</td> |
<td><i>luxS</i> overexpression plasmid in GR286; induced by xylose</td> | <td><i>luxS</i> overexpression plasmid in GR286; induced by xylose</td> | ||
</tr> | </tr> | ||
| Line 2,442: | Line 2,313: | ||
<img src="https://static.igem.org/mediawiki/2016/a/a9/T--NKU_China--notebook-6-13-12.png"> | <img src="https://static.igem.org/mediawiki/2016/a/a9/T--NKU_China--notebook-6-13-12.png"> | ||
<figcaption> | <figcaption> | ||
| − | <div class="p"><span>Growth curve of pWH-<i>luxS</i>, pWH-<i>luxS</i> | + | <div class="p"><span>Growth curve of pWH-<i>luxS</i>, pWH-<i>luxS</i> + xyl and pWH1520</span></div> |
</figcaption> | </figcaption> | ||
</figure> | </figure> | ||
| Line 2,775: | Line 2,646: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table14-1-1-1-2"> | <table class="table-theme-2" id="table14-1-1-1-2"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 2,845: | Line 2,717: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table14-1-1-1-4"> | <table class="table-theme-2" id="table14-1-1-1-4"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 2,922: | Line 2,795: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table14-1-1-2-2"> | <table class="table-theme-2" id="table14-1-1-2-2"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 3,075: | Line 2,949: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table15-1-1-2"> | <table class="table-theme-2" id="table15-1-1-2"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 3,253: | Line 3,128: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table15-1-3-2"> | <table class="table-theme-2" id="table15-1-3-2"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 3,405: | Line 3,281: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table15-2-1-3"> | <table class="table-theme-2" id="table15-2-1-3"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 3,599: | Line 3,476: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table15-3-1-4"> | <table class="table-theme-2" id="table15-3-1-4"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 3,766: | Line 3,644: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table16-1-1-2"> | <table class="table-theme-2" id="table16-1-1-2"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 3,946: | Line 3,825: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table16-1-3-2"> | <table class="table-theme-2" id="table16-1-3-2"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 4,069: | Line 3,949: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table16-2-1-2"> | <table class="table-theme-2" id="table16-2-1-2"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 4,249: | Line 4,130: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table16-2-3-2"> | <table class="table-theme-2" id="table16-2-3-2"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 4,372: | Line 4,254: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table16-3-1-2"> | <table class="table-theme-2" id="table16-3-1-2"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 4,552: | Line 4,435: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table16-3-3-2"> | <table class="table-theme-2" id="table16-3-3-2"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 4,696: | Line 4,580: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table17-1-2-1"> | <table class="table-theme-2" id="table17-1-2-1"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 4,876: | Line 4,761: | ||
</div> | </div> | ||
<div class="table-wrapper"> | <div class="table-wrapper"> | ||
| + | <div class="rbrace">}</div> | ||
<table class="table-theme-2" id="table17-1-3-2"> | <table class="table-theme-2" id="table17-1-3-2"> | ||
<caption>PCR reaction condition</caption> | <caption>PCR reaction condition</caption> | ||
| Line 4,959: | Line 4,845: | ||
<figcaption> | <figcaption> | ||
<div class="p"><span>Restriction enzyme digestion verification</span></div> | <div class="p"><span>Restriction enzyme digestion verification</span></div> | ||
| + | </figcaption> | ||
| + | </figure> | ||
| + | </div> | ||
| + | </div> | ||
| + | </div> | ||
| + | </div> | ||
| + | </div> | ||
| + | <div class="accordion-fragment" id="week18"> | ||
| + | <div class="accordion-header"> | ||
| + | <span class="default">☞</span><span class="active">☟</span> Week18 (Seq 12–Seq 18) | ||
| + | </div> | ||
| + | <div class="accordion-content"> | ||
| + | <div class="tabs" id="tabs7"> | ||
| + | <ul> | ||
| + | <li><a class="circle-number" href="#fragment18-1">➀</a></li> | ||
| + | <li><a class="circle-number" href="#fragment18-2">➁</a></li> | ||
| + | </ul> | ||
| + | <div id="fragment18-1"> | ||
| + | <div class="p"> | ||
| + | We detected the expression of several overexpressed genes at the mRNA level by RT-PCR, and obtained positive results. | ||
| + | </div> | ||
| + | <div class="flex-container"> | ||
| + | <figure> | ||
| + | <img src="https://static.igem.org/mediawiki/2016/f/f8/T--NKU_China--notebook-18-20-01.png" class="white"> | ||
| + | <figcaption> | ||
| + | <div class="p"><span>Relative expression of several overexpressed genes at the mRNA level</span></div> | ||
| + | </figcaption> | ||
| + | </figure> | ||
| + | </div> | ||
| + | </div> | ||
| + | <div id="fragment18-2"> | ||
| + | <div class="p"> | ||
| + | SDS-PAGE was performed to detect the expression of these genes at the protein level. | ||
| + | </div> | ||
| + | <div class="flex-container"> | ||
| + | <figure> | ||
| + | <img src="https://static.igem.org/mediawiki/2016/d/d2/T--NKU_China--notebook-18-20-02.png" class="white"> | ||
| + | <figcaption> | ||
| + | <div class="p"><span>pTrcHisB, pLuxS, pLuxS-Mtn, pLsrACDB, pLsrACDBFG SDS-PAGE</span></div> | ||
| + | </figcaption> | ||
| + | </figure> | ||
| + | </div> | ||
| + | </div> | ||
| + | </div> | ||
| + | </div> | ||
| + | </div> | ||
| + | <div class="accordion-fragment" id="week19"> | ||
| + | <div class="accordion-header"> | ||
| + | <span class="default">☞</span><span class="active">☟</span> Week19 (Seq 19–Seq 25) | ||
| + | </div> | ||
| + | <div class="accordion-content"> | ||
| + | <div class="tabs" id="tabs7"> | ||
| + | <ul> | ||
| + | <li><a class="circle-number" href="#fragment19-1">➀</a></li> | ||
| + | <li><a class="circle-number" href="#fragment19-2">➁</a></li> | ||
