Difference between revisions of "Team:NKU China/Notebook"

Latest revision as of 16:17, 19 October 2016

50μL PCR system ×2
2× Taq Master Mix	25μL
C2-F	2μL
C2-R	2μL
p-C2	2μL
ddH2O	19μL
Total	50μL

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	15 sec	30 cycles
72^oC	30 sec
72^oC	10 min
16^oC	∞

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
pMD19 T-Simple Vector	1μL
C2-luxS	4μL
ddH2O	12μL
Total	20μL
Reaction condition: 16^oC overnight

20μL digestion system
10× FastDigest Buffer	2μL
BamH Ⅰ	1μL
T-lsrACDB	1μL
ddH2O	7μL
Total	20μL
Reaction condition: 37^oC for 40 min

100μL methylation system
10× BamH Ⅰ methyltransferase Buffer	10μL
BamH Ⅰ methyltransferase	1μL
S-adenosylmethionine	0.5μL
pWH-C2-luxS	80μL
ddH2O	8.5μL
Total	100μL
Reaction condition: 37^oC for 1 hour

Groups divided in this experiment
GR286	wild strain as control group
GR286ΔluxS	GR286 without luxS gene
pWH-luxS	luxS overexpression plasmid in GR286; without induced by xylose
pWH-luxS + xyl	luxS overexpression plasmid in GR286; induced by xylose
pWH1520	empty plasmid in GR286 as control group
pHT-lsrACDB	lsrACDB overexpression plasmid in GR286ΔluxS
pHT-01	empty plasmid in GR286ΔluxS as control group

Selection of positive clones by colony PCR
(No.1 is positive control, No.2-6 are experimental groups. The result showed that we failed to transformed the plasmid pWH-*C2-luxS* into GR286)

Laboratory Notes

☞☟ Week1 (May 16–May 22)

begin
➀
➁
➂

In order to make sure the efficiency of our "consumer", we should first knock out the luxS gene in our engineering bacteria GR286(a simplified strain of Bacillus amyloliquefaciens LL3). We used a markerless gene replacement method to knock out the luxS gene.

Construction of targeting vector : the upstream and downstream of luxS gene were combined by over-lapping PCR and ligated into plasmid pKSU.

pKSU-ΔluxS was transformed into GR286, and positive clones were selected.

20μL PCR system
2× Taq Master Mix	10μL
pKSU-F	1μL
pKSU-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	1 min 30 sec
72^oC	10 min
16^oC	∞

The transformants were cultured at 42^oC with chloramphenicol to select single-crossover clones.

20μL PCR system
2× Taq Master Mix	10μL
luxS-up-F	1μL
luxS-dn-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
56^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

Selection of single-crossover clones by PCR
(No.1-4 are single-crossover strains,
No.5 is positive control.)

☞☟ Week2 (May 23–May 29)

➀
➁

The single-crossover strains were then cultured in LB medium and passaged every 12 hours for 4 generations.

The last generation was cultured in medium with 5-fluorouracil to select double-crossover clones. Regretfully, we didn't get the double-crossover clones.

20μL PCR system
2× Taq Master Mix	10μL
luxS-up-F	1μL
luxS-dn-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
56^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

Selection of double-crossover clones by PCR
(No.1-5 are experimental groups, No.6 is wild GR286. The result showed that we failed to get the double-crossover clones.)

☞☟ Week3 (May 30–Jun 05)

➀
➁
➂

Transformants were cultured at 42^oC with chloramphenicol again and the single-crossover clones were selected successfully.

20μL PCR system
2× Taq Master Mix	10μL
luxS-up-F	1μL
luxS-dn-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
56^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

Selection of single-crossover clones by PCR
(No.1&2&4 are single-crossover strains,No.5 is positive control. )

The single-crossover strains were then cultured in LB medium and passaged every 12 hours for 4 generations.

The last generation was cultured in medium with 5-fluorouracil to select double-crossover clones. We finally obtained our aimed strain—GR286ΔluxS.

20μL PCR system
2× Taq Master Mix	10μL
luxS-up-F	1μL
luxS-dn-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
56^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

Selection of Δ*luxS* clones by PCR
(The No.4 is the aimed strain&horbar;GR286Δ*luxS*)

☞☟ Week4 (Jun 06–Jun 12)

➀
➁
➂
➃
➄
➅

The GR286ΔluxS strain was cultured and made competent for future use.

The lsrACDB gene from Bacillus thuringiensis was cloned and ligated to T-vector.

50μL PCR system ×2
2× Taq Master Mix	25μL
lsrACDB-F	2μL
lsrACDB-R	2μL
Bacterium solution	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
57^oC	30 sec	30 cycles
72^oC	4 min 30 sec
72^oC	10 min
16^oC	∞

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
pMD19 T-Simple Vector	1μL
lsrACDB	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

The T-lsrACDB was transformed into DH5α and plate was coated, and then positive clones were selected.

20μL PCR system
2× Taq Master Mix	10μL
M13F	1μL
M13R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
59^oC	30 sec	30 cycles
72^oC	4 min 30 sec
72^oC	10 min
16^oC	∞

Selection of positive clones by PCR
(No. 3&4 are positive results)

After restriction enzyme digestion verification, the positive clones were then sequenced. Unfortunately, the sequencing result showed some mutations inside the target gene.

20μL digestion system
10× FastDigest Buffer	2μL
BamH Ⅰ	1μL
T-lsrACDB	1μL
ddH2O	7μL
Total	20μL
Reaction condition: 37^oC for 40 min

Restriction enzyme digestion verification
(No.1 are *lsrACDB* fragement, No.2 are linearized T-vector.)

The gene cloning process was repeated but there were still some mutations.

We finally decided to request the gene company to synthesize the lsrACDB gene.

☞☟ Week5 (Jun 13–Jun 19)

begin
➀
➁
➂
➃

This week, we started to construct another controller―supplier.

A strong promoter C2 was cloned from former kit and luxS gene was cloned from GR286.

50μL PCR system ×2
2× Taq Master Mix	25μL
C2-F	2μL
C2-R	2μL
p-C2	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	15 sec	30 cycles
72^oC	30 sec
72^oC	10 min
16^oC	∞

50μL PCR system ×2
2× Taq Master Mix	25μL
luxS-F	2μL
luxS-R	2μL
Bacterium solution	1μL
GR286	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
59^oC	30 sec	30 cycles
72^oC	30 sec
72^oC	10 min
16^oC	∞

PCR cloning product of promoter C2 and gene *luxS*
(NO.1&2 are C2, No.3&4 are *luxS*)

Two segments were fused together by fusion PCR and ligated into T-vector. After that, the vector was transformed into DH5α.

50μL PCR system ×2
2× Taq Master Mix	25μL
C2-F	2μL
luxS-R	2μL
C2	2μL
luxS	2μL
ddH2O	17μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
59^oC	30 sec	30 cycles
72^oC	40 sec
72^oC	10 min
16^oC	∞

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
pMD19 T-Simple Vector	1μL
C2-luxS	4μL
ddH2O	12μL
Total	20μL
Reaction condition: 16^oC overnight

Positive clones were selected by colony PCR.

20μL PCR system
2× Taq Master Mix	10μL
M13-F	1μL
M13-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
59^oC	30 sec	30 cycles
72^oC	40 sec
72^oC	10 min
16^oC	∞

PCR cloning product of promoter C2 and gene *luxS*

4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
BamH Ⅰ	1μL
T-lsrACDB	1μL
ddH2O	7μL
Total	20μL
Reaction condition: 37^oC for 40 min

Restriction enzyme digestion verification
(No.1 are linearized T-vector, No.2 are *C2-luxS* fragment.)

☞☟ Week6 (Jun 20–Jun 26)

➀
➁
➂
➃
➄

The sequencing result showed that there was a correct strain and thus it could be used for the following experiments. We obtained the correct plasmid T-C2-luxS from DH5α. Then the fragment C2-luxS was obtained by digestion and gel extraction.

40μL digestion system
10× FastDigest Buffer	4μL
BamH Ⅰ	2μL
T-C2-luxS	25μL
ddH2O	9μL
Total	20μL
Reaction condition: 37^oC for 40 min

The C2-luxS fragment was ligated to linearized plasmid pWH1520, and then the ligation product was transformed into DH5α.

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
pMD19 T-Simple Vector	1μL
C2-luxS	5μL
ddH2O	11μL
Total	20μL
Reaction condition: 16^oC overnight

The plasmid pWH-C2-luxS was extracted from DH5α. To prevent the plasmid from DAM&DCM methylation, we transformed it into E.coli JM110.

The plasmid pWH-C2-luxS was extracted from JM110,and then it was treated with BamH Ⅰ methylase.

100μL methylation system
10× BamH Ⅰ methyltransferase Buffer	10μL
BamH Ⅰ methyltransferase	1μL
S-adenosylmethionine	0.5μL
pWH-C2-luxS	80μL
ddH2O	8.5μL
Total	100μL
Reaction condition: 37^oC for 1 hour

The plasmid was transformed into GR286 by electroporation.[Failed]

☞☟ Week7 (Jun 27–Jul 03)

➀
➁
➂

This week, we tried to use different voltages to transform the plasmid. Sadly, all of these attempts rendered negative results.

We considered whether the luxS gene is toxic for GR286, and the bacteria tends to reject the gene when a strong promoter is inserted upstream of it. So, we planned to use inducible promoter to reconstruct our expression vector.

The plasmid pWH1520 contains a strong xylA promoter originating from Bacillus megaterium, and transcription initiated by this promoter is xylose-inducible. Also, the gene of interest carries its own ribosome binding sequence (RBS) and translation initiation codon. Based on these points, we redesigned primers.

☞☟ Week8 (Jul 04–Jul 10)

➀
➁
➂
➃

luxS gene was cloned from GR286 using our new primers.

50μL PCR system ×2
2× Taq Master Mix	25μL
YD-luxS-F	2μL
YD-luxS-R	2μL
Bacterium solution	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	40 sec
72^oC	10 min
16^oC	∞

The luxS fragment was purified by gel extraction, and ligated into linearized pWH1520. Then the vector was transformed into DH5α.

40μL digestion system ×2
10× FastDigest Buffer	4μL
BamH Ⅰ	2μL
pWH1520	25μL
ddH2O	9μL
Total	40μL
Reaction condition: 37^oC for 40 min

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
linearized pWH1520	1μL
luxS	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

Positive clones were selected by colony PCR.

20μL PCR system
2× Taq Master Mix	10μL
pWH-F	1μL
pWH-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	40 sec
72^oC	10 min
16^oC	∞

Selection of positive clones by colony PCR

4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
BamH Ⅰ	1μL
pWH-luxs	10μL
ddH2O	7μL
Total	20μL
Reaction condition: 37^oC for 40 min

Restriction enzyme digestion verification
(No.1 are linearized pWH1520, No.2 are *luxS* fragments.)

☞☟ Week9 (Jul 11–Jul 17)

➀
➁
➂
end

The sequencing result showed there's three positive strains. So one positive strain was chosen to be used for the following experiments. The pWH-luxS plasmid was extracted from the chosen strain. To prevent the plasmid from DAM&DCM methylation, we transformed it into E.coli JM110.

the plasmid pWH-luxS was extracted from JM110,and it was treated withBamH Ⅰ methylase.

100μL methylation system
10× BamH Ⅰ methyltransferase Buffer	10μL
BamH Ⅰ methyltransferase	1μL
S-adenosylmethionine	0.5μL
pWH-C2-luxS	80μL
ddH2O	8.5μL
Total	100μL
Reaction condition: 37^oC for 1 hour

The plasmid was transformed into GR286 by electroporation, and positive clones were selected.

The construction of supplier was accomplished!

☞☟ Week10 (Jul 18–Jul 24)

➀
➁

We have received the product of synthetic lsrACDB gene. We first used restriction-ligation method to ligate lsrACDB to plasmid pWH1520, but we failed to select positive after several tries.

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
linearized pWH1520	1μL
lsrACDB	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

Considering that the lsrACDB gene is a large fragment (4500bp), we used ClonExpress technique to clone the gene again to improve the efficiency of ligation. The lsrACDB sequence was divided into two parts and they were cloned separately. Then the two segments were ligated to the plasmid pWH1520 and the recombinant vector was transformed into DH5α. After that, verification PCR was used to select the positive clones. However, we didn't get a good result.

Selection of positive clones by colony PCR
(No.6 is positive control, No.1-5 are experimental groups)

☞☟ Week11 (Jul 25–Jul 31)

➀

We learnt a new method called circular polymerase extension cloning (CPEC) for high-throughput cloning of complex and combinatorial DNA libraries, and we decided to use this method to try to ligate our lsrACDB gene. It's encouraging that we succeeded to ligate the lsrACDB gene to the plasmid pHT-01.

Selection of positive clones by colony PCR
(No.3-6 are positive clones)

Restriction enzyme digestion verification
(No.2&3 are positive results.)

☞☟ Week12 (Aug 1–Aug 7)

➀
➁

Since we have already successfully constructed "supplier" and part of "consumer", we decided to measure the growth curve to explore the function of our "controller".

Groups divided in this experiment
GR286	wild strain as control group
GR286ΔluxS	GR286 without luxS gene
pWH-luxS	luxS overexpression plasmid in GR286; without induced by xylose
pWH-luxS + xyl	luxS overexpression plasmid in GR286; induced by xylose
pWH1520	empty plasmid in GR286 as control group
pHT-lsrACDB	lsrACDB overexpression plasmid in GR286ΔluxS
pHT-01	empty plasmid in GR286ΔluxS as control group

OD₆₀₀ of different groups at specific times

Growth curve of pWH-*luxS*, pWH-*luxS* + xyl and pWH1520

Growth curve of pHT-*lsrACDB* and pHT-01

Cultured media of our supplier was tested for the presence of AI-2 by inducing luminescence of Vibrio harveyi reporter strain BB170.

Fluorescence intensity of different groups at specific times

Relative fluorescence intensity of different groups

☞☟ Week13 (Aug 8–Aug 14)

➀
➁

For our consumer, we should also overexpress the lsrK and lsrFG gene for phosphorylating and degrading phosphorylated AI-2. We used ClonExpress technique to clone the two genes and ligate them to plasmid pHT-01 successfully.

Restriction enzyme digestion verification
(No.1&3&4 are positive results. )

We co-cultured the supplier with BB170 and tested the fluorescence intensity to explore the function of supplier. (negative result)

Fluorescence intensity of BB170 and co-culture medium

☞☟ Week14 (Aug 15–Aug 21)

begin
outline
1.1
1.2
1.3

Since the controller we constructed with GR286 did not demonstrate positive results, we decided to substitute GR286 with Escherichia coli whose AI-2 metabolic pathway had been elucidated as the chassis of our controller.

The strains to be constructed are shown in the tables below.

AI-2 supplier
	LuxS	Mtn
pTrcHisB	Native	Native
pLuxS	Induced	Native
pLuxS-Mtn	Induced	Induced

AI-2 consumer
	LsrACDB	LsrK	LsrFG
pTrcHisB	Native	Native	Native
pLsrACDB	Induced	Native	Native
pLsrFG	Native	Native	Induced
pLsrK	Native	Induced	Native
pLsrACDBFG	Induced	Native	Induced
pLsrACDBK	Induced	Constitutive	Native
plsrACDBFGK	Induced	Constitutive	Induced

The sequences of lsrACDB, lsrFG, lsrK, luxS, mtn gene in E.coli K12 were searched in NCBI, and primers were designed according to the gene sequences. The primers used in the construction of AI-2 controller are shown in the table below.

