Difference between revisions of "Team:NKU China/Notebook"

Latest revision as of 16:17, 19 October 2016

50μL PCR system ×2
2× Taq Master Mix	25μL
C2-F	2μL
C2-R	2μL
p-C2	2μL
ddH2O	19μL
Total	50μL

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	15 sec	30 cycles
72^oC	30 sec
72^oC	10 min
16^oC	∞

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
pMD19 T-Simple Vector	1μL
C2-luxS	4μL
ddH2O	12μL
Total	20μL
Reaction condition: 16^oC overnight

20μL digestion system
10× FastDigest Buffer	2μL
BamH Ⅰ	1μL
T-lsrACDB	1μL
ddH2O	7μL
Total	20μL
Reaction condition: 37^oC for 40 min

100μL methylation system
10× BamH Ⅰ methyltransferase Buffer	10μL
BamH Ⅰ methyltransferase	1μL
S-adenosylmethionine	0.5μL
pWH-C2-luxS	80μL
ddH2O	8.5μL
Total	100μL
Reaction condition: 37^oC for 1 hour

Groups divided in this experiment
GR286	wild strain as control group
GR286ΔluxS	GR286 without luxS gene
pWH-luxS	luxS overexpression plasmid in GR286; without induced by xylose
pWH-luxS + xyl	luxS overexpression plasmid in GR286; induced by xylose
pWH1520	empty plasmid in GR286 as control group
pHT-lsrACDB	lsrACDB overexpression plasmid in GR286ΔluxS
pHT-01	empty plasmid in GR286ΔluxS as control group

Selection of positive clones by colony PCR
(No.1 is positive control, No.2-6 are experimental groups. The result showed that we failed to transformed the plasmid pWH-*C2-luxS* into GR286)

Laboratory Notes

☞☟ Week1 (May 16–May 22)

begin
➀
➁
➂

In order to make sure the efficiency of our "consumer", we should first knock out the luxS gene in our engineering bacteria GR286(a simplified strain of Bacillus amyloliquefaciens LL3). We used a markerless gene replacement method to knock out the luxS gene.

Construction of targeting vector : the upstream and downstream of luxS gene were combined by over-lapping PCR and ligated into plasmid pKSU.

pKSU-ΔluxS was transformed into GR286, and positive clones were selected.

20μL PCR system
2× Taq Master Mix	10μL
pKSU-F	1μL
pKSU-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	1 min 30 sec
72^oC	10 min
16^oC	∞

The transformants were cultured at 42^oC with chloramphenicol to select single-crossover clones.

20μL PCR system
2× Taq Master Mix	10μL
luxS-up-F	1μL
luxS-dn-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
56^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

Selection of single-crossover clones by PCR
(No.1-4 are single-crossover strains,
No.5 is positive control.)

☞☟ Week2 (May 23–May 29)

➀
➁

The single-crossover strains were then cultured in LB medium and passaged every 12 hours for 4 generations.

The last generation was cultured in medium with 5-fluorouracil to select double-crossover clones. Regretfully, we didn't get the double-crossover clones.

20μL PCR system
2× Taq Master Mix	10μL
luxS-up-F	1μL
luxS-dn-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
56^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

Selection of double-crossover clones by PCR
(No.1-5 are experimental groups, No.6 is wild GR286. The result showed that we failed to get the double-crossover clones.)

☞☟ Week3 (May 30–Jun 05)

➀
➁
➂

Transformants were cultured at 42^oC with chloramphenicol again and the single-crossover clones were selected successfully.

20μL PCR system
2× Taq Master Mix	10μL
luxS-up-F	1μL
luxS-dn-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
56^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

Selection of single-crossover clones by PCR
(No.1&2&4 are single-crossover strains,No.5 is positive control. )

The single-crossover strains were then cultured in LB medium and passaged every 12 hours for 4 generations.

The last generation was cultured in medium with 5-fluorouracil to select double-crossover clones. We finally obtained our aimed strain—GR286ΔluxS.