| + | </ul> | ||
| + | <div id="fragment19-1"> | ||
| + | <div class="p"> | ||
| + | Cultured media of controllers were tested for the presence of AI-2 by inducing luminescence of <i>Vibrio harveyi</i> reporter strain BB170. | ||
| + | </div> | ||
| + | <div class="flex-container"> | ||
| + | <figure> | ||
| + | <img src="https://static.igem.org/mediawiki/2016/4/4c/T--NKU_China--notebook-18-20-03.jpg"> | ||
| + | <figcaption> | ||
| + | <div class="p"><span>Relative fluorescence intensity of suppliers at specific times</span></div> | ||
| + | </figcaption> | ||
| + | </figure> | ||
| + | <figure> | ||
| + | <img src="https://static.igem.org/mediawiki/2016/f/f7/T--NKU_China--notebook-18-20-04.jpg"> | ||
| + | <figcaption> | ||
| + | <div class="p"><span>Relative fluorescence intensity of consumers at specific times</span></div> | ||
| + | </figcaption> | ||
| + | </figure> | ||
| + | </div> | ||
| + | </div> | ||
| + | <div id="fragment19-2"> | ||
| + | <div class="p"> | ||
| + | HPLC was performed to detect the production of AI-2 of the strain pLuxS. | ||
| + | </div> | ||
| + | <div class="flex-container"> | ||
| + | <figure> | ||
| + | <img src="https://static.igem.org/mediawiki/2016/d/d9/T--NKU_China--notebook-18-20-05.png"> | ||
| + | <figcaption> | ||
| + | <div class="p"><span>HPLC result of AI-2 production of luxS overexpression strain and negative control</span></div> | ||
| + | </figcaption> | ||
| + | </figure> | ||
| + | </div> | ||
| + | </div> | ||
| + | </div> | ||
| + | </div> | ||
| + | </div> | ||
| + | <div class="accordion-fragment" id="week20"> | ||
| + | <div class="accordion-header"> | ||
| + | <span class="default">☞</span><span class="active">☟</span> Week20 (Seq 26–Oct 02) | ||
| + | </div> | ||
| + | <div class="accordion-content"> | ||
| + | <div class="tabs" id="tabs7"> | ||
| + | <ul> | ||
| + | <li><a class="circle-number" href="#fragment20-1">➀</a></li> | ||
| + | <li><a class="circle-number" href="#fragment20-2">➁</a></li> | ||
| + | </ul> | ||
| + | <div id="fragment20-1"> | ||
| + | <div class="p"> | ||
| + | Biofilm studies and evaluation:<br> | ||
| + | pTrcHisB, pLuxS, pLuxSMtn, pLsrACDB, pLsrACDBFG, pLsrACDBK, pLsrACDBFGK were diluted to OD~0.05 and reinoculated at a total volume of 200 μL at a 1:1 (v/v) ratio. IPTG (1 mM) was added at OD ~ 0.4, and biofilms were cultured for ~24 h (+/−30 min) at 30 <sup>o</sup>C in static conditions. After incubation, optical density was read on a plate reader at 600 nm. The supernatant was gently decanted, and each well was washed 3 times with 300 μL of sterile PBS to detach loosely adhered cells. The plate was then incubated at 60 <sup>o</sup>C with the lid off for 60 min, and afterwards, 250 μL of 0.1% crystal violet was added to each well and incubated for 15 min at room temperature. Crystal violet stain was aspirated with a pipette and excess stain was washed off by gently submerging and mixing in a tray filled with distilled water until washings were free of the stain. After the microplate was airdried, the dye was resolubilized by adding 250 μL of 95% ethanol, and incubated at room temperature with shaking for 30 min. The optical density of each well stained with crystal violet was measured at 540 nm. | ||
| + | </div> | ||
| + | <div class="flex-container"> | ||
| + | <figure> | ||
| + | <img src="https://static.igem.org/mediawiki/2016/3/33/T--NKU_China--notebook-18-20-06.jpg"> | ||
| + | <figcaption> | ||
| + | <div class="p"><span>Relative biofilm production of suppliers</span></div> | ||
| + | </figcaption> | ||
| + | </figure> | ||
| + | <figure> | ||
| + | <img src="https://static.igem.org/mediawiki/2016/8/8b/T--NKU_China--notebook-18-20-07.jpg"> | ||
| + | <figcaption> | ||
| + | <div class="p"><span>Relative biofilm production of consumers</span></div> | ||
| + | </figcaption> | ||
| + | </figure> | ||
| + | </div> | ||
| + | </div> | ||
| + | <div id="fragment20-2"> | ||
| + | <div class="p"> | ||
| + | Cultured media of controllers were tested for the presence of AI-2 by HPLC. AI-2 output and uptake profiles of controllers were drawn according to the HPLC results. | ||
| + | </div> | ||
| + | <div class="flex-container"> | ||
| + | <figure> | ||
| + | <img src="https://static.igem.org/mediawiki/2016/e/ed/T--NKU_China--notebook-18-20-08.jpg"> | ||
| + | <figcaption> | ||
| + | <div class="p"><span>AI-2 output profiles of suppliers</span></div> | ||
| + | </figcaption> | ||
| + | </figure> | ||
| + | <figure> | ||
| + | <img src="https://static.igem.org/mediawiki/2016/0/04/T--NKU_China--notebook-18-20-09.jpg"> | ||
| + | <figcaption> | ||
| + | <div class="p"><span>AI-2 uptake profiles of consumers</span></div> | ||
</figcaption> | </figcaption> | ||
</figure> | </figure> | ||
| Line 4,970: | Line 4,992: | ||
</body> | </body> | ||
</html> | </html> | ||
| + | {{NKU_China/footer}} | ||
Latest revision as of 16:17, 19 October 2016
Laboratory Notes
☞☟ Week1 (May 16–May 22)
In order to make sure the efficiency of our "consumer", we should first knock out the luxS gene in our engineering bacteria GR286(a simplified strain of Bacillus amyloliquefaciens LL3). We used a markerless gene replacement method to knock out the luxS gene.
Construction of targeting vector : the upstream and downstream of luxS gene were combined by over-lapping PCR and ligated into plasmid pKSU.
pKSU-ΔluxS was transformed into GR286, and positive clones were selected.
| 2× Taq Master Mix | 10μL |
| pKSU-F | 1μL |
| pKSU-R | 1μL |
| Bacterium solution | 1μL |
| ddH2O | 7μL |
| Total | 20μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 58oC | 30 sec | 30 cycles |
| 72oC | 1 min 30 sec | |
| 72oC | 10 min | |
| 16oC | ∞ |
Selection of positive clones by PCR
The transformants were cultured at 42oC with chloramphenicol to select single-crossover clones.
| 2× Taq Master Mix | 10μL |
| luxS-up-F | 1μL |
| luxS-dn-R | 1μL |
| Bacterium solution | 1μL |
| ddH2O | 7μL |
| Total | 20μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 56oC | 30 sec | 30 cycles |
| 72oC | 2 min | |
| 72oC | 10 min | |
| 16oC | ∞ |
Selection of single-crossover clones by PCR
(No.1-4 are single-crossover strains, No.5 is positive control.)