Primers used in the construction of AI-2 controller
Primer name	Sequence
lsrACDBFG1-F	CGACGATGACGATAAGGATCCATGCAAACGAGTGATACCCGC
lsrACDBFG1-R	TGTTTGGCGTTTCCGGCAGCGGTGCGGAGAGC
lsrACDBFG2-F	TGTTTGGCGTTTCCGCGATTG
lsrACDBFG2-R	GCACTCTCACACCACGTTGCATGGCGCGTTTC
lsrACDBFG3-F	GTGGTGTGAGAGTGCTGAC
lsrACDBFG3-R	ACCAGCTGCAGATCTCGAGCTCGTCACGGCATCAACCCATTGAAC
lsrACDB1-F	CGACGATGACGATAAGGATCCATGCAAACGAGTGATACCCGC
lsrACDB1-R	ACCGGAACCGCCGAGCAAACTAATGCCGCCCAGCAC
lsrACDB2-F	CTCGGCGGTTCCGGTGCGAT
lsrACDB2-R	ACCAGCTGCAGATCTCGAGCTCGTCAGAAATCGTATTTGCCG
luxS-F	ATGACGATAAGGATCCGAGCTCGATGCCGTTGTTAGATAGCTTC
luxS-R	GGACTCCCCCGGGGGACTAAATGTGCAGTTCCTGCAACTTC
mtn-F	TCCCCCGGGGGAGTCCTCTCCCGCGTGAGAAATAC
mtn-R	TATGGTACCAGCTGCAGATCTCTTAGCCATGTGCAAGTTTCTG
luxS-Fd	GGAATTCCCTAAATGTGCAGTTCCTGCAACTTC
luxS-Rv	GGGGTACCCCATGCCGTTGTTAGATAGCTTCACAG
lsrK-Fd	GGGGTACCCCATGGCTCGACTCTTTACC
lsrK-Rv	GGAATTCCCTATAACCCAGGCGCTTTCC
lsrFG-Fd	CGGGATCCCGATGGCAGATTTAGACGATATTAAAGATGG
lsrFG-Rv	GAAGATCTTCTCACGGCATCAACCCATTGAAC
lsrK-F	AACTGCAGAACCAATGCATTGGTTTACGGCTAGCTCAGTCCTAGGTATAGTGCTAGCAAAGAGGAGAAAATGGCTCGACTCTTTACC
lsrK-R	TTCGAACTATAACCCAGGCGCTTTCC
BK-JC-F	TTTCAGTGTATGTCGCGGATGC
GK-JC-F	TTGCGCTTCGATGTCTTACAGG
pTrc-JC-F	TGGGCACTCGACCGGAATTATC
pTrc-JC-R	GCTACTGCCGCCAGGCAAATTC

Construction of pLuxS-Mtn

luxS gene was cloned from E.coli K12.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
luxS-F	2μL
luxS-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
63^oC	30 sec	30 cycles
72^oC	30 sec
72^oC	10 min
16^oC	∞

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
mtn-F	2μL
mtn-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
63^oC	30sec	30 cycles
72^oC	45 sec
72^oC	10 min
16^oC	∞

ClonExpress technique was used to ligate luxS and mtn genes to plasmid pTrcHisB. The recombinant vector pTrc-luxS-mtn was transformed into E.coli K12. After that, verification PCR was performed to select the positive clones.

20μL PCR system
PrimeSTAR Max Premix(2×)	10μL
pTrc-JC-F	1μL
pTrc-JC-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30sec	30 cycles
72^oC	1 min 30 sec
72^oC	10 min
16^oC	∞

Selection of positive clones by PCR
(NO.3&5&8 are positive results)

3 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
Sac Ⅰ	1μL
Bgl Ⅱ	1μL
pTrc-luxS-mtn	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

Restriction enzyme digestion verification
(No.1 are linearized pTrcHisB, No.2 are *luxS*-*mtn* fragment. )

☞☟ Week15 (Aug 22–Aug 28)

outline
1.1
1.2
1.3
1.4
2.1
2.2
2.3
3.1
3.2
3.3

Construction of pLuxS
Construction of pLsrACDB
Construction of pLsrACDBFG

luxS gene was cloned from E.coli K12.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
luxS-Fd	2μL
luxS-Rv	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
60^oC	30 sec	30 cycles
72^oC	30 sec
72^oC	10 min
16^oC	∞

The luxS gene was purified by gel extraction. Then, both the luxS segment and pTrcHisB vector were treated with restriction enzyme. After that, luxS gene was ligated to linearized pTrcHisB, and the ligation product was transformed into E.coli K12.

40μL digestion system ×2
10× FastDigest Buffer	4μL
Kpn Ⅰ	2μL
EcoR Ⅰ	2μL
luxS	25μL
ddH2O	7μL
Total	40μL
Reaction condition: 37^oC for 40 min

40μL digestion system ×2
10× FastDigest Buffer	4μL
Kpn Ⅰ	2μL
EcoR Ⅰ	2μL
pTrcHisB	20μL
ddH2O	12μL
Total	40μL
Reaction condition: 37^oC for 40 min

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
linearized pTrcHisB	1μL
luxS	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

Verification PCR was performed to select the positive clones.

20μL PCR system ×2
2× Taq Master Mix	10μL
pTrc-JC-F	1μL
pTrc-JC-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30sec	30 cycles
72^oC	50 sec
72^oC	10 min
16^oC	∞

One positive strain was chosen to be cultured overnight and plasmid was extracted. After restriction enzyme digestion verification, the positive clone was sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
Kpn Ⅰ	1μL
EcoR Ⅰ	1μL
pTrc-luxS	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

Restriction enzyme digestion verification
(No.1 is linearized pTrcHisB + *luxS*, No.2 is plasmid pTrc-*luxS*. )

The lsrACDBFG sequence was divided into three parts and they were cloned separately. Then the three segments were ligated to the linearized pTrcHisB by ClonExpress technique, and the recombinant vector was transformed into DH5α.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrACDB1-F	2μL
lsrACDB1-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrACDB2-F	2μL
lsrACDB2-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
60^oC	30 sec	30 cycles
72^oC	2 min 20 sec
72^oC	10 min
16^oC	∞

PCR cloning product of segment *lsrACDB1*,*lsrACDB1*2

Verification PCR was performed to select the positive clones.

4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
BamH Ⅰ	1μL
Sac Ⅰ	1μL
pTrc-lsrACDB	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

The lsrACDBFG sequence was divided into three parts and they were cloned separately. Then the three segments were ligated to the linearized pTrcHisB by ClonExpress technique, and the recombinant vector was transformed into DH5α.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrACDBFG1-F	2μL
lsrACDBFG1-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrACDBFG2-F	2μL
lsrACDBFG2-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrACDBFG3-F	2μL
lsrACDBFG3-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

PCR cloning product of segment *lsrACDBFG*1,*lsrACDBFG*2, *lsrACDBFG*3

Verification PCR was performed to select the positive clones.

4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
BamH Ⅰ	1μL
Sac Ⅰ	1μL
pTrc-lsrACDB	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

Restriction enzyme digestion verification
(No.1-4 are linearized pTrcHisB + *lsrACDBFG*, No.5 is plasmid pTrc-*lsrACDBFG*.)

☞☟ Week16 (Aug 29–Sep 04)

outline
1.1
1.2
1.3
1.4
2.1
2.2
2.3
2.4
3.1
3.2
3.3
3.4

Construction of pLsrFG
Construction of pLsrACDBK
Construction of pLsrACDBFGK

lsrFG gene was cloned from E.coli K12.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrFG-Fd	2μL
lsrFG-Rv	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	1 min 15 sec
72^oC	10 min
16^oC	∞

The lsrFG gene was purified by gel extraction. Then, both the lsrFG segment and pTrcHisB vector were treated with restriction enzyme. After that, lsrFG gene was ligated to linearized pTrcHisB, and the ligation product was transformed into E.coli K12.

40μL digestion system ×2
10× FastDigest Buffer	4μL
BamH Ⅰ	2μL
Bgl Ⅱ	2μL
lsrFG	25μL
ddH2O	7μL
Total	40μL
Reaction condition: 37^oC for 40 min

40μL digestion system ×2
10× FastDigest Buffer	4μL
BamH Ⅰ	2μL
Bgl Ⅱ	2μL
pTrcHisB	20μL
ddH2O	12μL
Total	40μL
Reaction condition: 37^oC for 40 min

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
pMD19 T-Simple Vector	1μL
luxSFG	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

Verification PCR was performed to select the positive clones.

20μL PCR system ×2
2× Taq Master Mix	10μL
pTrc-JC-F	1μL
pTrc-JC-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	1 min 30 sec
72^oC	10 min
16^oC	∞

Selection of positive clones by PCR
(NO. 1&3 are positive results)

Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
BamH Ⅰ	1μL
Bgl Ⅱ	1μL
pTrc-lsrFG	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

lsrK gene was cloned from E.coli K12.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrK-F	2μL
lsrK-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
55^oC	30 sec	30 cycles
72^oC	1 min 40 sec
72^oC	10 min
16^oC	∞

The lsrK gene was purified by gel extraction. Then, both the lsrK segment and pTrc-lsrACDB vector were treated with restriction enzyme. After that, lsrK gene was ligated to linearized pTrc-lsrACDB, and the ligation product was transformed into E.coli K12.

40μL digestion system ×2
10× FastDigest Buffer	4μL
Pst Ⅰ	2μL
BstB Ⅰ	2μL
lsrK	25μL
ddH2O	7μL
Total	40μL
Reaction condition: 37^oC for 40 min

40μL digestion system ×2
10× FastDigest Buffer	4μL
Pst Ⅰ	2μL
BstB Ⅰ	2μL
pTrc-lsrACDB	25μL
ddH2O	7μL
Total	40μL
Reaction condition: 37^oC for 40 min

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
linearized pTrc-lsrACDB	1μL
lsrK	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

Verification PCR was performed to select the positive clones.

20μL PCR system ×2
2× Taq Master Mix	10μL
BK-JC-F	1μL
pTrc-JC-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
Pst Ⅰ	1μL
BstB Ⅰ	1μL
pTrc-lsrACDBK	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

lsrK gene was cloned from E.coli K12.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrK-F	2μL
lsrK-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
55^oC	30 sec	30 cycles
72^oC	1 min 40 sec
72^oC	10 min
16^oC	∞

The lsrK gene was purified by gel extraction. Then, both the lsrK segment and pTrc-lsrACDBFG vector were treated with restriction enzyme. After that, lsrK gene was ligated to linearized pTrc-lsrACDBFG, and the ligation product was transformed into E.coli K12.

40μL digestion system ×2
10× FastDigest Buffer	4μL
Pst Ⅰ	2μL
BstB Ⅰ	2μL
lsrK	25μL
ddH2O	7μL
Total	40μL
Reaction condition: 37^oC for 40 min

40μL digestion system ×2
10× FastDigest Buffer	4μL
Pst Ⅰ	2μL
BstB Ⅰ	2μL
pTrc-lsrACDBFG	20μL
ddH2O	12μL
Total	40μL
Reaction condition: 37^oC for 40 min

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
linearized pTrc-lsrACDFGB	1μL
lsrK	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

Verification PCR was performed to select the positive clones.

20μL PCR system ×2
2× Taq Master Mix	10μL
GK-JC-F	1μL
pTrc-JC-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

Selection of positive clones by PCR
(NO.3 is positive result)

Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
Pst Ⅰ	1μL
BstB Ⅰ	1μL
pTrc-lsrACDBKFGK	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

☞☟ Week17 (Sep 05–Sep 11)

outline
1.1
1.2
1.3
1.4

Construction of pLsrK

lsrK gene was cloned from E.coli K12.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrK-Fd	2μL
lsrK-Rv	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
55^oC	30 sec	30 cycles
72^oC	1 min 40 sec
72^oC	10 min
16^oC	∞

The lsrK gene was purified by gel extraction. Then, both the lsrK segment and pTrc-lsrACDBFG vector were treated with restriction enzyme. After that, lsrK gene was ligated to linearized pTrc-lsrACDBFG, and the ligation product was transformed into E.coli K12.

40μL digestion system ×2 ×2
10× FastDigest Buffer	4μL
Kpn Ⅰ	2μL
EcoR Ⅰ	2μL
lsrK	25μL
ddH2O	7μL
Total	40μL
Reaction condition: 37^oC for 40 min

40μL digestion system ×2 ×2
10× FastDigest Buffer	4μL
Pst Ⅰ	2μL
BstB Ⅰ	2μL
pTrc-HisB	20μL
ddH2O	12μL
Total	40μL
Reaction condition: 37^oC for 40 min

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
linearized pTrcHisB	1μL
lsrK	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

Verification PCR was performed to select the positive clones.

20μL PCR system ×2
2× Taq Master Mix	10μL
pTrc-JC-F	1μL
pTrc-JC-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
Kpn Ⅰ	1μL
EcoR Ⅰ	1μL
pTrc-lsrK	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

☞☟ Week18 (Seq 12–Seq 18)

➀
➁

We detected the expression of several overexpressed genes at the mRNA level by RT-PCR, and obtained positive results.

Relative expression of several overexpressed genes at the mRNA level

SDS-PAGE was performed to detect the expression of these genes at the protein level.

pTrcHisB, pLuxS, pLuxS-Mtn, pLsrACDB, pLsrACDBFG SDS-PAGE

☞☟ Week19 (Seq 19–Seq 25)

➀
➁

Cultured media of controllers were tested for the presence of AI-2 by inducing luminescence of Vibrio harveyi reporter strain BB170.

Relative fluorescence intensity of suppliers at specific times

Relative fluorescence intensity of consumers at specific times

HPLC was performed to detect the production of AI-2 of the strain pLuxS.

HPLC result of AI-2 production of luxS overexpression strain and negative control

☞☟ Week20 (Seq 26–Oct 02)

➀
➁

Biofilm studies and evaluation:
pTrcHisB, pLuxS, pLuxSMtn, pLsrACDB, pLsrACDBFG, pLsrACDBK, pLsrACDBFGK were diluted to OD~0.05 and reinoculated at a total volume of 200 μL at a 1:1 (v/v) ratio. IPTG (1 mM) was added at OD ~ 0.4, and biofilms were cultured for ~24 h (+/−30 min) at 30 ^oC in static conditions. After incubation, optical density was read on a plate reader at 600 nm. The supernatant was gently decanted, and each well was washed 3 times with 300 μL of sterile PBS to detach loosely adhered cells. The plate was then incubated at 60 ^oC with the lid off for 60 min, and afterwards, 250 μL of 0.1% crystal violet was added to each well and incubated for 15 min at room temperature. Crystal violet stain was aspirated with a pipette and excess stain was washed off by gently submerging and mixing in a tray filled with distilled water until washings were free of the stain. After the microplate was airdried, the dye was resolubilized by adding 250 μL of 95% ethanol, and incubated at room temperature with shaking for 30 min. The optical density of each well stained with crystal violet was measured at 540 nm.

Relative biofilm production of suppliers

Relative biofilm production of consumers

Cultured media of controllers were tested for the presence of AI-2 by HPLC. AI-2 output and uptake profiles of controllers were drawn according to the HPLC results.