20μL PCR system
2× Taq Master Mix	10μL
luxS-up-F	1μL
luxS-dn-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
56^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

Selection of Δ*luxS* clones by PCR
(The No.4 is the aimed strain&horbar;GR286Δ*luxS*)

☞☟ Week4 (Jun 06–Jun 12)

➀
➁
➂
➃
➄
➅

The GR286ΔluxS strain was cultured and made competent for future use.

The lsrACDB gene from Bacillus thuringiensis was cloned and ligated to T-vector.

50μL PCR system ×2
2× Taq Master Mix	25μL
lsrACDB-F	2μL
lsrACDB-R	2μL
Bacterium solution	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
57^oC	30 sec	30 cycles
72^oC	4 min 30 sec
72^oC	10 min
16^oC	∞

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
pMD19 T-Simple Vector	1μL
lsrACDB	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

The T-lsrACDB was transformed into DH5α and plate was coated, and then positive clones were selected.

20μL PCR system
2× Taq Master Mix	10μL
M13F	1μL
M13R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
59^oC	30 sec	30 cycles
72^oC	4 min 30 sec
72^oC	10 min
16^oC	∞

Selection of positive clones by PCR
(No. 3&4 are positive results)

After restriction enzyme digestion verification, the positive clones were then sequenced. Unfortunately, the sequencing result showed some mutations inside the target gene.

20μL digestion system
10× FastDigest Buffer	2μL
BamH Ⅰ	1μL
T-lsrACDB	1μL
ddH2O	7μL
Total	20μL
Reaction condition: 37^oC for 40 min

Restriction enzyme digestion verification
(No.1 are *lsrACDB* fragement, No.2 are linearized T-vector.)

The gene cloning process was repeated but there were still some mutations.

We finally decided to request the gene company to synthesize the lsrACDB gene.

☞☟ Week5 (Jun 13–Jun 19)

begin
➀
➁
➂
➃

This week, we started to construct another controller―supplier.

A strong promoter C2 was cloned from former kit and luxS gene was cloned from GR286.

50μL PCR system ×2
2× Taq Master Mix	25μL
C2-F	2μL
C2-R	2μL
p-C2	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	15 sec	30 cycles
72^oC	30 sec
72^oC	10 min
16^oC	∞

50μL PCR system ×2
2× Taq Master Mix	25μL
luxS-F	2μL
luxS-R	2μL
Bacterium solution	1μL
GR286	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
59^oC	30 sec	30 cycles
72^oC	30 sec
72^oC	10 min
16^oC	∞

PCR cloning product of promoter C2 and gene *luxS*
(NO.1&2 are C2, No.3&4 are *luxS*)

Two segments were fused together by fusion PCR and ligated into T-vector. After that, the vector was transformed into DH5α.

50μL PCR system ×2
2× Taq Master Mix	25μL
C2-F	2μL
luxS-R	2μL
C2	2μL
luxS	2μL
ddH2O	17μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
59^oC	30 sec	30 cycles
72^oC	40 sec
72^oC	10 min
16^oC	∞

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
pMD19 T-Simple Vector	1μL
C2-luxS	4μL
ddH2O	12μL
Total	20μL
Reaction condition: 16^oC overnight

Positive clones were selected by colony PCR.

20μL PCR system
2× Taq Master Mix	10μL
M13-F	1μL
M13-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
59^oC	30 sec	30 cycles
72^oC	40 sec
72^oC	10 min
16^oC	∞

PCR cloning product of promoter C2 and gene *luxS*

4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
BamH Ⅰ	1μL
T-lsrACDB	1μL
ddH2O	7μL
Total	20μL
Reaction condition: 37^oC for 40 min

Restriction enzyme digestion verification
(No.1 are linearized T-vector, No.2 are *C2-luxS* fragment.)

☞☟ Week6 (Jun 20–Jun 26)

➀
➁
➂
➃
➄

The sequencing result showed that there was a correct strain and thus it could be used for the following experiments. We obtained the correct plasmid T-C2-luxS from DH5α. Then the fragment C2-luxS was obtained by digestion and gel extraction.

40μL digestion system
10× FastDigest Buffer	4μL
BamH Ⅰ	2μL
T-C2-luxS	25μL
ddH2O	9μL
Total	20μL
Reaction condition: 37^oC for 40 min

The C2-luxS fragment was ligated to linearized plasmid pWH1520, and then the ligation product was transformed into DH5α.