☞☟ Week2 (May 23–May 29)
The single-crossover strains were then cultured in LB medium and passaged every 12 hours for 4 generations.
The last generation was cultured in medium with 5-fluorouracil to select double-crossover clones. Regretfully, we didn't get the double-crossover clones.
| 2× Taq Master Mix | 10μL |
| luxS-up-F | 1μL |
| luxS-dn-R | 1μL |
| Bacterium solution | 1μL |
| ddH2O | 7μL |
| Total | 20μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 56oC | 30 sec | 30 cycles |
| 72oC | 2 min | |
| 72oC | 10 min | |
| 16oC | ∞ |
Selection of double-crossover clones by PCR
(No.1-5 are experimental groups, No.6 is wild GR286. The result showed that we failed to get the double-crossover clones.)
☞☟ Week3 (May 30–Jun 05)
Transformants were cultured at 42oC with chloramphenicol again and the single-crossover clones were selected successfully.
| 2× Taq Master Mix | 10μL |
| luxS-up-F | 1μL |
| luxS-dn-R | 1μL |
| Bacterium solution | 1μL |
| ddH2O | 7μL |
| Total | 20μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 56oC | 30 sec | 30 cycles |
| 72oC | 2 min | |
| 72oC | 10 min | |
| 16oC | ∞ |
Selection of single-crossover clones by PCR
(No.1&2&4 are single-crossover strains,No.5 is positive control. )
The single-crossover strains were then cultured in LB medium and passaged every 12 hours for 4 generations.
The last generation was cultured in medium with 5-fluorouracil to select double-crossover clones. We finally obtained our aimed strain—GR286ΔluxS.
| 2× Taq Master Mix | 10μL |
| luxS-up-F | 1μL |
| luxS-dn-R | 1μL |
| Bacterium solution | 1μL |
| ddH2O | 7μL |
| Total | 20μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 56oC | 30 sec | 30 cycles |
| 72oC | 2 min | |
| 72oC | 10 min | |
| 16oC | ∞ |
Selection of ΔluxS clones by PCR
(The No.4 is the aimed strain―GR286ΔluxS)
☞☟ Week4 (Jun 06–Jun 12)
The GR286ΔluxS strain was cultured and made competent for future use.
The lsrACDB gene from Bacillus thuringiensis was cloned and ligated to T-vector.
| 2× Taq Master Mix | 25μL |
| lsrACDB-F | 2μL |
| lsrACDB-R | 2μL |
| Bacterium solution | 2μL |
| ddH2O | 19μL |
| Total | 50μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 57oC | 30 sec | 30 cycles |
| 72oC | 4 min 30 sec | |
| 72oC | 10 min | |
| 16oC | ∞ |
| 10× DNA Ligase Buffer | 2μL |
| T4 DNA Ligase | 1μL |
| pMD19 T-Simple Vector | 1μL |
| lsrACDB | 3μL |
| ddH2O | 13μL |
| Total | 20μL |
| Reaction condition: 16oC overnight | |
The T-lsrACDB was transformed into DH5α and plate was coated, and then positive clones were selected.
| 2× Taq Master Mix | 10μL |
| M13F | 1μL |
| M13R | 1μL |
| Bacterium solution | 1μL |
| ddH2O | 7μL |
| Total | 20μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 59oC | 30 sec | 30 cycles |
| 72oC | 4 min 30 sec | |
| 72oC | 10 min | |
| 16oC | ∞ |
Selection of positive clones by PCR
(No. 3&4 are positive results)
After restriction enzyme digestion verification, the positive clones were then sequenced. Unfortunately, the sequencing result showed some mutations inside the target gene.
| 10× FastDigest Buffer | 2μL |
| BamH Ⅰ | 1μL |
| T-lsrACDB | 1μL |
| ddH2O | 7μL |
| Total | 20μL |
| Reaction condition: 37oC for 40 min | |
Restriction enzyme digestion verification
(No.1 are lsrACDB fragement, No.2 are linearized T-vector.)
The gene cloning process was repeated but there were still some mutations.
We finally decided to request the gene company to synthesize the lsrACDB gene.
☞☟ Week5 (Jun 13–Jun 19)
This week, we started to construct another controller―supplier.
A strong promoter C2 was cloned from former kit and luxS gene was cloned from GR286.
| 2× Taq Master Mix | 25μL |
| C2-F | 2μL |
| C2-R | 2μL |
| p-C2 | 2μL |
| ddH2O | 19μL |
| Total | 50μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 58oC | 15 sec | 30 cycles |
| 72oC | 30 sec | |
| 72oC | 10 min | |
| 16oC | ∞ |
| 2× Taq Master Mix | 25μL |
| luxS-F | 2μL |
| luxS-R | 2μL |
| Bacterium solution | 1μL |
| GR286 | 2μL |
| ddH2O | 19μL |
| Total | 50μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 59oC | 30 sec | 30 cycles |
| 72oC | 30 sec | |
| 72oC | 10 min | |
| 16oC | ∞ |
PCR cloning product of promoter C2 and gene luxS
(NO.1&2 are C2, No.3&4 are luxS)
Two segments were fused together by fusion PCR and ligated into T-vector. After that, the vector was transformed into DH5α.
| 2× Taq Master Mix | 25μL |
| C2-F | 2μL |
| luxS-R | 2μL |
| C2 | 2μL |
| luxS | 2μL |
| ddH2O | 17μL |
| Total | 50μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 59oC | 30 sec | 30 cycles |
| 72oC | 40 sec | |
| 72oC | 10 min | |
| 16oC | ∞ |
| 10× DNA Ligase Buffer | 2μL |
| T4 DNA Ligase | 1μL |
| pMD19 T-Simple Vector | 1μL |
| C2-luxS | 4μL |
| ddH2O | 12μL |
| Total | 20μL |
| Reaction condition: 16oC overnight | |
Positive clones were selected by colony PCR.
| 2× Taq Master Mix | 10μL |
| M13-F | 1μL |
| M13-R | 1μL |
| Bacterium solution | 1μL |
| ddH2O | 7μL |
| Total | 20μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 59oC | 30 sec | 30 cycles |
| 72oC | 40 sec | |
| 72oC | 10 min | |
| 16oC | ∞ |
PCR cloning product of promoter C2 and gene luxS
4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
| 10× FastDigest Buffer | 2μL |
| BamH Ⅰ | 1μL |
| T-lsrACDB | 1μL |
| ddH2O | 7μL |
| Total | 20μL |
| Reaction condition: 37oC for 40 min | |
Restriction enzyme digestion verification
(No.1 are linearized T-vector, No.2 are C2-luxS fragment.)