@@ Line 5: / Line 5: @@
      <!--separatrix-->
      <style>
-         .main#protocols {
+         .main#notebook {
-             padding: 0 6vw;
+             padding: 0 8vw;
-            padding-bottom: 10vh;
-            line-height: 1.42857;
-            font-family: Verdana,Arial,sans-serif;
-            font-size: 1.2rem;
          }
-         .main#protocols .h1 {
+         #notebook .ui-accordion .ui-accordion-content {
-             padding-bottom: 0;
+             height: calc(100vh - 13rem - 18px);
+            position: relative;
+            z-index: 3;
+            box-sizing: border-box;
+            background-color: transparent;
          }
-         #protocols section {
+         #notebook .ui-tabs {
-             margin: 2rem 0 0 0;
+             margin: 0.2rem;
-            border: 0.35rem solid skyblue;
+             background-color: transparent;
-             border-color: #555;
-            border-radius: 0.375rem;
          }
-         #protocols section .h2 {
+         #notebook .ui-tabs .ui-tabs-nav .ui-tabs-anchor {
-            text-align: left;
+             font-weight:normal;
-             font-size: 1.5rem;
-            color: cyan;
-            margin: 0rem 0 1rem 0.5rem;
          }
-         #protocols section .h3 {
+         #week16 .ui-tabs-anchor {
-            clear: both;
+             font-size:1.2rem;
-             font-size: 2rem;
-            margin: 1rem 0 2rem 0.5rem;
          }
-         #protocols section > .p, #protocols section .accordion {
+         #notebook .ui-tabs .ui-tabs-nav .ui-tabs-anchor.circle-number {
-             margin: 0.5rem;
+             font-weight:bold;
          }
-         #protocols .accordion-content {
+         #notebook .ui-tabs .ui-tabs-panel {
-             font-size: 1.2rem;
+             position: relative;
-             padding: 1rem;
+            z-index: 0;
+            background-color: transparent;
+            height: calc(100vh - 17rem - 18px);
+             overflow: auto;
          }
-         #protocols section dt {
+         #notebook .ui-tabs-panel > .p, #notebook .ui-tabs-panel > ol, #notebook .ui-tabs-panel > ul {
-            font-size: 1.5rem;
+             margin: 0.8rem 1.6rem;
-             margin-bottom: 1rem;
-            font-family: Pacifico;
          }
-         #protocols section .h3, #protocols section dt {
+         #notebook .flex-container {
-             color: dodgerblue;
+             display: flex;
+            justify-content: space-around;
+            align-content: space-around;
+            flex-wrap: wrap;
+            background-color: transparent;
          }
-         #protocols .accordion-content .p {
+         #notebook  .table-wrapper {
-             margin: 0.5rem;
+             margin: auto;
+            padding: 1rem;
+            position:relative;
          }
-        #protocols .accordion-content li {
+         .table-wrapper div.rbrace {
-             margin: 0.5rem;
+             font-weight:100;
-             text-indent: 0;
+            color:dodgerblue;
+            position:absolute;
+            right:6.5rem;
+             bottom:5rem;
+            font-size:4rem;
+            z-index:4;
          }
-         #protocols .accordion-content img {
-            display: block;
+         #notebook  table {
-             margin: 0.5rem auto;
+             margin: 0;
-            position: relative;
-            z-index: 3;
          }
-         #protocols .accordion-content img.float {
+         #notebook table, #dongzhuoer td {
-             float: right;
+             border: none;
-            margin-right: 0.5rem;
          }
-         #protocols .accordion-content .reference {
+         #notebook  table {
-            text-indent: 0;
              font-size: 1rem;
-             margin-bottom: 0;
+             padding: 0;
          }
-         #protocols .accordion-content figure {
+         #notebook  table caption {
-             margin: 1rem auto;
+            border-top: 0.1rem solid;
+            border-bottom: 0.1rem solid;
+            margin: 0;
+            padding: 0.2rem 0;
+            text-align: center;
+            background-color: white;
+        }
+        #notebook  table tr {
+             margin: 0;
+            padding: 0;
+            background-color: white;
+        }
+        #notebook  table td {
+            border: none;
+            margin: 0;
+            padding: 0.2rem 1.2rem;
+        }
+        #notebook table tr:last-child td {
+            border-bottom: 0.1rem solid;
+        }
+        figure {
+            text-align: center;
+            font-size: 0.9rem;
+            margin: auto;
+            padding: 1rem;
          }
          figure img {
              width: 100%;
-             margin-bottom: 0.25rem;
+             margin-bottom:0.25rem;
+        }
+        figure img.white {
+            background-color:white;
          }
          figure figcaption {
-             text-align: center;
+             text-align:center;
-             line-height: 1.25;
+             line-height:1.25;
          }
-         #protocols .accordion-content table {
+         #notebook figure figcaption .p {
-             margin: 1rem auto;
+             text-indent:0;
-            border: 0.1rem solid skyblue;
+             text-align:center;
-             border-left: none;
-            border-right: none;
-            background-color: transparent;
-            color: white;
          }
-         #protocols .accordion-content table td {
+         #notebook .ui-tabs-panel li {
-             border: none;
+            margin:0.3rem;
-             padding: 0.2rem;
+        }
+    </style>
+    <style title="table-theme.css">
+        /**/
+        #notebook .table-theme-0 {
+            /*color: rgb(49,132,155);*/
+            background-color:transparent;
+            border-collapse:collapse;
+            /*color:blue;*/
+        }
+        #notebook .table-theme-0 tr {
+            background-color:transparent;
+        }
+        #notebook .table-theme-0 tr td {
+            background-color:transparent;
+            border:0.05rem solid white;
+            border-bottom-width:0.05rem;
+        }
+        #notebook .table-theme-0 tr:last-child td {
+            border-bottom-width:0.05rem;
+        }
+        #notebook .table-theme-0 caption {
+             border:none;
+             background-color:transparent;
+        }
+        /*PCR system*/
+        #notebook .table-theme-1 {
+            color: rgb(49,132,155);
+        }
+        #notebook .table-theme-1 caption {
+            border-top-color: rgb(75,172,198);
+            border-bottom-color: rgb(75,172,198);
+        }
+        #notebook .table-theme-1 table tr:last-child td {
+            border-bottom-color: rgb(75,172,198);
+        }
+        #notebook .table-theme-1 tr:nth-child(odd) {
+            background-color: rgb(210,234,241);
+        }
+        /*PCR reaction condition*/
+        #notebook .table-theme-2 {
+            color: rgb(118,146,60);
+            position:relative;
+        }
+        #notebook .table-theme-2 caption {
+            border-top-color: rgb(155, 187, 89);
+            border-bottom-color: rgb(155, 187, 89);
+        }
+        #notebook .table-theme-2 table tr:last-child td {
+            border-bottom-color: rgb(75,172,198);
+        }
+        #notebook .table-theme-2 tr:nth-child(odd) {
+            background-color: rgb(230,238,213);
+        }
+        /*ligation system*/
+        #notebook .table-theme-3 {
+            color: rgb(95, 73, 122);
+        }
+        #notebook .table-theme-3 caption {
+            border-top-color: rgb(128, 100, 162);
+            border-bottom-color: rgb(128, 100, 162);
+        }
+        #notebook .table-theme-3 table tr:last-child td {
+            border-bottom-color: rgb(128, 100, 162);
+        }
+        #notebook .table-theme-3 tr:nth-child(odd) {
+            background-color: rgb(223, 215, 232);
+        }
+        /*digestion system*/
+        #notebook .table-theme-4 {
+            color: rgb(148, 54, 52);
+        }
+        #notebook .table-theme-4 caption {
+            border-top-color: rgb(192, 80, 77);
+            border-bottom-color: rgb(192, 80, 77);
+        }
+        #notebook .table-theme-4 table tr:last-child td {
+            border-bottom-color: rgb(192, 80, 77);
+        }
+        #notebook .table-theme-4 tr:nth-child(odd) {
+            background-color: rgb(239, 211, 210);
+        }
+        /*methylation  system*/
+        #notebook .table-theme-5 {
+            color: rgb(227, 108, 10);
+        }
+        #notebook .table-theme-5 caption {
+            border-top-color: rgb(247, 150, 70);
+            border-bottom-color: rgb(247, 150, 70);
+        }
+        #notebook .table-theme-5 table tr:last-child td {
+            border-bottom-color: rgb(247, 150, 70);
+        }
+        #notebook .table-theme-5 tr:nth-child(odd) {
+            background-color: rgb(253, 228, 208);
+        }
+        /*Groups divided*/
+        #notebook .table-theme-6 {
+            color: rgb(0, 0, 0);
+        }
+        #notebook .table-theme-6 caption {
+            border-top-color: rgb(0, 0, 0);
+            border-bottom-color: rgb(0, 0, 0);
          }
-         #protocols .accordion-content span.notice {
+         #notebook .table-theme-6 table tr:last-child td {
-             color: gold;
+             border-bottom-color: rgb(0, 0, 0);
          }
-         #protocols #demo {
+         #notebook .table-theme-6 tr:nth-child(odd) {
-            margin-left: 10rem;
+             background-color: rgb(192, 192, 192);
-             text-indent: 0;
          }
      </style>
-     <script>
+     <script title="ready-js">
          $(function () {
-             adjust_figure(1.02);
+             adjust_figure(1.2);
-             $(".accordion").accordion({
+             $("#accordion").accordion({
                  header: ".accordion-header",
                  event: 'click',
                  heightStyle: 'content',
                  collapsible: true,
-                 active:false,
+                 active: 18,
                  icons: false,
              });
-             // particles();
+             $('.tabs').each(
-         })
+                function (index, value) {
+                    $(value).tabs({
+                        event: "mouseover",
+                        heightStyle: 'content',
+                        active:2,
+                    });
+                }
+            )
+            $('#particles-js').hide();
+         });
      </script>
 </head>
 <body id="dongzhuoer">
+    <div style="display:none">
+        <table class="table-theme-1" id="50&mu;L PCR system &times;2">
+            <caption>50&mu;L PCR system &times;2</caption>
+            <tr>
+                <td>2&times; Taq Master Mix</td>
+                <td>25&mu;L</td>
+            </tr>
+            <tr>
+                <td>C2-F</td>
+                <td>2&mu;L</td>
+            </tr>
+            <tr>
+                <td>C2-R</td>
+                <td>2&mu;L</td>
+            </tr>
+            <tr>
+                <td>p-C2</td>
+                <td>2&mu;L</td>
+            </tr>
+            <tr>
+                <td>ddH2O</td>
+                <td>19&mu;L</td>
+            </tr>
+            <tr>
+                <td>Total</td>
+                <td>50&mu;L</td>
+            </tr>
+        </table>
+        <table class="table-theme-2" id="PCR reaction condition">
+            <caption>PCR reaction condition</caption>
+            <tr>
+                <td>94<sup>o</sup>C</td>
+                <td>10 min</td>
+                <td></td>
+            </tr>
+            <tr>
+                <td>94<sup>o</sup>C</td>
+                <td>30 sec</td>
+                <td></td>
+            </tr>
+            <tr>
+                <td>58<sup>o</sup>C</td>
+                <td>15 sec</td>
+                <td>30 cycles</td>
+            </tr>
+            <tr>
+                <td>72<sup>o</sup>C</td>
+                <td>30 sec</td>
+                <td></td>
+            </tr>
+            <tr>
+                <td>72<sup>o</sup>C</td>
+                <td>10 min</td>
+                <td></td>
+            </tr>
+            <tr>
+                <td>16<sup>o</sup>C</td>
+                <td>&infin;</td>
+                <td></td>
+            </tr>
+        </table>
+        <table class="table-theme-3" id="20&mu;L ligation system">
+            <caption>20&mu;L ligation system</caption>
+            <tr>
+                <td>10&times; DNA Ligase Buffer</td>
+                <td>2&mu;L</td>
+            </tr>
+            <tr>
+                <td>T4 DNA Ligase</td>
+                <td>1&mu;L</td>
+            </tr>
+            <tr>
+                <td>pMD19 T-Simple Vector</td>
+                <td>1&mu;L</td>
+            </tr>
+            <tr>
+                <td><i>C2-luxS</i></td>
+                <td>4&mu;L</td>
+            </tr>
+            <tr>
+                <td>ddH2O</td>
+                <td>12&mu;L</td>
+            </tr>
+            <tr>
+                <td>Total</td>
+                <td>20&mu;L</td>
+            </tr>
+            <tr>
+                <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+            </tr>
+        </table>
+        <table class="table-theme-4" id="20&mu;L digestion  system">
+            <caption>20&mu;L digestion  system</caption>
+            <tr>
+                <td>10&times; FastDigest Buffer</td>
+                <td>2&mu;L</td>
+            </tr>
+            <tr>
+                <td>BamH &#8544;</td>
+                <td>1&mu;L</td>
+            </tr>
+            <tr>
+                <td>T-<i>lsrACDB</i></td>
+                <td>1&mu;L</td>
+            </tr>
+            <tr>
+                <td>ddH2O</td>
+                <td>7&mu;L</td>
+            </tr>
+            <tr>
+                <td>Total</td>
+                <td>20&mu;L</td>
+            </tr>
+            <tr>
+                <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+            </tr>
+        </table>
+        <table class="table-theme-5" id="100&mu;L methylation  system">
+            <caption>100&mu;L methylation  system</caption>
+            <tr>
+                <td>10&times; BamH &#8544; methyltransferase Buffer</td>
+                <td>10&mu;L</td>
+            </tr>
+            <tr>
+                <td>BamH &#8544; methyltransferase</td>
+                <td>1&mu;L</td>
+            </tr>
+            <tr>
+                <td>S-adenosylmethionine</td>
+                <td>0.5&mu;L</td>
+            </tr>
+            <tr>
+                <td>pWH-<i>C2-luxS</i></td>
+                <td>80&mu;L</td>
+            </tr>
+            <tr>
+                <td>ddH2O</td>
+                <td>8.5&mu;L</td>
+            </tr>
+            <tr>
+                <td>Total</td>
+                <td>100&mu;L</td>
+            </tr>
+            <tr>
+                <td colspan="2">Reaction condition: 37<sup>o</sup>C for 1 hour</td>
+            </tr>
+        </table>
+        <table class="table-theme-6" id="Groups divided in this experiment">
+            <caption>Groups divided in this experiment</caption>
+            <tr>
+                <td>GR286</td>
+                <td>wild strain as control group</td>
+            </tr>
+            <tr>
+                <td>GR286&Delta;<i>luxS</i></td>
+                <td>GR286 without <i>luxS</i> gene</td>
+            </tr>
+            <tr>
+                <td>pWH-<i>luxS</i></td>
+                <td><i>luxS</i> overexpression plasmid in GR286; without induced by xylose</td>
+            </tr>
+            <tr>
+                <td>pWH-<i>luxS</i> &plus; xyl</td>
+                <td><i>luxS</i> overexpression plasmid in GR286; induced by xylose</td>
+            </tr>
+            <tr>
+                <td>pWH1520</td>
+                <td>empty plasmid in GR286 as control group</td>
+            </tr>
+            <tr>
+                <td>pHT-<i>lsrACDB</i></td>
+                <td><i>lsrACDB</i> overexpression plasmid in GR286&Delta;<i>luxS</i></td>
+            </tr>
+            <tr>
+                <td>pHT-01</td>
+                <td>empty plasmid in GR286&Delta;<i>luxS</i> as control group</td>
+            </tr>
+        </table>
+        <figure>
+            <img src="image/Notebook/notebook-6-13-1.png" width="347" height="284">
+            <figcaption>
+                <div class="p"><span>Selection of positive clones by colony PCR</span></div>
+                (No.1 is positive control, No.2-6 are experimental groups. The result showed that we failed to transformed the plasmid pWH-<i>C2-luxS</i> into GR286)
+            </figcaption>
+        </figure>
+    </div>
      <div id="particles-js"></div>
      <script src="https://2016.igem.org/Template:NKU_China/js/particlesJS?action=raw&ctype=text/javascript"></script>
-     <div class="main" id="protocols">
+     <div class="main" id="notebook">
-         <div class="h1">Protocols</div>
+         <div class="h1">Laboratory Notes</div>
-         <section>
+         <div id="accordion">
-            <div class="h2 ">1. The Markerless Gene Replacement Method for <i>Bacillus amyloliquefaciens</i> LL3</div>
+             <div class="accordion-fragment" id="week1">
-             <div class="p"><span class="bold">Abstract: </span>This is a markerless gene replacement method that combines a temperature-sensitive plasmid pKSV7 with a counter-selectable marker, the <i>upp</i> gene encoding uracil phosphoribosyltransferase (UPRTase) for the <i>Bacillus amyloliquefaciens</i> strain LL3. This method allows us to adapt a two-step plasmid integration and excision strategy to perform markerless deletion of genes.</div>
+                 <div class="accordion-header">
-            <div class="accordion">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week1 (May 16&ndash;May 22)
-                 <div class="accordion-header"><span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;                </div>
+                </div>
                  <div class="accordion-content">
-                     <div class="h3">Introduction</div>
+                     <div class="tabs" id="tabs1">
-                    <img src="https://static.igem.org/mediawiki/2016/5/59/T--NKU_China--Protocols-01.jpg" class="float">
+                        <ul>
-                    <div class="p">The temperature-sensitive plasmid pKSV7 of <i>Bacillus</i> can replicate at 30<sup>o</sup>C normally, but the plasmid will be lost at 42<sup>o</sup>C. Combined the plasmid with a counter-selectable marker, the markerless gene replacement method can be constructed.</div>
+                            <li><a href="#fragment1-1">begin</a></li>
-                    <div class="p">The <i>upp</i> gene encodes uracil phosphoribosyl transferase (UPRTase), which makes U transfer to UMP. Thus, cell can use extrinsic uracil via the following pathway 5-FU &#10132; 5F(fluorin)-UMP &#10132; 5-F-dUMP. Since the products of this pathway are toxic, cellular growth can be restrained.</div>
+                            <li><a class="circle-number" href="#fragment1-2">&#10112;</a></li>
-                    <div class="p">If <i>upp</i> gene is knocked out, bacteria can resist 5-FU toxicity.</div>
+                            <li><a class="circle-number" href="#fragment1-3">&#10113;</a></li>
-                    <div class="h3">Procedures</div>
+                            <li><a class="circle-number" href="#fragment1-4">&#10114;</a></li>
-                    <ol>
+                        </ul>
-                        <li>&Delta;<i>upp</i> <i>B. amyloliquefaciens</i> LL3 was constructed, which can resist 5-fluorouracil.</li>
+                        <div id="fragment1-1">
-                        <li>Construction of the <i>upp</i> cassette: An 850 bp DNA fragment carrying the <i>upp</i> gene with its 5&apos; regulatory region and its 3&apos; transcription terminator was generated by PCR from <i>B. subtilis</i> 168 genomic DNA using primers Upp-F and Upp-R. After digesting with KpnI and BamHI, the fragment was cloned in the KpnI&ndash;BamHI site of pKSV7. The resulting counter-selective plasmid was designated pKSU.</li>
+                            <div class="p">
-                        <li>The target gene was selected. The upstream sequence A and downstream sequence B of target gene were combined by over-lapping PCR and ligated into plasmid pKSU.</li>
+                                In order to make sure the efficiency of our "consumer", we should first knock out the <i>luxS</i> gene in our engineering bacteria GR286(a simplified strain of <i>Bacillus amyloliquefaciens</i> LL3). We used a markerless gene replacement method to knock out the <i>luxS</i> gene.
-                        <li>Plasmid pKSU is a temperature sensitive plasmid, which replicates at 30<sup>o</sup>C and got expelled at 42<sup>o</sup>C, and contains an <i>upp</i> expression cassette. </li>
+                            </div>
-                         <li>The recombinant plasmid was transformed into the target strain and the resulting transformants were cultured at 42<sup>o</sup>C with chloramphenicol to select single-crossover colonies.</li>
+                        </div>
-                        <li>The single-crossover strains were then cultured in medium with 5-fluorouracil to select double-crossover colonies. </li>
+                        <div id="fragment1-2">
-                    </ol>
+                            <div class="p">
-                    <img src="https://static.igem.org/mediawiki/2016/6/61/T--NKU_China--Protocols-02.jpg">
+                                Construction of targeting vector : the upstream and downstream of <i>luxS</i> gene were combined by over-lapping PCR and ligated into plasmid pKSU.
-                    <div class="p reference"><span class="bold">Reference: </span>Zhang W et al. <i>Applied Microbiology &amp; Biotechnology</i>, 2014.</div>
+                            </div>
+                        </div>
+                        <div id="fragment1-3">
+                            <div class="p">
+                                pKSU-&Delta;<i>luxS</i> was transformed into GR286, and positive clones were selected.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table1-2-1">
+                                        <caption>20&mu;L PCR system</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pKSU-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pKSU-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table1-2-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>1 min 30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/e/e9/T--NKU_China--notebook-1-5-1.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                         </div>
+                        <div id="fragment1-4">
+                            <div class="p">
+                                The transformants were cultured at 42<sup>o</sup>C with chloramphenicol to select single-crossover clones.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table1-3-1">