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
pMD19 T-Simple Vector	1μL
C2-luxS	5μL
ddH2O	11μL
Total	20μL
Reaction condition: 16^oC overnight

The plasmid pWH-C2-luxS was extracted from DH5α. To prevent the plasmid from DAM&DCM methylation, we transformed it into E.coli JM110.

The plasmid pWH-C2-luxS was extracted from JM110,and then it was treated with BamH Ⅰ methylase.

100μL methylation system
10× BamH Ⅰ methyltransferase Buffer	10μL
BamH Ⅰ methyltransferase	1μL
S-adenosylmethionine	0.5μL
pWH-C2-luxS	80μL
ddH2O	8.5μL
Total	100μL
Reaction condition: 37^oC for 1 hour

The plasmid was transformed into GR286 by electroporation.[Failed]

☞☟ Week7 (Jun 27–Jul 03)

➀
➁
➂

This week, we tried to use different voltages to transform the plasmid. Sadly, all of these attempts rendered negative results.

We considered whether the luxS gene is toxic for GR286, and the bacteria tends to reject the gene when a strong promoter is inserted upstream of it. So, we planned to use inducible promoter to reconstruct our expression vector.

The plasmid pWH1520 contains a strong xylA promoter originating from Bacillus megaterium, and transcription initiated by this promoter is xylose-inducible. Also, the gene of interest carries its own ribosome binding sequence (RBS) and translation initiation codon. Based on these points, we redesigned primers.

☞☟ Week8 (Jul 04–Jul 10)

➀
➁
➂
➃

luxS gene was cloned from GR286 using our new primers.

50μL PCR system ×2
2× Taq Master Mix	25μL
YD-luxS-F	2μL
YD-luxS-R	2μL
Bacterium solution	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	40 sec
72^oC	10 min
16^oC	∞

The luxS fragment was purified by gel extraction, and ligated into linearized pWH1520. Then the vector was transformed into DH5α.

40μL digestion system ×2
10× FastDigest Buffer	4μL
BamH Ⅰ	2μL
pWH1520	25μL
ddH2O	9μL
Total	40μL
Reaction condition: 37^oC for 40 min

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
linearized pWH1520	1μL
luxS	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

Positive clones were selected by colony PCR.

20μL PCR system
2× Taq Master Mix	10μL
pWH-F	1μL
pWH-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	40 sec
72^oC	10 min
16^oC	∞

Selection of positive clones by colony PCR

4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
BamH Ⅰ	1μL
pWH-luxs	10μL
ddH2O	7μL
Total	20μL
Reaction condition: 37^oC for 40 min

Restriction enzyme digestion verification
(No.1 are linearized pWH1520, No.2 are *luxS* fragments.)

☞☟ Week9 (Jul 11–Jul 17)

➀
➁
➂
end

The sequencing result showed there's three positive strains. So one positive strain was chosen to be used for the following experiments. The pWH-luxS plasmid was extracted from the chosen strain. To prevent the plasmid from DAM&DCM methylation, we transformed it into E.coli JM110.

the plasmid pWH-luxS was extracted from JM110,and it was treated withBamH Ⅰ methylase.

100μL methylation system
10× BamH Ⅰ methyltransferase Buffer	10μL
BamH Ⅰ methyltransferase	1μL
S-adenosylmethionine	0.5μL
pWH-C2-luxS	80μL
ddH2O	8.5μL
Total	100μL
Reaction condition: 37^oC for 1 hour

The plasmid was transformed into GR286 by electroporation, and positive clones were selected.

The construction of supplier was accomplished!

☞☟ Week10 (Jul 18–Jul 24)

➀
➁

We have received the product of synthetic lsrACDB gene. We first used restriction-ligation method to ligate lsrACDB to plasmid pWH1520, but we failed to select positive after several tries.