☞☟ Week6 (Jun 20–Jun 26)
The sequencing result showed that there was a correct strain and thus it could be used for the following experiments. We obtained the correct plasmid T-C2-luxS from DH5α. Then the fragment C2-luxS was obtained by digestion and gel extraction.
| 10× FastDigest Buffer | 4μL |
| BamH Ⅰ | 2μL |
| T-C2-luxS | 25μL |
| ddH2O | 9μL |
| Total | 20μL |
| Reaction condition: 37oC for 40 min | |
The C2-luxS fragment was ligated to linearized plasmid pWH1520, and then the ligation product was transformed into DH5α.
| 10× DNA Ligase Buffer | 2μL |
| T4 DNA Ligase | 1μL |
| pMD19 T-Simple Vector | 1μL |
| C2-luxS | 5μL |
| ddH2O | 11μL |
| Total | 20μL |
| Reaction condition: 16oC overnight | |
The plasmid pWH-C2-luxS was extracted from DH5α. To prevent the plasmid from DAM&DCM methylation, we transformed it into E.coli JM110.
The plasmid pWH-C2-luxS was extracted from JM110,and then it was treated with BamH Ⅰ methylase.
| 10× BamH Ⅰ methyltransferase Buffer | 10μL |
| BamH Ⅰ methyltransferase | 1μL |
| S-adenosylmethionine | 0.5μL |
| pWH-C2-luxS | 80μL |
| ddH2O | 8.5μL |
| Total | 100μL |
| Reaction condition: 37oC for 1 hour | |
The plasmid was transformed into GR286 by electroporation.[Failed]
Selection of positive clones by colony PCR
(No.1 is positive control, No.2-6 are experimental groups. The result showed that we failed to transformed the plasmid pWH-C2-luxS into GR286)
☞☟ Week7 (Jun 27–Jul 03)
This week, we tried to use different voltages to transform the plasmid. Sadly, all of these attempts rendered negative results.
We considered whether the luxS gene is toxic for GR286, and the bacteria tends to reject the gene when a strong promoter is inserted upstream of it. So, we planned to use inducible promoter to reconstruct our expression vector.
The plasmid pWH1520 contains a strong xylA promoter originating from Bacillus megaterium, and transcription initiated by this promoter is xylose-inducible. Also, the gene of interest carries its own ribosome binding sequence (RBS) and translation initiation codon. Based on these points, we redesigned primers.
☞☟ Week8 (Jul 04–Jul 10)
luxS gene was cloned from GR286 using our new primers.
| 2× Taq Master Mix | 25μL |
| YD-luxS-F | 2μL |
| YD-luxS-R | 2μL |
| Bacterium solution | 2μL |
| ddH2O | 19μL |
| Total | 50μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 58oC | 30 sec | 30 cycles |
| 72oC | 40 sec | |
| 72oC | 10 min | |
| 16oC | ∞ |
PCR cloning product of gene luxS
The luxS fragment was purified by gel extraction, and ligated into linearized pWH1520. Then the vector was transformed into DH5α.
| 10× FastDigest Buffer | 4μL |
| BamH Ⅰ | 2μL |
| pWH1520 | 25μL |
| ddH2O | 9μL |
| Total | 40μL |
| Reaction condition: 37oC for 40 min | |
| 10× DNA Ligase Buffer | 2μL |
| T4 DNA Ligase | 1μL |
| linearized pWH1520 | 1μL |
| luxS | 3μL |
| ddH2O | 13μL |
| Total | 20μL |
| Reaction condition: 16oC overnight | |
Positive clones were selected by colony PCR.
| 2× Taq Master Mix | 10μL |
| pWH-F | 1μL |
| pWH-R | 1μL |
| Bacterium solution | 1μL |
| ddH2O | 7μL |
| Total | 20μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 58oC | 30 sec | 30 cycles |
| 72oC | 40 sec | |
| 72oC | 10 min | |
| 16oC | ∞ |
Selection of positive clones by colony PCR
4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
| 10× FastDigest Buffer | 2μL |
| BamH Ⅰ | 1μL |
| pWH-luxs | 10μL |
| ddH2O | 7μL |
| Total | 20μL |
| Reaction condition: 37oC for 40 min | |
Restriction enzyme digestion verification
(No.1 are linearized pWH1520, No.2 are luxS fragments.)
☞☟ Week9 (Jul 11–Jul 17)
The sequencing result showed there's three positive strains. So one positive strain was chosen to be used for the following experiments. The pWH-luxS plasmid was extracted from the chosen strain. To prevent the plasmid from DAM&DCM methylation, we transformed it into E.coli JM110.
the plasmid pWH-luxS was extracted from JM110,and it was treated withBamH Ⅰ methylase.
| 10× BamH Ⅰ methyltransferase Buffer | 10μL |
| BamH Ⅰ methyltransferase | 1μL |
| S-adenosylmethionine | 0.5μL |
| pWH-C2-luxS | 80μL |
| ddH2O | 8.5μL |
| Total | 100μL |
| Reaction condition: 37oC for 1 hour | |
The plasmid was transformed into GR286 by electroporation, and positive clones were selected.
Selection of positive clones by colony PCR
The construction of supplier was accomplished!
☞☟ Week10 (Jul 18–Jul 24)
We have received the product of synthetic lsrACDB gene. We first used restriction-ligation method to ligate lsrACDB to plasmid pWH1520, but we failed to select positive after several tries.
| 10× DNA Ligase Buffer | 2μL |
| T4 DNA Ligase | 1μL |
| linearized pWH1520 | 1μL |
| lsrACDB | 3μL |
| ddH2O | 13μL |
| Total | 20μL |
| Reaction condition: 16oC overnight | |
Considering that the lsrACDB gene is a large fragment (4500bp), we used ClonExpress technique to clone the gene again to improve the efficiency of ligation. The lsrACDB sequence was divided into two parts and they were cloned separately. Then the two segments were ligated to the plasmid pWH1520 and the recombinant vector was transformed into DH5α. After that, verification PCR was used to select the positive clones. However, we didn't get a good result.
Selection of positive clones by colony PCR
(No.6 is positive control, No.1-5 are experimental groups)
☞☟ Week11 (Jul 25–Jul 31)
We learnt a new method called circular polymerase extension cloning (CPEC) for high-throughput cloning of complex and combinatorial DNA libraries, and we decided to use this method to try to ligate our lsrACDB gene. It's encouraging that we succeeded to ligate the lsrACDB gene to the plasmid pHT-01.
Selection of positive clones by colony PCR
(No.3-6 are positive clones)
Restriction enzyme digestion verification
(No.2&3 are positive results.)