+                                        <caption>20&mu;L PCR system</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-up-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-dn-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table1-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>56<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/d/de/T--NKU_China--notebook-1-5-2.jpeg">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of single-crossover clones by PCR</span></div>
+                                        (No.1-4 are single-crossover strains, <br>No.5 is positive control.)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
                  </div>
              </div>
-        </section>
+             <div class="accordion-fragment" id="week2">
-        <section>
+                 <div class="accordion-header">
-             <div class="h2">2. Circular Polymerase Extension Cloning (CPEC)</div>
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week2 (May 23&ndash;May 29)
-            <div class="p"><span class="bold">Abstract: </span>Circular polymerase extension cloning (CPEC) is based on polymerase overlap extension and is therefore free of restriction digestion, ligation or single-stranded homologous recombination. CPEC is highly efficient, accurate and user friendly. Once the inserts and the linear vector have been prepared, the CPEC reaction can be completed in 10 min to 3 h, depending on the complexity of the gene libraries.</div>
+                </div>
-            <div class="accordion">
-                 <div class="accordion-header"><span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;</div>
                  <div class="accordion-content">
-                     <div class="h3">Introduction</div>
+                     <div class="tabs" id="tabs2">
-                    <div class="p">CPEC is a single-tube, one-step reaction that normally takes 5&ndash;10 min to complete for everyday laboratory cloning. The method is directional, sequence independent and ligase free. It uses the polymerase extension mechanism2 to join overlapping DNA fragments into a double-stranded circular form, such as a plasmid. In a typical CPEC reaction, linear double-stranded insert(s) and vector are first heat-denatured; the resulting single strands then anneal with their overlapping ends and extend using each other as a template to form double-stranded circular plasmids. In CPEC, all overlapping regions between insert(s) and the vector are unique and carefully designed to have very similar and high melting temperatures (T<sub>m</sub>), which eliminates vector reannealing and concatenation of inserts and makes CPEC very efficient and accurate. The low concentrations of fragments in the reaction favor plasmid circularization and effectively prevent plasmid concatenation. After the CPEC reaction, the perfectly formed double-stranded circular plasmids, with one nick in each strand, can be directly transformed into competent host cells.</div>
+                        <ul>
-                    <img src="https://static.igem.org/mediawiki/2016/d/da/T--NKU_China--Protocols-03.jpg">
+                            <li><a class="circle-number" href="#fragment2-1">&#10112;</a></li>
-                    <div class="h3">Steps</div>
+                            <li><a class="circle-number" href="#fragment2-2">&#10113;</a></li>
-                    <dl>
+                        </ul>
-                        <dt>1. Design of overlapping sequences between vector and insert(s).</dt>
+                        <div id="fragment2-1">
-                        <dd>
+                            <div class="p">
-                            <div class="p">The key to successful CPEC library construction and multiway CPEC is to carefully select and design the overlapping sequences between the vector and the insert(s) so that all overlapping regions share very similar T<sub>m</sub>. The T<sub>m</sub> of the overlapping regions should be as high as possible (ideally between 60 and 70<sup>o</sup>C) to maximize hybridization specificity. The T<sub>m</sub> of all overlapping regions in the final CPEC assembly reaction should match each other as closely as possible, ideally with differences within &plusmn; to 3<sup>o</sup>C. This will help eliminate mis-hybridization and ensure highest cloning efficiency and accuracy. The length of the overlapping region, typically between 15 and 35 bases, is of secondary consideration and is dictated by the T<sub>m</sub>. Standard PCR primer selection rules and software can be applied to facilitate the design process. If PCR is used to introduce overlapping regions with the vector or with adjacent fragments, primers should be designed to include at least two parts, each hybridizing to one end of the two neighboring fragments to be joined. If an additional short sequence needs to be inserted between two existing fragments, it can be simply included in the primer design between the two overlapping regions.</div>
+                                The single-crossover strains were then cultured in LB medium and passaged every 12 hours for 4 generations.
-                        </dd>
+                            </div>
-                        <dt>2. Preparation of linear vector. </dt>
+                        </div>
-                        <dd>
+                        <div id="fragment2-2">
-                            <div class="p">The linear vector can be prepared most conveniently by PCR amplification using primers designed to introduce overlapping regions with the insert(s), as described below in the Procedure; this approach offers the most flexibility in selecting cloning sites. If a convenient restriction site is available on the vector that does not introduce unwanted sequences, restriction digestion can also be used to linearize the vector. To prevent carryover of undigested or intact circular vector templates, we recommend gel purification of the linear vector after PCR amplification or restriction digestion. In addition, to eliminate the effect of any residual carryover vector, we recommend using an empty vector as the starting material for PCR amplification or restriction digestion; this way, any carryover of the empty vector will not interfere with downstream functional assays or screens.</div>
+                            <div class="p">
-                        </dd>
+                                The last generation was cultured in medium with 5-fluorouracil to select double-crossover clones. Regretfully, we didn&#39;t get the double-crossover clones.
-                        <dt>3. Preparation of inserts. </dt>
+                            </div>
-                        <dd>
+                            <div class="flex-container">
-                            <div class="p">The inserts can be a single gene, a gene library, multiple genes or even multiple libraries. They can be isolated from natural sources or synthesized on the basis of in silico designs. Irrespective of whether they are single sequences or libraries, ensure that they share overlapping regions with the vector or neighboring fragments, as described above. If PCR is used to prepare the inserts, as described in the Procedure below, a high-fidelity DNA polymerase (e.g. Phusion DNA polymerase) is preferred in order to minimize the introduction of mutations or addition of an extra nucleotide at the ends of amplified products. Gel purification is sometimes necessary to ensure purity of the products.</div>
+                                <div class="table-wrapper">
-                        </dd>
+                                    <table class="table-theme-1" id="table2-2-1">
-                        <dt>4. CPEC cloning.</dt>
+                                        <caption>20&mu;L PCR system</caption>
-                        <dd>
+                                        <tr>
-                            <div class="p">In the final CPEC assembly and cloning reaction, prepared linear vec<U+00AC>tor and inserts are mixed together with the reaction cocktail, which includes dNTPs, 1&times;PCR buffer and a thermal-stable high-fidelity DNA polymerase. The composition of the CPEC reaction cocktail is almost identical to that of a standard PCR, except that no primers are added. The final vector concentration is normally in the range of 5&ndash;10 ng/&mu;L and the insert-to-vector molar ratio is in the range of 1:1 to 2:1. The thermal cycling conditions are also similar to those used for a standard PCR reaction, except that fewer cycles are needed. For example, 1&ndash;5 cycles are sufficient to clone a single insert or a less complex library; 15&ndash;30 cycles may be needed to assemble multiple fragments or clone complex or combinatorial libraries. Depending on the number of cycles used, the total reaction time can be anywhere from 10 min to a few hours. A stringent annealing temperature should be used for thermal cycling, the value of which is determined by the T<sub>m</sub> of the overlapping regions and recommen<U+00AC>dations for the particular DNA polymerase used. Extension time is calculated by the size of the construct and the extension rate of the polymerase. For single-fragment or single-library cloning, shorter extension times can be used.</div>
+                                            <td>2&times; Taq Master Mix</td>
-                        </dd>
+                                            <td>10&mu;L</td>
-                    </dl>
+                                        </tr>
-                    <div class="p reference"><span class="bold">Reference: </span>Quan J, <i>Nature Protocols</i>, 2011.</div>
+                                        <tr>
+                                            <td><i>luxS</i>-up-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-dn-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table2-2-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>56<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/3/3d/T--NKU_China--notebook-1-5-3.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of double-crossover clones by PCR</span></div>
+                                        (No.1-5 are experimental groups, No.6 is wild GR286. The result showed that we failed to get the double-crossover clones.)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
                  </div>
              </div>
-        </section>
+             <div class="accordion-fragment" id="week3">
-        <section>
+                 <div class="accordion-header">
-             <div class="h2">3. ClonExpress MultiS One Step Cloning Kit</div>
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week3 (May 30&ndash;Jun 05)
-            <div class="p"><span class="bold">Abstract: </span>ClonExpress One Step technology is a simple, fast and highly efficient cloning kit which is based on homologous recombination technology. It allows to directly clone any amplified product(s) to any linearized vector, at any site.</div>
+                </div>
-            <div class="accordion">
-                 <div class="accordion-header"><span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;</div>
                  <div class="accordion-content">
-                     <div class="h3">Introduction</div>
+                     <div class="tabs" id="tabs3">
-                    <div class="p">ClonExpress MultiS One Step Cloning kit is a new version cloning kit based on ClonExpress One Step Cloning technology. Exnase MultiS and reaction buffer supplied in this kit are especially optimized for multi-insertion seamless cloning (MultiS for short). With the help of this kit, sequential assembly of up to five insertions can be realized in a single reaction. Additionally, Exnase MultiS is also compatible with the endonuclease digesting reaction and the PCR reaction. Thus, the digesting products or PCR products can be directly applied in recombination reaction without purification, which greatly simplifies the experimental procedures.</div>
+                        <ul>
-                    <div class="p">Firstly, the expression vector will be linearized at the cloning site of choice. A small sequence (15-20 bp) overlapped with the end of the cloning site will be added onto the insert through a PCR step. After the inserts and the linearized vector are mixed in the presence of Exnase for only 30 min, the cloning DNA products can be directly subjected to <i>E.coli</i> transformation with true positive rate over 95%.</div>
+                            <li><a class="circle-number" href="#fragment3-1">&#10112;</a></li>
-                    <div class="h3">Steps</div>
+                            <li><a class="circle-number" href="#fragment3-2">&#10113;</a></li>
-                    <dl>
+                            <li><a class="circle-number" href="#fragment3-3">&#10114;</a></li>
-                         <dt>1. Preparation for linearized cloning vectors</dt>
+                         </ul>
-                         <dd>
+                         <div id="fragment3-1">
-                             <div class="p">Select appropriate cloning sites, and linearize the cloning vector. GC content of 20 bp regions at both ends of linearized cloning vector has great impacts on the recombination efficiency. The maximum recombination efficiency can be realized when the GC content of these regions is within 40%&sim;60%.Thus, it&apos;s better to avoid regions with sequence repeats and select regions containing even GC content.</div>
+                             <div class="p">
-                             <div class="p">The cloning vectors can be linearized by restriction digesting with endonuclease or by reverse PCR amplification.</div>
+                                Transformants were cultured at 42<sup>o</sup>C with chloramphenicol again and the single-crossover clones were selected successfully.
-                        </dd>
+                            </div>
-                        <dt>2. Design of PCR primers of the insertions</dt>
+                             <div class="flex-container">
-                        <dd>
+                                <div class="table-wrapper">
-                            <div class="p">The principle for the design of ClonExpress MultiS primers is: introduce homologous sequences (15 bp&sim;20 bp)into 5&apos; end of primers, aiming to making the ends of amplified insertions and linearized cloning vector identical to the ends of their neighbours which is required for recombination reaction. Taking sequential assembly of three insertions (assembly order from 5&apos; to 3&apos; is as follows: insertion 1, insertion 2, insertion 3) to pUC18 cloning vector as example, design the primers as below:</div>
+                                    <table class="table-theme-1" id="table3-1-1">
-                            <div class="p">Firstly, design the forward primer of insertion 1 and the reverse primer of insertion 3 (two insertions next to cloning vector) according to Figure 1.</div>
+                                        <caption>20&mu;L PCR system</caption>
-                            <figure>
+                                        <tr>
-                                <img src="https://static.igem.org/mediawiki/2016/c/c1/T--NKU_China--Protocols-04.jpg">
+                                            <td>2&times; Taq Master Mix</td>
-                                <figcaption><span>Figure 1: Design of the forward primer of insertion 1 and the reverse primer of insertion 3</span></figcaption>
+                                            <td>10&mu;L</td>
-                            </figure>
+                                        </tr>
-                            <div class="p"><span class="notice">Notice</span>: If the primer length exceeds 40 bp, PAGE purification of synthetized primers is recommended, which will benefit the recombination efficiency. When calculating the T<sub>m</sub> of primers, the homologous sequence of vector ends should be excluded and only gene specific amplification sequence should be counted.</div>
+                                        <tr>
-                            <div class="p">Secondly, design the reverse primer of insertion 1 and the forward primer of insertion 2. Homologous sequence used for inter-recombination between insertions can be fully added to either the reverse primer of insertion 1or the forward primer of insertion 2, and also can be partially added to both of them. Taking the addition homologous sequence to the reverse primer of insertion 1 as an example, design the primer according to Figure 2.</div>
+                                            <td><i>luxS</i>-up-F</td>
-                            <figure>
+                                            <td>1&mu;L</td>
-                                <img src="https://static.igem.org/mediawiki/2016/f/fb/T--NKU_China--Protocols-05.jpg">
+                                        </tr>
-                                <figcaption><span>Figure 2: Design of the reverse primer of insertion 1 and the forward primer of insertion 2</span></figcaption>
+                                        <tr>
-                            </figure>
+                                            <td><i>luxS</i>-dn-R</td>
-                            <div class="p"><span class="notice">Notice</span>: If the primer length exceeds 40 bp, PAGE purification of synthetized primers is recommended, which will benefit the recombination efficiency. When calculating the T<sub>m</sub> of primers, the homologous sequence of vector end should be excluded and only gene specific amplification sequence should be counted.</div>
+                                            <td>1&mu;L</td>
-                            <div class="p">Lastly, design the reverse primer of insertion 2 and the forward primer of insertion 3. Design principles are similar to that of the reverse primer of insertion 1 and forward primer of insertion 2 respectively (see Figure 2).</div>
+                                        </tr>
-                        </dd>
+                                        <tr>
-                        <dt>3. PCR amplification of insertions</dt>
+                                            <td>Bacterium solution</td>
-                        <dd>
+                                            <td>1&mu;L</td>
-                            <div class="p">Insertions can be amplified by any polymerase (Taq DNA polymerase or other high-fidelity polymerases). It will not interfere with the recombination efficiency whether there is A-tail in the PCR products or not, which will be removed during recombination and missing in the final construct.</div>
+                                        </tr>
-                            <div class="p">Take a small amount of products and run agrose electrophoresis after PCR to confirm the yields and specificity of amplification. Exnase MultiS is compatible with most PCR reactions. As a result, PCR products can be directly applied to recombination reaction without further purification if the PCR templates are not circular plasmids which share the same antibiotic resistance with the cloning vector.</div>
+                                        <tr>
-                        </dd>
+                                            <td>ddH2O</td>
-                        <dt>4. Recombination reaction</dt>
+                                            <td>7&mu;L</td>
-                        <dd>
+                                        </tr>
-                            <div class="p">Set up the following reaction on ice. Spin briefly to bring the sample to the bottom before reacting.</div>
+                                        <tr>
-                            <table>
+                                            <td>Total</td>
-                                <tr>
+                                            <td>20&mu;L</td>
-                                    <td>ddH2O</td>
+                                        </tr>
-                                    <td>Up to 20 &mu;l</td>
+                                    </table>
-                                </tr>
+                                </div>
-                                <tr>
+                                <div class="table-wrapper">
-                                    <td>5<U+00A1><c1>CE MultiS Buffer</td>
+                                    <div class="rbrace">&#125;</div>
-                                    <td>4 &mu;l</td>
+                                    <table class="table-theme-2" id="table3-1-2">
-                                </tr>
+                                        <caption>PCR reaction condition</caption>
-                                <tr>
+                                        <tr>
-                                    <td>Linearized cloning vector</td>
+                                            <td>94<sup>o</sup>C</td>
-                                    <td>x ng</td>
+                                            <td>10 min</td>
-                                </tr>
+                                            <td></td>
-                                <tr>
+                                        </tr>
-                                    <td>PCR products of insertions</td>
+                                        <tr>
-                                    <td>x ng</td>
+                                            <td>94<sup>o</sup>C</td>
-                                </tr>
+                                            <td>30 sec</td>
-                                <tr>
+                                            <td></td>
-                                    <td>Exnase<sup>&reg;</sup> MultiS</td>
+                                        </tr>
-                                    <td>2 &mu;l</td>
+                                        <tr>
-                                </tr>
+                                            <td>56<sup>o</sup>C</td>
-                            </table>
+                                            <td>30 sec</td>
-                            <div class="p">The recommended amount of DNA for recombination reaction is 0.03 pmol per DNA fragment (including the cloning vector and insertions). Their corresponding mass can be roughly calculated according the following formula:</div>
+                                            <td>30 cycles</td>
-                            <div class="p">The mass of each fragment required = [0.02&times;number of base pair] ng (0.03 pmol)</div>
+                                        </tr>
-                            <div class="p">For example, when cloning three insertions of 0.5 kb, 1 kb and 2 kb to a 5 kb vector, their corresponding DNA mass needed is as follows:</div>
+                                        <tr>
-                            <div class="p" id="demo">
+                                            <td>72<sup>o</sup>C</td>
-                                Linearized cloning vector: 0.02&times;5000 = 100 ng<br>
+                                            <td>2 min</td>
-.5 kb insertion: 0.02&times;500 = 10 ng<br>