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
linearized pWH1520	1μL
lsrACDB	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

Considering that the lsrACDB gene is a large fragment (4500bp), we used ClonExpress technique to clone the gene again to improve the efficiency of ligation. The lsrACDB sequence was divided into two parts and they were cloned separately. Then the two segments were ligated to the plasmid pWH1520 and the recombinant vector was transformed into DH5α. After that, verification PCR was used to select the positive clones. However, we didn't get a good result.

Selection of positive clones by colony PCR
(No.6 is positive control, No.1-5 are experimental groups)

☞☟ Week11 (Jul 25–Jul 31)

➀

We learnt a new method called circular polymerase extension cloning (CPEC) for high-throughput cloning of complex and combinatorial DNA libraries, and we decided to use this method to try to ligate our lsrACDB gene. It's encouraging that we succeeded to ligate the lsrACDB gene to the plasmid pHT-01.

Selection of positive clones by colony PCR
(No.3-6 are positive clones)

Restriction enzyme digestion verification
(No.2&3 are positive results.)

☞☟ Week12 (Aug 1–Aug 7)

➀
➁

Since we have already successfully constructed "supplier" and part of "consumer", we decided to measure the growth curve to explore the function of our "controller".

Groups divided in this experiment
GR286	wild strain as control group
GR286ΔluxS	GR286 without luxS gene
pWH-luxS	luxS overexpression plasmid in GR286; without induced by xylose
pWH-luxS + xyl	luxS overexpression plasmid in GR286; induced by xylose
pWH1520	empty plasmid in GR286 as control group
pHT-lsrACDB	lsrACDB overexpression plasmid in GR286ΔluxS
pHT-01	empty plasmid in GR286ΔluxS as control group

OD₆₀₀ of different groups at specific times

Growth curve of pWH-*luxS*, pWH-*luxS* + xyl and pWH1520

Growth curve of pHT-*lsrACDB* and pHT-01

Cultured media of our supplier was tested for the presence of AI-2 by inducing luminescence of Vibrio harveyi reporter strain BB170.

Fluorescence intensity of different groups at specific times

Relative fluorescence intensity of different groups

☞☟ Week13 (Aug 8–Aug 14)

➀
➁

For our consumer, we should also overexpress the lsrK and lsrFG gene for phosphorylating and degrading phosphorylated AI-2. We used ClonExpress technique to clone the two genes and ligate them to plasmid pHT-01 successfully.

Restriction enzyme digestion verification
(No.1&3&4 are positive results. )

We co-cultured the supplier with BB170 and tested the fluorescence intensity to explore the function of supplier. (negative result)

Fluorescence intensity of BB170 and co-culture medium

☞☟ Week14 (Aug 15–Aug 21)

begin
outline
1.1
1.2
1.3

Since the controller we constructed with GR286 did not demonstrate positive results, we decided to substitute GR286 with Escherichia coli whose AI-2 metabolic pathway had been elucidated as the chassis of our controller.

The strains to be constructed are shown in the tables below.

AI-2 supplier
	LuxS	Mtn
pTrcHisB	Native	Native
pLuxS	Induced	Native
pLuxS-Mtn	Induced	Induced

AI-2 consumer
	LsrACDB	LsrK	LsrFG
pTrcHisB	Native	Native	Native
pLsrACDB	Induced	Native	Native
pLsrFG	Native	Native	Induced
pLsrK	Native	Induced	Native
pLsrACDBFG	Induced	Native	Induced
pLsrACDBK	Induced	Constitutive	Native
plsrACDBFGK	Induced	Constitutive	Induced

The sequences of lsrACDB, lsrFG, lsrK, luxS, mtn gene in E.coli K12 were searched in NCBI, and primers were designed according to the gene sequences. The primers used in the construction of AI-2 controller are shown in the table below.