☞☟ Week12 (Aug 1–Aug 7)
Since we have already successfully constructed "supplier" and part of "consumer", we decided to measure the growth curve to explore the function of our "controller".
| GR286 | wild strain as control group |
| GR286ΔluxS | GR286 without luxS gene |
| pWH-luxS | luxS overexpression plasmid in GR286; without induced by xylose |
| pWH-luxS + xyl | luxS overexpression plasmid in GR286; induced by xylose |
| pWH1520 | empty plasmid in GR286 as control group |
| pHT-lsrACDB | lsrACDB overexpression plasmid in GR286ΔluxS |
| pHT-01 | empty plasmid in GR286ΔluxS as control group |
OD600 of different groups at specific times
Growth curve of GR286 and GR286ΔluxS
Growth curve of pWH-luxS, pWH-luxS + xyl and pWH1520
Growth curve of pHT-lsrACDB and pHT-01
Cultured media of our supplier was tested for the presence of AI-2 by inducing luminescence of Vibrio harveyi reporter strain BB170.
Fluorescence intensity of different groups at specific times
Relative fluorescence intensity of different groups
☞☟ Week13 (Aug 8–Aug 14)
For our consumer, we should also overexpress the lsrK and lsrFG gene for phosphorylating and degrading phosphorylated AI-2. We used ClonExpress technique to clone the two genes and ligate them to plasmid pHT-01 successfully.
Restriction enzyme digestion verification
(No.1&3&4 are positive results. )
We co-cultured the supplier with BB170 and tested the fluorescence intensity to explore the function of supplier. (negative result)
Fluorescence intensity of BB170 and co-culture medium
☞☟ Week14 (Aug 15–Aug 21)
Since the controller we constructed with GR286 did not demonstrate positive results, we decided to substitute GR286 with Escherichia coli whose AI-2 metabolic pathway had been elucidated as the chassis of our controller.
-
The strains to be constructed are shown in the tables below.
AI-2 supplier LuxS Mtn pTrcHisB Native Native pLuxS Induced Native pLuxS-Mtn Induced Induced AI-2 consumer LsrACDB LsrK LsrFG pTrcHisB Native Native Native pLsrACDB Induced Native Native pLsrFG Native Native Induced pLsrK Native Induced Native pLsrACDBFG Induced Native Induced pLsrACDBK Induced Constitutive Native plsrACDBFGK Induced Constitutive Induced -
The sequences of lsrACDB, lsrFG, lsrK, luxS, mtn gene in E.coli K12 were searched in NCBI, and primers were designed according to the gene sequences. The primers used in the construction of AI-2 controller are shown in the table below.
Primers used in the construction of AI-2 controller Primer name Sequence lsrACDBFG1-F CGACGATGACGATAAGGATCCATGCAAACGAGTGATACCCGC lsrACDBFG1-R TGTTTGGCGTTTCCGGCAGCGGTGCGGAGAGC lsrACDBFG2-F TGTTTGGCGTTTCCGCGATTG lsrACDBFG2-R GCACTCTCACACCACGTTGCATGGCGCGTTTC lsrACDBFG3-F GTGGTGTGAGAGTGCTGAC lsrACDBFG3-R ACCAGCTGCAGATCTCGAGCTCGTCACGGCATCAACCCATTGAAC lsrACDB1-F CGACGATGACGATAAGGATCCATGCAAACGAGTGATACCCGC lsrACDB1-R ACCGGAACCGCCGAGCAAACTAATGCCGCCCAGCAC lsrACDB2-F CTCGGCGGTTCCGGTGCGAT lsrACDB2-R ACCAGCTGCAGATCTCGAGCTCGTCAGAAATCGTATTTGCCG luxS-F ATGACGATAAGGATCCGAGCTCGATGCCGTTGTTAGATAGCTTC luxS-R GGACTCCCCCGGGGGACTAAATGTGCAGTTCCTGCAACTTC mtn-F TCCCCCGGGGGAGTCCTCTCCCGCGTGAGAAATAC mtn-R TATGGTACCAGCTGCAGATCTCTTAGCCATGTGCAAGTTTCTG luxS-Fd GGAATTCCCTAAATGTGCAGTTCCTGCAACTTC luxS-Rv GGGGTACCCCATGCCGTTGTTAGATAGCTTCACAG lsrK-Fd GGGGTACCCCATGGCTCGACTCTTTACC lsrK-Rv GGAATTCCCTATAACCCAGGCGCTTTCC lsrFG-Fd CGGGATCCCGATGGCAGATTTAGACGATATTAAAGATGG lsrFG-Rv GAAGATCTTCTCACGGCATCAACCCATTGAAC lsrK-F AACTGCAGAACCAATGCATTGGTTTACGGCTAGCTCAGTCCTAGGTATAGTGCTAGCAAAGAGGAGAAAATGGCTCGACTCTTTACC lsrK-R TTCGAACTATAACCCAGGCGCTTTCC BK-JC-F TTTCAGTGTATGTCGCGGATGC GK-JC-F TTGCGCTTCGATGTCTTACAGG pTrc-JC-F TGGGCACTCGACCGGAATTATC pTrc-JC-R GCTACTGCCGCCAGGCAAATTC
- Construction of pLuxS-Mtn
luxS gene was cloned from E.coli K12.
| PrimeSTAR Max Premix(2×) | 25μL |
| luxS-F | 2μL |
| luxS-R | 2μL |
| E.coli K12 | 2μL |
| ddH2O | 19μL |
| Total | 50μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 63oC | 30 sec | 30 cycles |
| 72oC | 30 sec | |
| 72oC | 10 min | |
| 16oC | ∞ |
PCR cloning product of gene luxS
| PrimeSTAR Max Premix(2×) | 25μL |
| mtn-F | 2μL |
| mtn-R | 2μL |
| E.coli K12 | 2μL |
| ddH2O | 19μL |
| Total | 50μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 63oC | 30sec | 30 cycles |
| 72oC | 45 sec | |
| 72oC | 10 min | |
| 16oC | ∞ |
PCR cloning product of gene mtn
ClonExpress technique was used to ligate luxS and mtn genes to plasmid pTrcHisB. The recombinant vector pTrc-luxS-mtn was transformed into E.coli K12. After that, verification PCR was performed to select the positive clones.