+                                            <td></td>
-kb insertion: 0.02&times;1000 = 20 ng<br>
+                                        </tr>
-kb insertion: 0.02&times;2000 = 40 ng
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/9/93/T--NKU_China--notebook-1-5-4.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of single-crossover clones by PCR</span></div>
+                                        (No.1&amp;2&amp;4 are single-crossover strains,No.5 is positive control. )
+                                    </figcaption>
+                                 </figure>
                              </div>
+                        </div>
+                        <div id="fragment3-2">
                              <div class="p">
-                                 <span class="notice">Notice</span>:
+                                 The single-crossover strains were then cultured in LB medium and passaged every 12 hours for 4 generations.
-                                <ol>
-                                    <li>The mass of linearized cloning vector used should be between 50&sim;200 ng. Use 50 or 200 ng if the calculated mass is out of range.</li>
-                                    <li>The mass of insertions should be over 10 ng. Use 10 ng if the calculated mass is less.</li>
-                                    <li>When applied to recombination reaction without gel recovery, the total volume of unpurified DNA used should be less than 1/5 of that of recombination reaction, which is 4 &mu;l.</li>
-                                </ol>
                              </div>
-                             <div class="p">After finishing setting up, gently pipette up and down several times with a pipettor to mix thoroughly and try to avoid the formation of bubbles. Incubate the reaction at 37<sup>o</sup>C for 30 min and immediately place it on ice for 5 min. Recombination product is now ready for transformation, or otherwise it can be stored at -20<sup>o</sup>C before transformation.</div>
+                        </div>
+                        <div id="fragment3-3">
+                             <div class="p">
+                                The last generation was cultured in medium with 5-fluorouracil to select double-crossover clones. We finally obtained our aimed strain&#8212;GR286&Delta;<i>luxS</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table3-3-1">
+                                        <caption>20&mu;L PCR system</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-up-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-dn-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table3-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>56<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/a/aa/T--NKU_China--notebook-1-5-5.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of &Delta;<i>luxS</i> clones by PCR</span></div>
+                                        (The No.4 is the aimed strain&horbar;GR286&Delta;<i>luxS</i>)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week4">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week4 (Jun 06&ndash;Jun 12)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs4">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment4-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment4-2">&#10113;</a></li>
+                            <li><a class="circle-number" href="#fragment4-3">&#10114;</a></li>
+                            <li><a class="circle-number" href="#fragment4-4">&#10115;</a></li>
+                            <li><a class="circle-number" href="#fragment4-5">&#10116;</a></li>
+                            <li><a class="circle-number" href="#fragment4-6">&#10117;</a></li>
+                        </ul>
+                        <div id="fragment4-1">
+                            <div class="p">
+                                The GR286&Delta;<i>luxS</i> strain was cultured and made competent for future use.
+                            </div>
+                        </div>
+                        <div id="fragment4-2">
+                            <div class="p">
+                                The <i>lsrACDB</i> gene from <i>Bacillus thuringiensis</i> was cloned and ligated to T-vector.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table4-2-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i>-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i>-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table4-2-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>57<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>4 min 30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table4-2-3">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pMD19 T-Simple Vector</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment4-3">
+                            <div class="p">
+                                The T-<i>lsrACDB</i> was transformed into DH5&alpha; and plate was coated, and then positive clones were selected.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table4-3-1">
+                                        <caption>20&mu;L PCR system</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>M13F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>M13R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table4-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>59<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>4 min 30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/7/72/T--NKU_China--notebook-1-5-6.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                        (No. 3&amp;4 are positive results)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment4-4">
+                            <div class="p">
+                                After restriction enzyme digestion verification, the positive clones were then sequenced. Unfortunately, the sequencing result showed some mutations inside the target gene.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table4-4-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T-<i>lsrACDB</i></td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/9/91/T--NKU_China--notebook-1-5-7.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                        (No.1 are <i>lsrACDB</i> fragement, No.2 are linearized T-vector.)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment4-5">
+                            <div class="p">
+                                The gene cloning process was repeated but there were still some mutations.
+                            </div>
+                        </div>
+                        <div id="fragment4-6">
+                            <div class="p">
+                                We finally decided to request the gene company to synthesize the lsrACDB gene.
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week5">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week5 (Jun 13&ndash;Jun 19)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs5">
+                        <ul>
+                            <li><a href="#fragment5-1">begin</a></li>
+                            <li><a class="circle-number" href="#fragment5-2">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment5-3">&#10113;</a></li>
+                            <li><a class="circle-number" href="#fragment5-4">&#10114;</a></li>
+                            <li><a class="circle-number" href="#fragment5-5">&#10115;</a></li>
+                        </ul>
+                        <div id="fragment5-1">
+                            <div class="p">
+                                This week, we started to construct another controller&#8213;supplier.
+                            </div>
+                        </div>
+                            <div id="fragment5-2">
+                                <div class="p">
+                                    A strong promoter <i>C2</i> was cloned from former kit and <i>luxS</i> gene was cloned from GR286.
+                                </div>
+                                <div class="flex-container">
+                                    <div class="table-wrapper">
+                                        <table class="table-theme-1" id="table5-1-1">
+                                            <caption>50&mu;L PCR system &times;2</caption>
+                                            <tr>
+                                                <td>2&times; Taq Master Mix</td>
+                                                <td>25&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>C2-F</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>C2-R</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>p-C2</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>ddH2O</td>
+                                                <td>19&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Total</td>
+                                                <td>50&mu;L</td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                    <div class="table-wrapper">
+                                        <div class="rbrace">&#125;</div>
+                                        <table class="table-theme-2" id="table5-1-2">
+                                            <caption>PCR reaction condition</caption>
+                                            <tr>
+                                                <td>94<sup>o</sup>C</td>
+                                                <td>10 min</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>94<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>58<sup>o</sup>C</td>
+                                                <td>15 sec</td>
+                                                <td>30 cycles</td>
+                                            </tr>
+                                            <tr>
+                                                <td>72<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>72<sup>o</sup>C</td>
+                                                <td>10 min</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>16<sup>o</sup>C</td>
+                                                <td>&infin;</td>
+                                                <td></td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                    <div class="table-wrapper">
+                                        <table class="table-theme-1" id="table5-1-3">
+                                            <caption>50&mu;L PCR system &times;2</caption>
+                                            <tr>
+                                                <td>2&times; Taq Master Mix</td>
+                                                <td>25&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td><i>luxS</i>-F</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td><i>luxS</i>-R</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Bacterium solution</td>
+                                                <td>1&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>GR286</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>ddH2O</td>
+                                                <td>19&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Total</td>
+                                                <td>50&mu;L</td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                    <div class="table-wrapper">
+                                        <div class="rbrace">&#125;</div>
+                                        <table class="table-theme-2" id="table5-1-4">
+                                            <caption>PCR reaction condition</caption>
+                                            <tr>
+                                                <td>94<sup>o</sup>C</td>
+                                                <td>10 min</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>94<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>59<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td>30 cycles</td>
+                                            </tr>
+                                            <tr>
+                                                <td>72<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>72<sup>o</sup>C</td>
+                                                <td>10 min</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>16<sup>o</sup>C</td>
+                                                <td>&infin;</td>
+                                                <td></td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                    <figure>
+                                        <img src="https://static.igem.org/mediawiki/2016/d/dc/T--NKU_China--notebook-1-5-8.png">
+                                        <figcaption>
+                                            <div class="p"><span>PCR cloning product of promoter <i>C2</i> and gene <i>luxS</i></span></div>
+                                            (NO.1&amp;2 are <i>C2</i>, No.3&amp;4 are <i>luxS</i>)
+                                        </figcaption>
+                                    </figure>
+                                </div>
+                            </div>
+                            <div id="fragment5-3">
+                                <div class="p">
+                                    Two segments were fused together by fusion PCR and ligated into T-vector. After that, the vector was transformed into DH5&alpha;.
+                                </div>
+                                <div class="flex-container">
+                                    <div class="table-wrapper">
+                                        <table class="table-theme-1" id="table5-2-1">
+                                            <caption>50&mu;L PCR system &times;2</caption>
+                                            <tr>
+                                                <td>2&times; Taq Master Mix</td>
+                                                <td>25&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>C2-F</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td><i>luxS</i>-R</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>C2</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td><i>luxS</i></td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>ddH2O</td>
+                                                <td>17&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Total</td>
+                                                <td>50&mu;L</td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                    <div class="table-wrapper">
+                                        <div class="rbrace">&#125;</div>
+                                        <table class="table-theme-2" id="table5-2-2">
+                                            <caption>PCR reaction condition</caption>
+                                            <tr>
+                                                <td>94<sup>o</sup>C</td>
+                                                <td>10 min</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>94<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>59<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td>30 cycles</td>
+                                            </tr>
+                                            <tr>
+                                                <td>72<sup>o</sup>C</td>
+                                                <td>40 sec</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>72<sup>o</sup>C</td>
+                                                <td>10 min</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>16<sup>o</sup>C</td>
+                                                <td>&infin;</td>
+                                                <td></td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                    <div class="table-wrapper">
+                                        <table class="table-theme-3" id="table5-2-3">
+                                            <caption>20&mu;L ligation system</caption>
+                                            <tr>
+                                                <td>10&times; DNA Ligase Buffer</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>T4 DNA Ligase</td>
+                                                <td>1&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>pMD19 T-Simple Vector</td>
+                                                <td>1&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td><i>C2-luxS</i></td>
+                                                <td>4&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>ddH2O</td>
+                                                <td>12&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Total</td>
+                                                <td>20&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                </div>
+                            </div>
+                            <div id="fragment5-4">
+                                <div class="p">
+                                    Positive clones were selected by colony PCR.
+                                </div>
+                                <div class="flex-container">
+                                    <div class="table-wrapper">
+                                        <table class="table-theme-1" id="table5-3-1">
+                                            <caption>20&mu;L PCR system</caption>
+                                            <tr>
+                                                <td>2&times; Taq Master Mix</td>
+                                                <td>10&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>M13-F</td>
+                                                <td>1&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>M13-R</td>
+                                                <td>1&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Bacterium solution</td>
+                                                <td>1&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>ddH2O</td>
+                                                <td>7&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Total</td>
+                                                <td>20&mu;L</td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                    <div class="table-wrapper">
+                                        <div class="rbrace">&#125;</div>
+                                        <table class="table-theme-2" id="table5-3-2">
+                                            <caption>PCR reaction condition</caption>
+                                            <tr>
+                                                <td>94<sup>o</sup>C</td>
+                                                <td>10 min</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>94<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>59<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td>30 cycles</td>
+                                            </tr>
+                                            <tr>
+                                                <td>72<sup>o</sup>C</td>
+                                                <td>40 sec</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>72<sup>o</sup>C</td>
+                                                <td>10 min</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>16<sup>o</sup>C</td>
+                                                <td>&infin;</td>
+                                                <td></td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                    <figure>
+                                        <img src="https://static.igem.org/mediawiki/2016/c/c9/T--NKU_China--notebook-1-5-9.png">
+                                        <figcaption>
+                                            <div class="p"><span>PCR cloning product of promoter <i>C2</i> and gene <i>luxS</i></span></div>
+                                        </figcaption>
+                                    </figure>
+                                </div>
+                            </div>
+                            <div id="fragment5-5">
+                                <div class="p">
+positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                                </div>
+                                <div class="flex-container">
+                                    <div class="table-wrapper">
+                                        <table class="table-theme-4" id="table5-4-1">
+                                            <caption>20&mu;L digestion  system</caption>
+                                            <tr>
+                                                <td>10&times; FastDigest Buffer</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>BamH &#8544;</td>
+                                                <td>1&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>T-<i>lsrACDB</i></td>
+                                                <td>1&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>ddH2O</td>
+                                                <td>7&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Total</td>
+                                                <td>20&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                    <figure>
+                                        <img src="https://static.igem.org/mediawiki/2016/f/fb/T--NKU_China--notebook-1-5-10.png">
+                                        <figcaption>
+                                            <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                            (No.1 are linearized T-vector, No.2 are <i>C2-luxS</i> fragment.)
+                                        </figcaption>
+                                    </figure>
+                                </div>
+                            </div>
+                        </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week6">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week6 (Jun 20&ndash;Jun 26)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs6">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment6-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment6-2">&#10113;</a></li>
+                            <li><a class="circle-number" href="#fragment6-3">&#10114;</a></li>
+                            <li><a class="circle-number" href="#fragment6-4">&#10115;</a></li>
+                            <li><a class="circle-number" href="#fragment6-5">&#10116;</a></li>
+                        </ul>
+                        <div id="fragment6-1">
+                            <div class="p">
+                                The sequencing result showed that there was a correct strain and thus it could be used for the following experiments. We obtained the correct plasmid T-<i>C2-luxS</i> from DH5&alpha;. Then the fragment <i>C2-luxS</i> was obtained by digestion and gel extraction.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table6-1-1">
+                                        <caption>40&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T-<i>C2-luxS</i></td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>9&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment6-2">