Primers used in the construction of AI-2 controller
Primer name	Sequence
lsrACDBFG1-F	CGACGATGACGATAAGGATCCATGCAAACGAGTGATACCCGC
lsrACDBFG1-R	TGTTTGGCGTTTCCGGCAGCGGTGCGGAGAGC
lsrACDBFG2-F	TGTTTGGCGTTTCCGCGATTG
lsrACDBFG2-R	GCACTCTCACACCACGTTGCATGGCGCGTTTC
lsrACDBFG3-F	GTGGTGTGAGAGTGCTGAC
lsrACDBFG3-R	ACCAGCTGCAGATCTCGAGCTCGTCACGGCATCAACCCATTGAAC
lsrACDB1-F	CGACGATGACGATAAGGATCCATGCAAACGAGTGATACCCGC
lsrACDB1-R	ACCGGAACCGCCGAGCAAACTAATGCCGCCCAGCAC
lsrACDB2-F	CTCGGCGGTTCCGGTGCGAT
lsrACDB2-R	ACCAGCTGCAGATCTCGAGCTCGTCAGAAATCGTATTTGCCG
luxS-F	ATGACGATAAGGATCCGAGCTCGATGCCGTTGTTAGATAGCTTC
luxS-R	GGACTCCCCCGGGGGACTAAATGTGCAGTTCCTGCAACTTC
mtn-F	TCCCCCGGGGGAGTCCTCTCCCGCGTGAGAAATAC
mtn-R	TATGGTACCAGCTGCAGATCTCTTAGCCATGTGCAAGTTTCTG
luxS-Fd	GGAATTCCCTAAATGTGCAGTTCCTGCAACTTC
luxS-Rv	GGGGTACCCCATGCCGTTGTTAGATAGCTTCACAG
lsrK-Fd	GGGGTACCCCATGGCTCGACTCTTTACC
lsrK-Rv	GGAATTCCCTATAACCCAGGCGCTTTCC
lsrFG-Fd	CGGGATCCCGATGGCAGATTTAGACGATATTAAAGATGG
lsrFG-Rv	GAAGATCTTCTCACGGCATCAACCCATTGAAC
lsrK-F	AACTGCAGAACCAATGCATTGGTTTACGGCTAGCTCAGTCCTAGGTATAGTGCTAGCAAAGAGGAGAAAATGGCTCGACTCTTTACC
lsrK-R	TTCGAACTATAACCCAGGCGCTTTCC
BK-JC-F	TTTCAGTGTATGTCGCGGATGC
GK-JC-F	TTGCGCTTCGATGTCTTACAGG
pTrc-JC-F	TGGGCACTCGACCGGAATTATC
pTrc-JC-R	GCTACTGCCGCCAGGCAAATTC

Construction of pLuxS-Mtn

luxS gene was cloned from E.coli K12.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
luxS-F	2μL
luxS-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
63^oC	30 sec	30 cycles
72^oC	30 sec
72^oC	10 min
16^oC	∞

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
mtn-F	2μL
mtn-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
63^oC	30sec	30 cycles
72^oC	45 sec
72^oC	10 min
16^oC	∞

ClonExpress technique was used to ligate luxS and mtn genes to plasmid pTrcHisB. The recombinant vector pTrc-luxS-mtn was transformed into E.coli K12. After that, verification PCR was performed to select the positive clones.

20μL PCR system
PrimeSTAR Max Premix(2×)	10μL
pTrc-JC-F	1μL
pTrc-JC-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30sec	30 cycles
72^oC	1 min 30 sec
72^oC	10 min
16^oC	∞

Selection of positive clones by PCR
(NO.3&5&8 are positive results)

3 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
Sac Ⅰ	1μL
Bgl Ⅱ	1μL
pTrc-luxS-mtn	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

Restriction enzyme digestion verification
(No.1 are linearized pTrcHisB, No.2 are *luxS*-*mtn* fragment. )

☞☟ Week15 (Aug 22–Aug 28)

outline
1.1
1.2
1.3
1.4
2.1
2.2
2.3
3.1
3.2
3.3

Construction of pLuxS
Construction of pLsrACDB
Construction of pLsrACDBFG

luxS gene was cloned from E.coli K12.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
luxS-Fd	2μL
luxS-Rv	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
60^oC	30 sec	30 cycles
72^oC	30 sec
72^oC	10 min
16^oC	∞

The luxS gene was purified by gel extraction. Then, both the luxS segment and pTrcHisB vector were treated with restriction enzyme. After that, luxS gene was ligated to linearized pTrcHisB, and the ligation product was transformed into E.coli K12.