| PrimeSTAR Max Premix(2×) | 10μL |
| pTrc-JC-F | 1μL |
| pTrc-JC-R | 1μL |
| Bacterium solution | 1μL |
| ddH2O | 7μL |
| Total | 20μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 58oC | 30sec | 30 cycles |
| 72oC | 1 min 30 sec | |
| 72oC | 10 min | |
| 16oC | ∞ |
Selection of positive clones by PCR
(NO.3&5&8 are positive results)
3 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
| 10× FastDigest Buffer | 2μL |
| Sac Ⅰ | 1μL |
| Bgl Ⅱ | 1μL |
| pTrc-luxS-mtn | 6μL |
| ddH2O | 10μL |
| Total | 20μL |
| Reaction condition: 37oC for 40 min | |
Restriction enzyme digestion verification
(No.1 are linearized pTrcHisB, No.2 are luxS-mtn fragment. )
☞☟ Week15 (Aug 22–Aug 28)
- Construction of pLuxS
- Construction of pLsrACDB
- Construction of pLsrACDBFG
luxS gene was cloned from E.coli K12.
| PrimeSTAR Max Premix(2×) | 25μL |
| luxS-Fd | 2μL |
| luxS-Rv | 2μL |
| E.coli K12 | 2μL |
| ddH2O | 19μL |
| Total | 50μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 60oC | 30 sec | 30 cycles |
| 72oC | 30 sec | |
| 72oC | 10 min | |
| 16oC | ∞ |
PCR cloning product of gene luxS
The luxS gene was purified by gel extraction. Then, both the luxS segment and pTrcHisB vector were treated with restriction enzyme. After that, luxS gene was ligated to linearized pTrcHisB, and the ligation product was transformed into E.coli K12.
| 10× FastDigest Buffer | 4μL |
| Kpn Ⅰ | 2μL |
| EcoR Ⅰ | 2μL |
| luxS | 25μL |
| ddH2O | 7μL |
| Total | 40μL |
| Reaction condition: 37oC for 40 min | |
| 10× FastDigest Buffer | 4μL |
| Kpn Ⅰ | 2μL |
| EcoR Ⅰ | 2μL |
| pTrcHisB | 20μL |
| ddH2O | 12μL |
| Total | 40μL |
| Reaction condition: 37oC for 40 min | |
| 10× DNA Ligase Buffer | 2μL |
| T4 DNA Ligase | 1μL |
| linearized pTrcHisB | 1μL |
| luxS | 3μL |
| ddH2O | 13μL |
| Total | 20μL |
| Reaction condition: 16oC overnight | |
Verification PCR was performed to select the positive clones.
| 2× Taq Master Mix | 10μL |
| pTrc-JC-F | 1μL |
| pTrc-JC-R | 1μL |
| Bacterium solution | 1μL |
| ddH2O | 7μL |
| Total | 20μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 58oC | 30sec | 30 cycles |
| 72oC | 50 sec | |
| 72oC | 10 min | |
| 16oC | ∞ |
Selection of positive clones by PCR
One positive strain was chosen to be cultured overnight and plasmid was extracted. After restriction enzyme digestion verification, the positive clone was sequenced.
| 10× FastDigest Buffer | 2μL |
| Kpn Ⅰ | 1μL |
| EcoR Ⅰ | 1μL |
| pTrc-luxS | 6μL |
| ddH2O | 10μL |
| Total | 20μL |
| Reaction condition: 37oC for 40 min | |
Restriction enzyme digestion verification
(No.1 is linearized pTrcHisB + luxS, No.2 is plasmid pTrc-luxS. )
The lsrACDBFG sequence was divided into three parts and they were cloned separately. Then the three segments were ligated to the linearized pTrcHisB by ClonExpress technique, and the recombinant vector was transformed into DH5α.
| PrimeSTAR Max Premix(2×) | 25μL |
| lsrACDB1-F | 2μL |
| lsrACDB1-R | 2μL |
| E.coli K12 | 2μL |
| ddH2O | 19μL |
| Total | 50μL |
| PrimeSTAR Max Premix(2×) | 25μL |
| lsrACDB2-F | 2μL |
| lsrACDB2-R | 2μL |
| E.coli K12 | 2μL |
| ddH2O | 19μL |
| Total | 50μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 60oC | 30 sec | 30 cycles |
| 72oC | 2 min 20 sec | |
| 72oC | 10 min | |
| 16oC | ∞ |
PCR cloning product of segment lsrACDB1,lsrACDB12
Verification PCR was performed to select the positive clones.
Selection of positive clones by PCR
4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
| 10× FastDigest Buffer | 2μL |
| BamH Ⅰ | 1μL |
| Sac Ⅰ | 1μL |
| pTrc-lsrACDB | 6μL |
| ddH2O | 10μL |
| Total | 20μL |
| Reaction condition: 37oC for 40 min | |
Restriction enzyme digestion verification
The lsrACDBFG sequence was divided into three parts and they were cloned separately. Then the three segments were ligated to the linearized pTrcHisB by ClonExpress technique, and the recombinant vector was transformed into DH5α.
| PrimeSTAR Max Premix(2×) | 25μL |
| lsrACDBFG1-F | 2μL |
| lsrACDBFG1-R | 2μL |
| E.coli K12 | 2μL |
| ddH2O | 19μL |
| Total | 50μL |
| PrimeSTAR Max Premix(2×) | 25μL |
| lsrACDBFG2-F | 2μL |
| lsrACDBFG2-R | 2μL |
| E.coli K12 | 2μL |
| ddH2O | 19μL |
| Total | 50μL |
| PrimeSTAR Max Premix(2×) | 25μL |
| lsrACDBFG3-F | 2μL |
| lsrACDBFG3-R | 2μL |
| E.coli K12 | 2μL |
| ddH2O | 19μL |
| Total | 50μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 58oC | 30 sec | 30 cycles |
| 72oC | 2 min | |
| 72oC | 10 min | |
| 16oC | ∞ |
PCR cloning product of segment lsrACDBFG1,lsrACDBFG2, lsrACDBFG3
Verification PCR was performed to select the positive clones.
Selection of positive clones by PCR
4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
| 10× FastDigest Buffer | 2μL |
| BamH Ⅰ | 1μL |
| Sac Ⅰ | 1μL |
| pTrc-lsrACDB | 6μL |
| ddH2O | 10μL |
| Total | 20μL |
| Reaction condition: 37oC for 40 min | |
Restriction enzyme digestion verification
(No.1-4 are linearized pTrcHisB + lsrACDBFG, No.5 is plasmid pTrc-lsrACDBFG.)