+                            <div class="p">
+                                The <i>C2-luxS</i> fragment was ligated to linearized plasmid pWH1520, and then the ligation product was transformed into DH5&alpha;.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table6-2-1">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pMD19 T-Simple Vector</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>C2-luxS</i></td>
+                                            <td>5&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>11&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment6-3">
+                            <div class="p">
+                                The plasmid pWH-<i>C2-luxS</i> was extracted from DH5&alpha;. To prevent the plasmid from DAM&DCM methylation, we transformed it into <i>E.coli</i> JM110.
+                            </div>
+                        </div>
+                        <div id="fragment6-4">
+                            <div class="p">
+                                The plasmid pWH-<i>C2-luxS</i> was extracted from JM110,and then it was treated with BamH &#8544; methylase.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-5" id="table6-4-1">
+                                        <caption>100&mu;L methylation  system</caption>
+                                        <tr>
+                                            <td>10&times; BamH &#8544; methyltransferase Buffer</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544; methyltransferase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>S-adenosylmethionine</td>
+                                            <td>0.5&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH-<i>C2-luxS</i></td>
+                                            <td>80&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>8.5&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>100&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 1 hour</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment6-5">
+                            <div class="p">
+                                The plasmid was transformed into GR286 by electroporation.[Failed]
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/e/e0/T--NKU_China--notebook-6-13-1.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by colony PCR</span></div>
+                                        (No.1 is positive control, No.2-6 are experimental groups. The result showed that we failed to transformed the plasmid pWH-<i>C2-luxS</i> into GR286)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week7">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week7 (Jun 27&ndash;Jul 03)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs7">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment7-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment7-2">&#10113;</a></li>
+                            <li><a class="circle-number" href="#fragment7-3">&#10114;</a></li>
+                        </ul>
+                        <div id="fragment7-1">
+                            <div class="p">
+                                This week, we tried to use different voltages to transform the plasmid. Sadly, all of these attempts rendered negative results.
+                            </div>
+                        </div>
+                        <div id="fragment7-2">
+                            <div class="p">
+                                We considered whether the <i>luxS</i> gene is toxic for GR286, and the bacteria tends to reject the gene when a strong promoter is inserted upstream of it. So, we planned to use inducible promoter to reconstruct our expression vector.
+                            </div>
+                        </div>
+                        <div id="fragment7-3">
+                            <div class="p">
+                                The plasmid pWH1520 contains a strong <i>xylA</i> promoter originating from <i>Bacillus megaterium</i>, and transcription initiated by this promoter is xylose-inducible. Also, the gene of interest carries its own ribosome binding sequence (RBS) and translation initiation codon. Based on these points, we redesigned primers.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/e/eb/T--NKU_China--notebook-6-13-2.png">
+                                    <figcaption>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week8">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week8 (Jul 04&ndash;Jul 10)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs8">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment8-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment8-2">&#10113;</a></li>
+                            <li><a class="circle-number" href="#fragment8-3">&#10114;</a></li>
+                            <li><a class="circle-number" href="#fragment8-4">&#10115;</a></li>
+                        </ul>
+                        <div id="fragment8-1">
+                            <div class="p">
+                                <i>luxS</i> gene was cloned from GR286 using our new primers.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table8-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>YD-luxS-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>YD-luxS-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table8-1-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>40 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/3/3a/T--NKU_China--notebook-6-13-3.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>luxS</i></span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment8-2">
+                            <div class="p">
+                                The <i>luxS</i> fragment was purified by gel extraction, and ligated into linearized pWH1520. Then the vector was transformed into DH5&alpha;.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table8-2-1">
+                                        <caption>40&mu;L digestion  system &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH1520</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>9&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table8-2-2">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>linearized pWH1520</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment8-3">
+                            <div class="p">
+                                Positive clones were selected by colony PCR.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table8-3-1">
+                                        <caption>20&mu;L PCR system</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table8-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>40 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/4/49/T--NKU_China--notebook-6-13-4.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by colony PCR</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment8-4">
+                            <div class="p">
+positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table8-4-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH-<i>luxs</i></td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/3/35/T--NKU_China--notebook-6-13-5.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                        (No.1 are linearized pWH1520, No.2 are <i>luxS</i> fragments.)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
-                         </dd>
+                    </div>
-                         <dt>5. Transformation and plating</dt>
+                </div>
-                         <dd>
+            </div>
-                             <div class="p">Add the entire recombination products to 200 &mu;l of competent cells; flip the tube several times to mix it thoroughly and place the tube on ice for 30 min. Heat-shock the tube for 45&sim;90 sec at 42<sup>o</sup>C and then place the tube on ice for 2 min. Add 900 &mu;l of SOC or LB medium to competent cells and leave the tube in 37<sup>o</sup>C water bath for 10 min to let the competent cells fully recovered. Then, shake the tube at 37<sup>o</sup>C for 45 min to culture the bacteria. Take 100 &mu;l of culture and plate evenly on agar plate which contains appropriate selection antibiotic. Place the plate at 37<sup>o</sup>C overnight to culture.</div>
+            <div class="accordion-fragment" id="week9">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week9 (Jul 11&ndash;Jul 17)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs9">
+                         <ul>
+                            <li><a class="circle-number" href="#fragment9-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment9-2">&#10113;</a></li>
+                            <li><a class="circle-number" href="#fragment9-3">&#10114;</a></li>
+                            <li><a href="#fragment9-4">end</a></li>
+                         </ul>
+                        <div id="fragment9-1">
+                            <div class="p">
+                                The sequencing result showed there&#39;s three positive strains. So one positive strain was chosen to be used for the following experiments. The pWH-<i>luxS</i> plasmid was extracted from the chosen strain. To prevent the plasmid from DAM&DCM methylation, we transformed it into E.coli JM110.
+                            </div>
+                         </div>
+                        <div id="fragment9-2">
+                             <div class="p">
+                                the plasmid pWH-<i>luxS</i> was extracted from JM110,and it was treated withBamH &#8544; methylase.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-5" id="table6-4-1">
+                                        <caption>100&mu;L methylation  system</caption>
+                                        <tr>
+                                            <td>10&times; BamH &#8544; methyltransferase Buffer</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544; methyltransferase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>S-adenosylmethionine</td>
+                                            <td>0.5&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH-<i>C2-luxS</i></td>
+                                            <td>80&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>8.5&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>100&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 1 hour</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment9-3">
+                            <div class="p">
+                                The plasmid was transformed into GR286 by electroporation, and positive clones were selected.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/a/aa/T--NKU_China--notebook-6-13-6.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by colony PCR</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment9-4">
+                            <div class="p">
+                                The construction of supplier was accomplished!
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week10">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week10 (Jul 18&ndash;Jul 24)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs10">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment10-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment10-2">&#10113;</a></li>
+                        </ul>
+                        <div id="fragment10-1">
+                            <div class="p">
+                                We have received the product of synthetic <i>lsrACDB</i> gene. We first used restriction-ligation method to ligate <i>lsrACDB</i> to plasmid pWH1520, but we failed to select positive after several tries.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table10-1-1">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>linearized pWH1520</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment10-2">
+                            <div class="p">
+                                Considering that the <i>lsrACDB</i> gene is a large fragment (4500bp), we used ClonExpress technique to clone the gene again to improve the efficiency of ligation. The <i>lsrACDB</i> sequence was divided into two parts and they were cloned separately. Then the two segments were ligated to the plasmid pWH1520 and the recombinant vector was transformed into DH5&alpha;. After that, verification PCR was used to select the positive clones. However, we didn&#39;t get a good result.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/1/17/T--NKU_China--notebook-6-13-7.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by colony PCR</span></div>
+                                        (No.6 is positive control, No.1-5 are experimental groups)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week11">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week11 (Jul 25&ndash;Jul 31)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs10">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment11-1">&#10112;</a></li>
+                        </ul>
+                        <div id="fragment11-1">
+                            <div class="p">
+                                We learnt a new method called circular polymerase extension cloning (CPEC) for high-throughput cloning of complex and combinatorial DNA libraries, and we decided to use this method to try to ligate our <i>lsrACDB</i> gene. It&#39;s encouraging that we succeeded to ligate the <i>lsrACDB</i> gene to the plasmid pHT-01.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/c/c2/T--NKU_China--notebook-6-13-8.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by colony PCR</span></div>
+                                        (No.3-6 are positive clones)
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/7/7a/T--NKU_China--notebook-6-13-9.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                        (No.2&amp;3 are positive results.)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week12">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week12 (Aug 1&ndash;Aug 7)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs12">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment12-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment12-2">&#10113;</a></li>
+                        </ul>
+                        <div id="fragment12-1">
+                            <div class="p">
+                                Since we have already successfully constructed "supplier" and part of "consumer", we decided to measure the growth curve to explore the function of our "controller".
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-6" id="table12-1-1">
+                                        <caption>Groups divided in this experiment</caption>
+                                        <tr>
+                                            <td>GR286</td>
+                                            <td>wild strain as control group</td>
+                                        </tr>
+                                        <tr>
+                                            <td>GR286&Delta;<i>luxS</i></td>
+                                            <td>GR286 without <i>luxS</i> gene</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH-<i>luxS</i></td>
+                                            <td><i>luxS</i> overexpression plasmid in GR286; without induced by xylose</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH-<i>luxS</i> &plus; xyl</td>
+                                            <td><i>luxS</i> overexpression plasmid in GR286; induced by xylose</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH1520</td>
+                                            <td>empty plasmid in GR286 as control group</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pHT-<i>lsrACDB</i></td>
+                                            <td><i>lsrACDB</i> overexpression plasmid in GR286&Delta;<i>luxS</i></td>
+                                        </tr>
+                                        <tr>
+                                            <td>pHT-01</td>
+                                            <td>empty plasmid in GR286&Delta;<i>luxS</i> as control group</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/a/ad/T--NKU_China--notebook-6-13-10.png">
+                                    <figcaption>
+                                        <div class="p"><span>OD<sub>600</sub> of different groups at specific times</span></div>
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/0/00/T--NKU_China--notebook-6-13-11.png">
+                                    <figcaption>
+                                        <div class="p"><span>Growth curve of GR286 and GR286&Delta;<i>luxS</i></span></div>
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/a/a9/T--NKU_China--notebook-6-13-12.png">
+                                    <figcaption>
+                                        <div class="p"><span>Growth curve of pWH-<i>luxS</i>, pWH-<i>luxS</i> &plus; xyl and pWH1520</span></div>
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/6/6b/T--NKU_China--notebook-6-13-13.png">
+                                    <figcaption>
+                                        <div class="p"><span>Growth curve of pHT-<i>lsrACDB</i> and pHT-01</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment12-2">
+                            <div class="p">
+                                Cultured media of our supplier was tested for the presence of AI-2 by inducing luminescence of <i>Vibrio harveyi</i> reporter strain BB170.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/a/a4/T--NKU_China--notebook-6-13-14.png">
+                                    <figcaption>
+                                        <div class="p"><span>Fluorescence intensity of different groups at specific times</span></div>
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/c/c5/T--NKU_China--notebook-6-13-15.png">
+                                    <figcaption>
+                                        <div class="p"><span>Relative fluorescence intensity of different groups</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week13">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week13 (Aug 8&ndash;Aug 14)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs12">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment13-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment13-2">&#10113;</a></li>
+                        </ul>
+                        <div id="fragment13-1">
+                            <div class="p">
+                                For our consumer, we should also overexpress the <i>lsrK</i> and <i>lsrFG</i> gene for phosphorylating and degrading phosphorylated AI-2. We used ClonExpress technique to clone the two genes and ligate them to plasmid pHT-01 successfully.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/c/c5/T--NKU_China--notebook-6-13-16.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                        (No.1&3&4 are positive results. )
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment13-2">
+                            <div class="p">
+                                We co-cultured the supplier with BB170 and tested the fluorescence intensity to explore the function of supplier. (negative result)
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/f/f1/T--NKU_China--notebook-6-13-17.png">
+                                    <figcaption>
+                                        <div class="p"><span>Fluorescence intensity of BB170 and co-culture medium</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week14">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week14 (Aug 15&ndash;Aug 21)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs14">
+                        <ul>
+                            <li><a href="#fragment14">begin</a></li>
+                            <li><a href="#fragment14-0">outline</a></li>
+                            <li><a href="#fragment14-1-1">1.1</a></li>
+                            <li><a href="#fragment14-1-2">1.2</a></li>
+                            <li><a href="#fragment14-1-3">1.3</a></li>
+                        </ul>
+                        <div id="fragment14">
+                            <div class="p">Since the controller we constructed with GR286 did not demonstrate positive results, we decided to substitute GR286 with <i>Escherichia coli</i> whose AI-2 metabolic pathway had been elucidated as the chassis of our controller.</div>
+                            <ul>
+                                <li>
+                                    The strains to be constructed are shown in the tables below.
+                                    <div class="flex-container">
+                                        <div class="table-wrapper">
+                                            <table class="table-theme-0" style="font-weight:bold">
+                                                <caption>AI-2 supplier</caption>
+                                                <tr>
+                                                    <td></td>
+                                                    <td>LuxS</td>
+                                                    <td>Mtn</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pTrcHisB</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pLuxS</td>
+                                                    <td>Induced</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pLuxS-Mtn</td>
+                                                    <td>Induced</td>
+                                                    <td>Induced</td>
+                                                </tr>
+                                            </table>
+                                        </div>
+                                        <div class="table-wrapper">
+                                            <table class="table-theme-0" style="font-weight:bold">
+                                                <caption>AI-2 consumer</caption>
+                                                <tr>
+                                                    <td></td>
+                                                    <td>LsrACDB</td>
+                                                    <td>LsrK</td>
+                                                    <td>LsrFG</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pTrcHisB</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pLsrACDB</td>
+                                                    <td>Induced</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pLsrFG</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td>Induced</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pLsrK</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td>Induced</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pLsrACDBFG</td>
+                                                    <td>Induced</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td>Induced</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pLsrACDBK</td>
+                                                    <td>Induced</td>
+                                                    <td>Constitutive</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>plsrACDBFGK</td>