40μL digestion system ×2
10× FastDigest Buffer	4μL
Kpn Ⅰ	2μL
EcoR Ⅰ	2μL
luxS	25μL
ddH2O	7μL
Total	40μL
Reaction condition: 37^oC for 40 min

40μL digestion system ×2
10× FastDigest Buffer	4μL
Kpn Ⅰ	2μL
EcoR Ⅰ	2μL
pTrcHisB	20μL
ddH2O	12μL
Total	40μL
Reaction condition: 37^oC for 40 min

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
linearized pTrcHisB	1μL
luxS	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

Verification PCR was performed to select the positive clones.

20μL PCR system ×2
2× Taq Master Mix	10μL
pTrc-JC-F	1μL
pTrc-JC-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30sec	30 cycles
72^oC	50 sec
72^oC	10 min
16^oC	∞

One positive strain was chosen to be cultured overnight and plasmid was extracted. After restriction enzyme digestion verification, the positive clone was sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
Kpn Ⅰ	1μL
EcoR Ⅰ	1μL
pTrc-luxS	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

Restriction enzyme digestion verification
(No.1 is linearized pTrcHisB + *luxS*, No.2 is plasmid pTrc-*luxS*. )

The lsrACDBFG sequence was divided into three parts and they were cloned separately. Then the three segments were ligated to the linearized pTrcHisB by ClonExpress technique, and the recombinant vector was transformed into DH5α.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrACDB1-F	2μL
lsrACDB1-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrACDB2-F	2μL
lsrACDB2-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
60^oC	30 sec	30 cycles
72^oC	2 min 20 sec
72^oC	10 min
16^oC	∞

PCR cloning product of segment *lsrACDB1*,*lsrACDB1*2

Verification PCR was performed to select the positive clones.

4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
BamH Ⅰ	1μL
Sac Ⅰ	1μL
pTrc-lsrACDB	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

The lsrACDBFG sequence was divided into three parts and they were cloned separately. Then the three segments were ligated to the linearized pTrcHisB by ClonExpress technique, and the recombinant vector was transformed into DH5α.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrACDBFG1-F	2μL
lsrACDBFG1-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrACDBFG2-F	2μL
lsrACDBFG2-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrACDBFG3-F	2μL
lsrACDBFG3-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

PCR cloning product of segment *lsrACDBFG*1,*lsrACDBFG*2, *lsrACDBFG*3

Verification PCR was performed to select the positive clones.

4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
BamH Ⅰ	1μL
Sac Ⅰ	1μL
pTrc-lsrACDB	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

Restriction enzyme digestion verification
(No.1-4 are linearized pTrcHisB + *lsrACDBFG*, No.5 is plasmid pTrc-*lsrACDBFG*.)

☞☟ Week16 (Aug 29–Sep 04)

outline
1.1
1.2
1.3
1.4
2.1
2.2
2.3
2.4
3.1
3.2
3.3
3.4

Construction of pLsrFG
Construction of pLsrACDBK
Construction of pLsrACDBFGK

lsrFG gene was cloned from E.coli K12.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrFG-Fd	2μL
lsrFG-Rv	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	1 min 15 sec
72^oC	10 min
16^oC	∞

The lsrFG gene was purified by gel extraction. Then, both the lsrFG segment and pTrcHisB vector were treated with restriction enzyme. After that, lsrFG gene was ligated to linearized pTrcHisB, and the ligation product was transformed into E.coli K12.

40μL digestion system ×2
10× FastDigest Buffer	4μL
BamH Ⅰ	2μL
Bgl Ⅱ	2μL
lsrFG	25μL
ddH2O	7μL
Total	40μL
Reaction condition: 37^oC for 40 min

40μL digestion system ×2
10× FastDigest Buffer	4μL
BamH Ⅰ	2μL
Bgl Ⅱ	2μL
pTrcHisB	20μL
ddH2O	12μL
Total	40μL
Reaction condition: 37^oC for 40 min

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
pMD19 T-Simple Vector	1μL
luxSFG	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

Verification PCR was performed to select the positive clones.