☞☟ Week16 (Aug 29–Sep 04)
- Construction of pLsrFG
- Construction of pLsrACDBK
- Construction of pLsrACDBFGK
lsrFG gene was cloned from E.coli K12.
| PrimeSTAR Max Premix(2×) | 25μL |
| lsrFG-Fd | 2μL |
| lsrFG-Rv | 2μL |
| E.coli K12 | 2μL |
| ddH2O | 19μL |
| Total | 50μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 58oC | 30 sec | 30 cycles |
| 72oC | 1 min 15 sec | |
| 72oC | 10 min | |
| 16oC | ∞ |
PCR cloning product of gene lsrFG
The lsrFG gene was purified by gel extraction. Then, both the lsrFG segment and pTrcHisB vector were treated with restriction enzyme. After that, lsrFG gene was ligated to linearized pTrcHisB, and the ligation product was transformed into E.coli K12.
| 10× FastDigest Buffer | 4μL |
| BamH Ⅰ | 2μL |
| Bgl Ⅱ | 2μL |
| lsrFG | 25μL |
| ddH2O | 7μL |
| Total | 40μL |
| Reaction condition: 37oC for 40 min | |
| 10× FastDigest Buffer | 4μL |
| BamH Ⅰ | 2μL |
| Bgl Ⅱ | 2μL |
| pTrcHisB | 20μL |
| ddH2O | 12μL |
| Total | 40μL |
| Reaction condition: 37oC for 40 min | |
| 10× DNA Ligase Buffer | 2μL |
| T4 DNA Ligase | 1μL |
| pMD19 T-Simple Vector | 1μL |
| luxSFG | 3μL |
| ddH2O | 13μL |
| Total | 20μL |
| Reaction condition: 16oC overnight | |
Verification PCR was performed to select the positive clones.
| 2× Taq Master Mix | 10μL |
| pTrc-JC-F | 1μL |
| pTrc-JC-R | 1μL |
| Bacterium solution | 1μL |
| ddH2O | 7μL |
| Total | 20μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 58oC | 30 sec | 30 cycles |
| 72oC | 1 min 30 sec | |
| 72oC | 10 min | |
| 16oC | ∞ |
Selection of positive clones by PCR
(NO. 1&3 are positive results)
Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
| 10× FastDigest Buffer | 2μL |
| BamH Ⅰ | 1μL |
| Bgl Ⅱ | 1μL |
| pTrc-lsrFG | 6μL |
| ddH2O | 10μL |
| Total | 20μL |
| Reaction condition: 37oC for 40 min | |
Restriction enzyme digestion verification
lsrK gene was cloned from E.coli K12.
| PrimeSTAR Max Premix(2×) | 25μL |
| lsrK-F | 2μL |
| lsrK-R | 2μL |
| E.coli K12 | 2μL |
| ddH2O | 19μL |
| Total | 50μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 55oC | 30 sec | 30 cycles |
| 72oC | 1 min 40 sec | |
| 72oC | 10 min | |
| 16oC | ∞ |
PCR cloning product of gene lsrK
The lsrK gene was purified by gel extraction. Then, both the lsrK segment and pTrc-lsrACDB vector were treated with restriction enzyme. After that, lsrK gene was ligated to linearized pTrc-lsrACDB, and the ligation product was transformed into E.coli K12.
| 10× FastDigest Buffer | 4μL |
| Pst Ⅰ | 2μL |
| BstB Ⅰ | 2μL |
| lsrK | 25μL |
| ddH2O | 7μL |
| Total | 40μL |
| Reaction condition: 37oC for 40 min | |
| 10× FastDigest Buffer | 4μL |
| Pst Ⅰ | 2μL |
| BstB Ⅰ | 2μL |
| pTrc-lsrACDB | 25μL |
| ddH2O | 7μL |
| Total | 40μL |
| Reaction condition: 37oC for 40 min | |
| 10× DNA Ligase Buffer | 2μL |
| T4 DNA Ligase | 1μL |
| linearized pTrc-lsrACDB | 1μL |
| lsrK | 3μL |
| ddH2O | 13μL |
| Total | 20μL |
| Reaction condition: 16oC overnight | |
Verification PCR was performed to select the positive clones.
| 2× Taq Master Mix | 10μL |
| BK-JC-F | 1μL |
| pTrc-JC-R | 1μL |
| Bacterium solution | 1μL |
| ddH2O | 7μL |
| Total | 20μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 58oC | 30 sec | 30 cycles |
| 72oC | 2 min | |
| 72oC | 10 min | |
| 16oC | ∞ |
Selection of positive clones by PCR
(NO. 1&3 are positive results)
Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
| 10× FastDigest Buffer | 2μL |
| Pst Ⅰ | 1μL |
| BstB Ⅰ | 1μL |
| pTrc-lsrACDBK | 6μL |
| ddH2O | 10μL |
| Total | 20μL |
| Reaction condition: 37oC for 40 min | |
Restriction enzyme digestion verification
lsrK gene was cloned from E.coli K12.
| PrimeSTAR Max Premix(2×) | 25μL |
| lsrK-F | 2μL |
| lsrK-R | 2μL |
| E.coli K12 | 2μL |
| ddH2O | 19μL |
| Total | 50μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 55oC | 30 sec | 30 cycles |
| 72oC | 1 min 40 sec | |
| 72oC | 10 min | |
| 16oC | ∞ |
PCR cloning product of gene lsrK
The lsrK gene was purified by gel extraction. Then, both the lsrK segment and pTrc-lsrACDBFG vector were treated with restriction enzyme. After that, lsrK gene was ligated to linearized pTrc-lsrACDBFG, and the ligation product was transformed into E.coli K12.
| 10× FastDigest Buffer | 4μL |
| Pst Ⅰ | 2μL |
| BstB Ⅰ | 2μL |
| lsrK | 25μL |
| ddH2O | 7μL |
| Total | 40μL |
| Reaction condition: 37oC for 40 min | |
| 10× FastDigest Buffer | 4μL |
| Pst Ⅰ | 2μL |
| BstB Ⅰ | 2μL |
| pTrc-lsrACDBFG | 20μL |
| ddH2O | 12μL |
| Total | 40μL |
| Reaction condition: 37oC for 40 min | |
| 10× DNA Ligase Buffer | 2μL |
| T4 DNA Ligase | 1μL |
| linearized pTrc-lsrACDFGB | 1μL |
| lsrK | 3μL |
| ddH2O | 13μL |
| Total | 20μL |
| Reaction condition: 16oC overnight | |
Verification PCR was performed to select the positive clones.