+                                                    <td>Induced</td>
+                                                    <td>Constitutive</td>
+                                                    <td>Induced</td>
+                                                </tr>
+                                            </table>
+                                        </div>
+                                    </div>
+                                </li>
+                                <li>
+                                    The sequences of <i>lsrACDB</i>, <i>lsrFG</i>, <i>lsrK</i>, <i>luxS</i>, <i>mtn</i> gene in <i>E.coli K12</i> were searched in NCBI, and primers were designed according to the gene sequences. The primers used in the construction of AI-2 controller are shown in the table below.
+                                    <div class="flex-container">
+                                        <div class="table-wrapper">
+                                            <table class="table-theme-0" style="word-break:break-all">
+                                                <caption>Primers used in the construction of AI-2 controller</caption>
+                                                <tr>
+                                                    <td style="min-width:7.5rem">Primer name</td>
+                                                    <td>Sequence</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDBFG</i>1-F</td>
+                                                    <td>CGACGATGACGATAAGGATCCATGCAAACGAGTGATACCCGC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDBFG</i>1-R</td>
+                                                    <td>TGTTTGGCGTTTCCGGCAGCGGTGCGGAGAGC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDBFG</i>2-F</td>
+                                                    <td>TGTTTGGCGTTTCCGCGATTG</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDBFG</i>2-R</td>
+                                                    <td>GCACTCTCACACCACGTTGCATGGCGCGTTTC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDBFG</i>3-F</td>
+                                                    <td>GTGGTGTGAGAGTGCTGAC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDBFG</i>3-R</td>
+                                                    <td>ACCAGCTGCAGATCTCGAGCTCGTCACGGCATCAACCCATTGAAC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDB</i>1-F</td>
+                                                    <td>CGACGATGACGATAAGGATCCATGCAAACGAGTGATACCCGC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDB</i>1-R</td>
+                                                    <td>ACCGGAACCGCCGAGCAAACTAATGCCGCCCAGCAC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDB</i>2-F</td>
+                                                    <td>CTCGGCGGTTCCGGTGCGAT</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDB</i>2-R</td>
+                                                    <td>ACCAGCTGCAGATCTCGAGCTCGTCAGAAATCGTATTTGCCG</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>luxS</i>-F</td>
+                                                    <td>ATGACGATAAGGATCCGAGCTCGATGCCGTTGTTAGATAGCTTC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>luxS</i>-R</td>
+                                                    <td>GGACTCCCCCGGGGGACTAAATGTGCAGTTCCTGCAACTTC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>mtn</i>-F</td>
+                                                    <td>TCCCCCGGGGGAGTCCTCTCCCGCGTGAGAAATAC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>mtn</i>-R</td>
+                                                    <td>TATGGTACCAGCTGCAGATCTCTTAGCCATGTGCAAGTTTCTG</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>luxS</i>-Fd</td>
+                                                    <td>GGAATTCCCTAAATGTGCAGTTCCTGCAACTTC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>luxS</i>-Rv</td>
+                                                    <td>GGGGTACCCCATGCCGTTGTTAGATAGCTTCACAG</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrK</i>-Fd</td>
+                                                    <td>GGGGTACCCCATGGCTCGACTCTTTACC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrK</i>-Rv</td>
+                                                    <td>GGAATTCCCTATAACCCAGGCGCTTTCC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrFG</i>-Fd</td>
+                                                    <td>CGGGATCCCGATGGCAGATTTAGACGATATTAAAGATGG</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrFG</i>-Rv</td>
+                                                    <td>GAAGATCTTCTCACGGCATCAACCCATTGAAC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrK</i>-F</td>
+                                                    <td>AACTGCAGAACCAATGCATTGGTTTACGGCTAGCTCAGTCCTAGGTATAGTGCTAGCAAAGAGGAGAAAATGGCTCGACTCTTTACC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrK</i>-R</td>
+                                                    <td>TTCGAACTATAACCCAGGCGCTTTCC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>BK-JC-F</td>
+                                                    <td>TTTCAGTGTATGTCGCGGATGC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>GK-JC-F</td>
+                                                    <td>TTGCGCTTCGATGTCTTACAGG</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pTrc-JC-F</td>
+                                                    <td>TGGGCACTCGACCGGAATTATC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pTrc-JC-R</td>
+                                                    <td>GCTACTGCCGCCAGGCAAATTC</td>
+                                                </tr>
+                                            </table>
-                         </dd>
+                                        </div>
-                         <dt>6. Selection of positive colony</dt>
+                                    </div>
-                         <dd>
+                                </li>
+                            </ul>
+                         </div>
+                         <div id="fragment14-0">
+                            <ol>
+                                <li>Construction of pLuxS-Mtn</li>
+                            </ol>
+                        </div>
+                         <div id="fragment14-1-1">
                              <div class="p">
-                                 Colony PCR is the most convenient selection method. Pick a single colony with tips to 20&sim;50 &mu;l of LB medium, mix thoroughly and take 1 &mu;l as PCR template. To avoid false positive PCR, we recommend at least one sequencing primer of the cloning vector should be used. Inoculate the remaining medium of positive clones into fresh LB medium and culture overnight. Then, extract the plasmids for subsequent authentication.
+                                 <i>luxS</i> gene was cloned from <i>E.coli K12</i>.
                              </div>
-                         </dd>
+                            <div class="flex-container">
-                     </dl>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table14-1-1-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table14-1-1-1-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>63<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/f/f7/T--NKU_China--notebook-14-17-01.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>luxS</i></span></div>
+                                    </figcaption>
+                                </figure>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table14-1-1-1-3">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>mtn</i>-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>mtn</i>-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table14-1-1-1-4">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>63<sup>o</sup>C</td>
+                                            <td>30sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>45 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/6/66/T--NKU_China--notebook-14-17-02.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>mtn</i></span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment14-1-2">
+                            <div class="p">
+                                ClonExpress technique was used to ligate <i>luxS</i> and <i>mtn</i> genes to plasmid pTrcHisB. The recombinant vector pTrc-<i>luxS</i>-<i>mtn</i> was transformed into <i>E.coli K12</i>. After that, verification PCR was performed to select the positive clones.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table14-1-1-2-1">
+                                        <caption>20&mu;L PCR system</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table14-1-1-2-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>1 min 30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/e/e4/T--NKU_China--notebook-14-17-03.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                        (NO.3&amp;5&amp;8 are positive results)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment14-1-3">
+                            <div class="p">
+positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table14-1-3-1-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Sac &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bgl &#8545;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>luxS</i>-<i>mtn</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/8/83/T--NKU_China--notebook-14-17-04.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                        (No.1 are linearized pTrcHisB, No.2 are <i>luxS</i>-<i>mtn</i> fragment. )
+                                    </figcaption>
+                                </figure>
+                            </div>
+                         </div>
+                     </div>
                  </div>
              </div>
-        </section>
+             <div class="accordion-fragment" id="week15">
-        <section>
+                 <div class="accordion-header">
-             <div class="h2">4. Testing of the presence of AI-2 via <i>Vibrio harveyi</i> reporter strain BB170.</div>
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week15 (Aug 22&ndash;Aug 28)
-            <div class="p"><span class="bold">Abstract: </span><i>Vibrio harveyi</i> can express bioluminescence in response to small signal molecules called autoinducers, which accumulate in the environment. Mutant strain BB170 responds only to autoinducer-2 (AI-2).  Therefore, BB170 became a universal strain to test the presence of AI-2.</div>
+                </div>
-            <div class="accordion">
-                 <div class="accordion-header"><span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;</div>
                  <div class="accordion-content">
-                     <div class="h3">Steps</div>
+                     <div class="tabs" id="tabs15">
-                    <ol>
+                        <ul>
-                        <li>BB170 was grown for 16 h with shaking at 30<sup>o</sup>C in AI-2 Bioassay (AB) media. AB media is made by adjusting 400 mL of distilled (DI) water to pH 7.5, and adding 7 g of NaCl, 2.4 g of MgSO<sub>4</sub>, 0.8 g casamino acid and 8 mL of glycerol. AB media is supplmented with 400 &mu;L of potassium phosphate buffer (K<sub>2</sub>HPO<sub>4</sub> 10.71 g and 5.24 g KH<sub>2</sub>PO<sub>4</sub> dissolved in 100 mL of DI water), 400 &mu;L of 0.1 M L-arginine (0.1742 g L-arginine in 10 mL of DI water), 40 &mu;L of riboflavin (10 &mu;g/mL), 40 &mu;L of thiamine (1 mg/mL) and 40 &mu;L kanamycin (50 mg/mL). </li>
+                            <li><a href="#fragment15-0">outline</a></li>
-                        <li>Overnight cultures were diluted 1:5000 in fresh AB media. Test samples were added to BB170 cultures at a final concentration of 10% (vol/vol). The cultures were shaking at 30<sup>o</sup>C.</li>
+                            <li><a href="#fragment15-1-1">1.1</a></li>
-                         <li>In the next six hours, 200 &mu;L cultures were added into black 96-well plates every 30 min, and luminescence was measured by microplate reader in the mode of Chemiluminescence. </li>
+                            <li><a href="#fragment15-1-2">1.2</a></li>
-                    </ol>
+                            <li><a href="#fragment15-1-3">1.3</a></li>
-                    <div class="p reference"><span class="bold">Reference: </span>Bassler B L et al. <i>Journal of Bacteriology</i>, 1997.</div>
+                            <li><a href="#fragment15-1-4">1.4</a></li>
+                            <li><a href="#fragment15-2-1">2.1</a></li>
+                            <li><a href="#fragment15-2-2">2.2</a></li>
+                            <li><a href="#fragment15-2-3">2.3</a></li>
+                            <li><a href="#fragment15-3-1">3.1</a></li>
+                            <li><a href="#fragment15-3-2">3.2</a></li>
+                            <li><a href="#fragment15-3-3">3.3</a></li>
+                        </ul>
+                        <div id="fragment15-0">
+                            <ol>
+                                <li>Construction of pLuxS</li>
+                                <li>Construction of pLsrACDB</li>
+                                <li>Construction of pLsrACDBFG</li>
+                            </ol>
+                        </div>
+                        <div id="fragment15-1-1">
+                            <div class="p">
+                                <i>luxS</i> gene was cloned from <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table15-1-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-Fd</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-Rv</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table15-1-1-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>60<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/b/bc/T--NKU_China--notebook-14-17-05.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>luxS</i></span></div>
+                                        </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-1-2">
+                            <div class="p">
+                                The <i>luxS</i> gene was purified by gel extraction. Then, both the <i>luxS</i> segment and pTrcHisB vector were treated with restriction enzyme. After that, <i>luxS</i> gene was ligated to linearized pTrcHisB, and the ligation product was transformed into <i>E.coli K12</i>.                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <div class="table-wrapper">
+                                        <table class="table-theme-4" id="table15-1-2-1">
+                                            <caption>40&mu;L digestion  system &times;2</caption>
+                                            <tr>
+                                                <td>10&times; FastDigest Buffer</td>
+                                                <td>4&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Kpn &#8544;</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>EcoR &#8544;</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td><i>luxS</i></td>
+                                                <td>25&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>ddH2O</td>
+                                                <td>7&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Total</td>
+                                                <td>40&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                    <div class="table-wrapper">
+                                        <table class="table-theme-4" id="table15-1-2-2">
+                                            <caption>40&mu;L digestion  system &times;2</caption>
+                                            <tr>
+                                                <td>10&times; FastDigest Buffer</td>
+                                                <td>4&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Kpn &#8544;</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>EcoR &#8544;</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>pTrcHisB</td>
+                                                <td>20&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>ddH2O</td>
+                                                <td>12&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Total</td>
+                                                <td>40&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                    <table class="table-theme-3" id="table15-1-2-3">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>linearized pTrcHisB</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment15-1-3">
+                            <div class="p">
+                                Verification PCR was performed to select the positive clones.                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table15-1-3-1">
+                                        <caption>20&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table15-1-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>50 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/6/65/T--NKU_China--notebook-14-17-06.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-1-4">
+                            <div class="p">
+                                One positive strain was chosen to be cultured overnight and plasmid was extracted. After restriction enzyme digestion verification, the positive clone was sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table15-1-4-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Kpn &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>EcoR &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>luxS</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/c/ca/T--NKU_China--notebook-14-17-07.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                        (No.1 is linearized pTrcHisB &plus; <i>luxS</i>, No.2 is plasmid pTrc-<i>luxS</i>. )
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-2-1">
+                            <div class="p">
+                                The <i>lsrACDBFG</i> sequence was divided into three parts and they were cloned separately. Then the three segments were ligated to the linearized pTrcHisB by ClonExpress technique, and the recombinant vector was transformed into DH5&alpha;.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table15-2-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i>1-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i>1-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table15-2-1-2">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i>2-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i>2-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table15-2-1-3">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>60<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min 20 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/b/b6/T--NKU_China--notebook-14-17-08.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of segment <i>lsrACDB1</i>,<i>lsrACDB1</i>2</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-2-2">
+                            <div class="p">
+                                Verification PCR was performed to select the positive clones.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/e/e1/T--NKU_China--notebook-14-17-09.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-2-3">
+                            <div class="p">
+positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table15-2-3-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Sac &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrACDB</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/5/5d/T--NKU_China--notebook-14-17-10.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                         </div>
+                        <div id="fragment15-3-1">
+                            <div class="p">
+                                The <i>lsrACDBFG</i> sequence was divided into three parts and they were cloned separately. Then the three segments were ligated to the linearized pTrcHisB by ClonExpress technique, and the recombinant vector was transformed into DH5&alpha;.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table15-3-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDBFG</i>1-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDBFG</i>1-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table15-3-1-2">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDBFG</i>2-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDBFG</i>2-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table15-3-1-3">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDBFG</i>3-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDBFG</i>3-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table15-3-1-4">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/6/69/T--NKU_China--notebook-14-17-11.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of segment <i>lsrACDBFG</i>1,<i>lsrACDBFG</i>2, <i>lsrACDBFG</i>3</span>
+                                        </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-3-2">
+                            <div class="p">
+                                Verification PCR was performed to select the positive clones.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/9/97/T--NKU_China--notebook-14-17-12.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-3-3">
+                            <div class="p">
+positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table15-3-2-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Sac &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrACDB</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/3/33/T--NKU_China--notebook-14-17-13.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                        (No.1-4 are linearized pTrcHisB &plus; <i>lsrACDBFG</i>, No.5 is plasmid pTrc-<i>lsrACDBFG</i>.)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
                  </div>
              </div>
-        </section>
+             <div class="accordion-fragment" id="week16">
-        <section>
+                 <div class="accordion-header">
-             <div class="h2">5. Metabolic engineering of <i>Escherichia coli</i> using CRISPR&ndash;Cas9 meditated genome editing</div>
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week16 (Aug 29&ndash;Sep 04)
-            <div class="p"><span class="bold">Abstract: </span>Engineering cellular metabolism for improved production of valuable chemicals requires extensive modulation of bacterial genome to explore complex genetic spaces. Here, we use the development of a CRISPR&ndash;Cas9 based method for genome editing and metabolic engineering of <i>Escherichia coli</i>. This system enables us to introduce various types of genomic modifications with near 100% editing efficiency and to introduce three mutations simultaneously.</div>
+                </div>
-            <div class="accordion">
-                 <div class="accordion-header"><span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;</div>
                  <div class="accordion-content">
-                     <div class="h3">Steps</div>
+                     <div class="tabs" id="tabs16">
-                    <dl>
+                        <ul>
-                         <dt>1. Constructing gRNA plasmid and donor DNA</dt>
+                            <li><a href="#fragment16-0">outline</a></li>
-                         <dd>
+                            <li><a href="#fragment16-1-1">1.1</a></li>
-                             <div class="p">To construct gRNA plasmid, a set of primers were used to PCR amplify the pGRB backbone. The 20 bp spacer sequence specific for each target was synthesized in primers. The PCR product was then self-ligated using Golden Gate Assembly to obtain the desired gRNA plasmid.</div>
+                            <li><a href="#fragment16-1-2">1.2</a></li>
-                             <div class="p">Donor dsDNA usually had 300&ndash;500 bp homologous arm on each side unless otherwise noted. To construct donor dsDNA, two homologous arms and the sequence to be inserted were separately amplified and were then fused together by fusion PCR. Gel purification of the PCR products prior to electroporation is necessary. All primers, including those used as donor ssDNA, were ordered from Genewiz.</div>
+                            <li><a href="#fragment16-1-3">1.3</a></li>
-                         </dd>
+                            <li><a href="#fragment16-1-4">1.4</a></li>
-                         <dt>2. Genome editing procedure</dt>
+                            <li><a href="#fragment16-2-1">2.1</a></li>
-                         <dd>
+                            <li><a href="#fragment16-2-2">2.2</a></li>
-                             <div class="p">Electrocompetent cells with pRedCas9 plasmid were generated previously. In brief, a single colony or 100 times diluted overnight culture was inoculated in 3 mL LB medium (or 100 mL LB for large scale preparation) and was grown at 32<sup>o</sup>C to OD&sim;.5. The cells were then washed twice with cold-sterile ddH2O in test tubes. One microliter of cells were finally concentrated 20-fold into 50 &mu;L volume for each reaction. Unless otherwise noted, 100 ng donor dsDNA (or 1 &mu;M ssDNA) and 100 ng gRNA plasmid were added in each electroporation reaction. Bio-Rad MicroPulser was used for electroporation (0.1 cm cuvette, 1.80 kV). Cells after electroporation were immediately added into 3 mL LB and recovered for 3 h prior to plating. For plasmid curing, correct colonies were inoculated in LB containing 0.2% L-arabinose and cultivated for 6&ndash;8 h or overnight.</div>
+                            <li><a href="#fragment16-2-3">2.3</a></li>
-                         </dd>
+                            <li><a href="#fragment16-2-4">2.4</a></li>
-                     </dl>
+                            <li><a href="#fragment16-3-1">3.1</a></li>
-                     <div class="p reference"><span class="bold">Reference: </span>Li, Yifan, et al. "Metabolic engineering of <i>Escherichia coli</i> using CRISPR&ndash;Cas9 meditated genome editing." Metabolic engineering 31 (2015): 13-21.</div>
+                            <li><a href="#fragment16-3-2">3.2</a></li>
+                            <li><a href="#fragment16-3-3">3.3</a></li>
+                            <li><a href="#fragment16-3-4">3.4</a></li>
+                        </ul>
+                        <div id="fragment16-0">
+                            <ol>
+                                <li>Construction of pLsrFG</li>
+                                <li>Construction of pLsrACDBK</li>
+                                <li>Construction of pLsrACDBFGK</li>
+                            </ol>
+                         </div>
+                        <div id="fragment16-1-1">
+                            <div class="p">
+                                <i>lsrFG</i> gene was cloned from <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table16-1-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrFG</i>-Fd</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrFG</i>-Rv</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table16-1-1-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>1 min 15 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/5/5c/T--NKU_China--notebook-14-17-14.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>lsrFG</i></span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                         </div>
+                        <div id="fragment16-1-2">
+                             <div class="p">
+                                The <i>lsrFG</i> gene was purified by gel extraction. Then, both the <i>lsrFG</i> segment and pTrcHisB vector were treated with restriction enzyme. After that, <i>lsrFG</i> gene was ligated to linearized pTrcHisB, and the ligation product was transformed into <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-1-2-1">
+                                        <caption>40&mu;L digestion  system &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bgl &#8545;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrFG</i></td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-1-2-2">
+                                        <caption>40&mu;L digestion  system &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bgl &#8545;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrcHisB</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>12&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table16-1-2-3">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pMD19 T-Simple Vector</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxSFG</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment16-1-3">
+                            <div class="p">
+                                Verification PCR was performed to select the positive clones.
+                            </div>
+                             <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table16-1-3-1">
+                                        <caption>20&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table16-1-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>1 min 30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/5/5b/T--NKU_China--notebook-14-17-15.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                        (NO. 1&amp;3 are positive results)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment16-1-4">
+                            <div class="p">
+                                Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-1-4-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bgl &#8545;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrFG</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/b/b0/T--NKU_China--notebook-14-17-16.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment16-2-1">
+                            <div class="p">
+                                <i>lsrK</i> gene was cloned from <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table16-2-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i>-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i>-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table16-2-1-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>55<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>1 min 40 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/8/85/T--NKU_China--notebook-14-17-17.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>lsrK</i></span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment16-2-2">
+                            <div class="p">
+                                The <i>lsrK</i> gene was purified by gel extraction. Then, both the <i>lsrK</i> segment and pTrc-<i>lsrACDB</i> vector were treated with restriction enzyme. After that, <i>lsrK</i> gene was ligated to linearized pTrc-<i>lsrACDB</i>, and the ligation product was transformed into <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-2-2-1">
+                                        <caption>40&mu;L digestion  system &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Pst &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BstB &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i></td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-2-2-2">
+                                        <caption>40&mu;L digestion  system &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Pst &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BstB &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrACDB</i></td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table16-2-2-3">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>linearized pTrc-<i>lsrACDB</i></td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                         </div>
+                         <div id="fragment16-2-3">
+                            <div class="p">
+                                Verification PCR was performed to select the positive clones.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table16-2-3-1">
+                                        <caption>20&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BK-JC-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table16-2-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/c/cb/T--NKU_China--notebook-14-17-18.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                        (NO. 1&amp;3 are positive results)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                         </div>
+                        <div id="fragment16-2-4">
+                             <div class="p">
+                                Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-2-4-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Pst &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BstB &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrACDBK</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/5/56/T--NKU_China--notebook-14-17-19.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment16-3-1">
+                            <div class="p">
+                                <i>lsrK</i> gene was cloned from <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table16-3-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i>-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i>-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table16-3-1-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>55<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>1 min 40 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/8/85/T--NKU_China--notebook-14-17-17.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>lsrK</i></span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment16-3-2">
+                            <div class="p">
+                                The <i>lsrK</i> gene was purified by gel extraction. Then, both the <i>lsrK</i> segment and pTrc-<i>lsrACDBFG</i> vector were treated with restriction enzyme. After that, <i>lsrK</i> gene was ligated to linearized pTrc-<i>lsrACDBFG</i>, and the ligation product was transformed into <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-3-2-1">
+                                        <caption>40&mu;L digestion  system &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Pst &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BstB &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i></td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-3-2-2">
+                                        <caption>40&mu;L digestion  system &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Pst &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BstB &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrACDBFG</i></td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>12&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table16-3-2-3">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>linearized pTrc-<i>lsrACDFGB</i></td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment16-3-3">
+                            <div class="p">
+                                Verification PCR was performed to select the positive clones.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table16-3-3-1">
+                                        <caption>20&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>GK-JC-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table16-3-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/7/78/T--NKU_China--notebook-14-17-20.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                        (NO.3 is positive result)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment16-3-4">
+                            <div class="p">
+                                Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-3-4-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Pst &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BstB &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrACDBKFGK</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/e/e2/T--NKU_China--notebook-14-17-21.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week17">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week17 (Sep 05&ndash;Sep 11)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs17">
+                        <ul>
+                            <li><a href="#fragment17-0">outline</a></li>
+                            <li><a href="#fragment17-1-1">1.1</a></li>
+                            <li><a href="#fragment17-1-2">1.2</a></li>
+                            <li><a href="#fragment17-1-3">1.3</a></li>
+                            <li><a href="#fragment17-1-4">1.4</a></li>
+                        </ul>
+                        <div id="fragment17-0">
+                            <ol>
+                                <li>Construction of pLsrK</li>
+                            </ol>
+                        </div>
+                        <div id="fragment17-1-1">
+                            <div class="p">
+                                <i>lsrK</i> gene was cloned from <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table17-1-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i>-Fd</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i>-Rv</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table17-1-2-1">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>55<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>1 min 40 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/2/24/T--NKU_China--notebook-14-17-22.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>lsrK</i></span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment17-1-2">
+                            <div class="p">
+                                The <i>lsrK</i> gene was purified by gel extraction. Then, both the <i>lsrK</i> segment and pTrc-<i>lsrACDBFG</i> vector were treated with restriction enzyme. After that, <i>lsrK</i> gene was ligated to linearized pTrc-<i>lsrACDBFG</i>, and the ligation product was transformed into <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table17-1-2-1">
+                                        <caption>40&mu;L digestion  system &times;2 &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Kpn &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>EcoR &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i></td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table17-1-2-2">
+                                        <caption>40&mu;L digestion  system &times;2 &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Pst &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BstB &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-HisB</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>12&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table17-1-2-3">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>linearized pTrcHisB</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment17-1-3">
+                            <div class="p">
+                                Verification PCR was performed to select the positive clones.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table17-1-3-1">
+                                        <caption>20&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table17-1-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/3/30/T--NKU_China--notebook-14-17-23.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment17-1-4">
+                            <div class="p">
+positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table17-1-4-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Kpn &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>EcoR &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrK</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/2/22/T--NKU_China--notebook-14-17-24.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                         </div>
+                     </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week18">
+                <div class="accordion-header">
+                     <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week18 (Seq 12&ndash;Seq 18)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs7">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment18-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment18-2">&#10113;</a></li>
+                        </ul>
+                        <div id="fragment18-1">
+                            <div class="p">
+                                We detected the expression of several overexpressed genes at the mRNA level by RT-PCR, and obtained positive results.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/f/f8/T--NKU_China--notebook-18-20-01.png" class="white">
+                                    <figcaption>
+                                        <div class="p"><span>Relative expression of several overexpressed genes at the mRNA level</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment18-2">
+                            <div class="p">
+                                SDS-PAGE was performed to detect the expression of these genes at the protein level.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/d/d2/T--NKU_China--notebook-18-20-02.png" class="white">
+                                    <figcaption>
+                                        <div class="p"><span>pTrcHisB, pLuxS, pLuxS-Mtn, pLsrACDB, pLsrACDBFG SDS-PAGE</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week19">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week19 (Seq 19&ndash;Seq 25)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs7">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment19-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment19-2">&#10113;</a></li>
+                        </ul>
+                        <div id="fragment19-1">
+                            <div class="p">
+                                Cultured media of controllers were tested for the presence of AI-2 by inducing luminescence of <i>Vibrio harveyi</i> reporter strain BB170.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/4/4c/T--NKU_China--notebook-18-20-03.jpg">
+                                    <figcaption>
+                                        <div class="p"><span>Relative fluorescence intensity of suppliers at specific times</span></div>
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/f/f7/T--NKU_China--notebook-18-20-04.jpg">
+                                    <figcaption>
+                                        <div class="p"><span>Relative fluorescence intensity of consumers at specific times</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment19-2">
+                            <div class="p">
+                                HPLC was performed to detect the production of AI-2 of the strain pLuxS.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/d/d9/T--NKU_China--notebook-18-20-05.png">
+                                    <figcaption>
+                                        <div class="p"><span>HPLC result of AI-2 production of luxS overexpression strain and negative control</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week20">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week20 (Seq 26&ndash;Oct 02)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs7">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment20-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment20-2">&#10113;</a></li>
+                        </ul>
+                        <div id="fragment20-1">
+                            <div class="p">
+                                Biofilm studies and evaluation:<br>
+                                pTrcHisB, pLuxS, pLuxSMtn, pLsrACDB, pLsrACDBFG, pLsrACDBK, pLsrACDBFGK were diluted to OD~0.05 and reinoculated at a total volume of 200 &mu;L at a 1:1 (v/v) ratio. IPTG (1 mM) was added at OD ~ 0.4, and biofilms were cultured for ~24 h (&plus;/&minus;30 min) at 30 <sup>o</sup>C in static conditions. After incubation, optical density was read on a plate reader at 600 nm. The supernatant was gently decanted, and each well was washed 3 times with 300 &mu;L of sterile PBS to detach loosely adhered cells. The plate was then incubated at 60 <sup>o</sup>C  with the lid off for 60 min, and afterwards, 250 &mu;L of 0.1% crystal violet was added to each well and incubated for 15 min at room temperature. Crystal violet stain was aspirated with a pipette and excess stain was washed off by gently submerging and mixing in a tray filled with distilled water until washings were free of the stain. After the microplate was airdried, the dye was resolubilized by adding 250 &mu;L of 95% ethanol, and incubated at room temperature with shaking for 30 min. The optical density of each well stained with crystal violet was measured at 540 nm.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/3/33/T--NKU_China--notebook-18-20-06.jpg">
+                                    <figcaption>
+                                        <div class="p"><span>Relative biofilm production of suppliers</span></div>
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/8/8b/T--NKU_China--notebook-18-20-07.jpg">
+                                    <figcaption>
+                                        <div class="p"><span>Relative biofilm production of consumers</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment20-2">
+                            <div class="p">
+                                Cultured media of controllers were tested for the presence of AI-2 by HPLC. AI-2 output and uptake profiles of controllers were drawn according to the HPLC results.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/e/ed/T--NKU_China--notebook-18-20-08.jpg">
+                                    <figcaption>
+                                        <div class="p"><span>AI-2 output profiles of suppliers</span></div>
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/0/04/T--NKU_China--notebook-18-20-09.jpg">
+                                    <figcaption>
+                                        <div class="p"><span>AI-2 uptake profiles of consumers</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
                  </div>
              </div>
-         </section>
+         </div>
      </div>
 </body>
 </html>
 {{NKU_China/footer}}