| 2× Taq Master Mix | 10μL |
| GK-JC-F | 1μL |
| pTrc-JC-R | 1μL |
| Bacterium solution | 1μL |
| ddH2O | 7μL |
| Total | 20μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 58oC | 30 sec | 30 cycles |
| 72oC | 2 min | |
| 72oC | 10 min | |
| 16oC | ∞ |
Selection of positive clones by PCR
(NO.3 is positive result)
Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
| 10× FastDigest Buffer | 2μL |
| Pst Ⅰ | 1μL |
| BstB Ⅰ | 1μL |
| pTrc-lsrACDBKFGK | 6μL |
| ddH2O | 10μL |
| Total | 20μL |
| Reaction condition: 37oC for 40 min | |
Restriction enzyme digestion verification
☞☟ Week17 (Sep 05–Sep 11)
- Construction of pLsrK
lsrK gene was cloned from E.coli K12.
| PrimeSTAR Max Premix(2×) | 25μL |
| lsrK-Fd | 2μL |
| lsrK-Rv | 2μL |
| E.coli K12 | 2μL |
| ddH2O | 19μL |
| Total | 50μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 55oC | 30 sec | 30 cycles |
| 72oC | 1 min 40 sec | |
| 72oC | 10 min | |
| 16oC | ∞ |
PCR cloning product of gene lsrK
The lsrK gene was purified by gel extraction. Then, both the lsrK segment and pTrc-lsrACDBFG vector were treated with restriction enzyme. After that, lsrK gene was ligated to linearized pTrc-lsrACDBFG, and the ligation product was transformed into E.coli K12.
| 10× FastDigest Buffer | 4μL |
| Kpn Ⅰ | 2μL |
| EcoR Ⅰ | 2μL |
| lsrK | 25μL |
| ddH2O | 7μL |
| Total | 40μL |
| Reaction condition: 37oC for 40 min | |
| 10× FastDigest Buffer | 4μL |
| Pst Ⅰ | 2μL |
| BstB Ⅰ | 2μL |
| pTrc-HisB | 20μL |
| ddH2O | 12μL |
| Total | 40μL |
| Reaction condition: 37oC for 40 min | |
| 10× DNA Ligase Buffer | 2μL |
| T4 DNA Ligase | 1μL |
| linearized pTrcHisB | 1μL |
| lsrK | 3μL |
| ddH2O | 13μL |
| Total | 20μL |
| Reaction condition: 16oC overnight | |
Verification PCR was performed to select the positive clones.
| 2× Taq Master Mix | 10μL |
| pTrc-JC-F | 1μL |
| pTrc-JC-R | 1μL |
| Bacterium solution | 1μL |
| ddH2O | 7μL |
| Total | 20μL |
}
| 94oC | 10 min | |
| 94oC | 30 sec | |
| 58oC | 30 sec | 30 cycles |
| 72oC | 2 min | |
| 72oC | 10 min | |
| 16oC | ∞ |
Selection of positive clones by PCR
4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
| 10× FastDigest Buffer | 2μL |
| Kpn Ⅰ | 1μL |
| EcoR Ⅰ | 1μL |
| pTrc-lsrK | 6μL |
| ddH2O | 10μL |
| Total | 20μL |
| Reaction condition: 37oC for 40 min | |
Restriction enzyme digestion verification
☞☟ Week18 (Seq 12–Seq 18)
We detected the expression of several overexpressed genes at the mRNA level by RT-PCR, and obtained positive results.
Relative expression of several overexpressed genes at the mRNA level
SDS-PAGE was performed to detect the expression of these genes at the protein level.
pTrcHisB, pLuxS, pLuxS-Mtn, pLsrACDB, pLsrACDBFG SDS-PAGE
☞☟ Week19 (Seq 19–Seq 25)
Cultured media of controllers were tested for the presence of AI-2 by inducing luminescence of Vibrio harveyi reporter strain BB170.
Relative fluorescence intensity of suppliers at specific times
Relative fluorescence intensity of consumers at specific times
HPLC was performed to detect the production of AI-2 of the strain pLuxS.
HPLC result of AI-2 production of luxS overexpression strain and negative control
☞☟ Week20 (Seq 26–Oct 02)
Biofilm studies and evaluation:
pTrcHisB, pLuxS, pLuxSMtn, pLsrACDB, pLsrACDBFG, pLsrACDBK, pLsrACDBFGK were diluted to OD~0.05 and reinoculated at a total volume of 200 μL at a 1:1 (v/v) ratio. IPTG (1 mM) was added at OD ~ 0.4, and biofilms were cultured for ~24 h (+/−30 min) at 30 oC in static conditions. After incubation, optical density was read on a plate reader at 600 nm. The supernatant was gently decanted, and each well was washed 3 times with 300 μL of sterile PBS to detach loosely adhered cells. The plate was then incubated at 60 oC with the lid off for 60 min, and afterwards, 250 μL of 0.1% crystal violet was added to each well and incubated for 15 min at room temperature. Crystal violet stain was aspirated with a pipette and excess stain was washed off by gently submerging and mixing in a tray filled with distilled water until washings were free of the stain. After the microplate was airdried, the dye was resolubilized by adding 250 μL of 95% ethanol, and incubated at room temperature with shaking for 30 min. The optical density of each well stained with crystal violet was measured at 540 nm.
pTrcHisB, pLuxS, pLuxSMtn, pLsrACDB, pLsrACDBFG, pLsrACDBK, pLsrACDBFGK were diluted to OD~0.05 and reinoculated at a total volume of 200 μL at a 1:1 (v/v) ratio. IPTG (1 mM) was added at OD ~ 0.4, and biofilms were cultured for ~24 h (+/−30 min) at 30 oC in static conditions. After incubation, optical density was read on a plate reader at 600 nm. The supernatant was gently decanted, and each well was washed 3 times with 300 μL of sterile PBS to detach loosely adhered cells. The plate was then incubated at 60 oC with the lid off for 60 min, and afterwards, 250 μL of 0.1% crystal violet was added to each well and incubated for 15 min at room temperature. Crystal violet stain was aspirated with a pipette and excess stain was washed off by gently submerging and mixing in a tray filled with distilled water until washings were free of the stain. After the microplate was airdried, the dye was resolubilized by adding 250 μL of 95% ethanol, and incubated at room temperature with shaking for 30 min. The optical density of each well stained with crystal violet was measured at 540 nm.
Relative biofilm production of suppliers
Relative biofilm production of consumers
Cultured media of controllers were tested for the presence of AI-2 by HPLC. AI-2 output and uptake profiles of controllers were drawn according to the HPLC results.
AI-2 output profiles of suppliers
AI-2 uptake profiles of consumers
sponsors
contact us
Email: iGEM_NKU_China@hotmail.com
Website: 2016.igem.org/Team:NKU_China
Address: Nankai University,
No.94 Weijin Road, Nankai District
Tianjin, P.R.China 300071
No.94 Weijin Road, Nankai District
Tianjin, P.R.China 300071
© NKU_China IGEM - All rights reserved. Based on jQuery and bootstrap.