20μL PCR system ×2
2× Taq Master Mix	10μL
pTrc-JC-F	1μL
pTrc-JC-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	1 min 30 sec
72^oC	10 min
16^oC	∞

Selection of positive clones by PCR
(NO. 1&3 are positive results)

Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
BamH Ⅰ	1μL
Bgl Ⅱ	1μL
pTrc-lsrFG	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

lsrK gene was cloned from E.coli K12.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrK-F	2μL
lsrK-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
55^oC	30 sec	30 cycles
72^oC	1 min 40 sec
72^oC	10 min
16^oC	∞

The lsrK gene was purified by gel extraction. Then, both the lsrK segment and pTrc-lsrACDB vector were treated with restriction enzyme. After that, lsrK gene was ligated to linearized pTrc-lsrACDB, and the ligation product was transformed into E.coli K12.

40μL digestion system ×2
10× FastDigest Buffer	4μL
Pst Ⅰ	2μL
BstB Ⅰ	2μL
lsrK	25μL
ddH2O	7μL
Total	40μL
Reaction condition: 37^oC for 40 min

40μL digestion system ×2
10× FastDigest Buffer	4μL
Pst Ⅰ	2μL
BstB Ⅰ	2μL
pTrc-lsrACDB	25μL
ddH2O	7μL
Total	40μL
Reaction condition: 37^oC for 40 min

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
linearized pTrc-lsrACDB	1μL
lsrK	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

Verification PCR was performed to select the positive clones.

20μL PCR system ×2
2× Taq Master Mix	10μL
BK-JC-F	1μL
pTrc-JC-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
Pst Ⅰ	1μL
BstB Ⅰ	1μL
pTrc-lsrACDBK	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

lsrK gene was cloned from E.coli K12.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrK-F	2μL
lsrK-R	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
55^oC	30 sec	30 cycles
72^oC	1 min 40 sec
72^oC	10 min
16^oC	∞

The lsrK gene was purified by gel extraction. Then, both the lsrK segment and pTrc-lsrACDBFG vector were treated with restriction enzyme. After that, lsrK gene was ligated to linearized pTrc-lsrACDBFG, and the ligation product was transformed into E.coli K12.

40μL digestion system ×2
10× FastDigest Buffer	4μL
Pst Ⅰ	2μL
BstB Ⅰ	2μL
lsrK	25μL
ddH2O	7μL
Total	40μL
Reaction condition: 37^oC for 40 min

40μL digestion system ×2
10× FastDigest Buffer	4μL
Pst Ⅰ	2μL
BstB Ⅰ	2μL
pTrc-lsrACDBFG	20μL
ddH2O	12μL
Total	40μL
Reaction condition: 37^oC for 40 min

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
linearized pTrc-lsrACDFGB	1μL
lsrK	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

Verification PCR was performed to select the positive clones.

20μL PCR system ×2
2× Taq Master Mix	10μL
GK-JC-F	1μL
pTrc-JC-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

Selection of positive clones by PCR
(NO.3 is positive result)

Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
Pst Ⅰ	1μL
BstB Ⅰ	1μL
pTrc-lsrACDBKFGK	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

☞☟ Week17 (Sep 05–Sep 11)

outline
1.1
1.2
1.3
1.4

Construction of pLsrK

lsrK gene was cloned from E.coli K12.

50μL PCR system ×2
PrimeSTAR Max Premix(2×)	25μL
lsrK-Fd	2μL
lsrK-Rv	2μL
E.coli K12	2μL
ddH2O	19μL
Total	50μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
55^oC	30 sec	30 cycles
72^oC	1 min 40 sec
72^oC	10 min
16^oC	∞

The lsrK gene was purified by gel extraction. Then, both the lsrK segment and pTrc-lsrACDBFG vector were treated with restriction enzyme. After that, lsrK gene was ligated to linearized pTrc-lsrACDBFG, and the ligation product was transformed into E.coli K12.

40μL digestion system ×2 ×2
10× FastDigest Buffer	4μL
Kpn Ⅰ	2μL
EcoR Ⅰ	2μL
lsrK	25μL
ddH2O	7μL
Total	40μL
Reaction condition: 37^oC for 40 min

40μL digestion system ×2 ×2
10× FastDigest Buffer	4μL
Pst Ⅰ	2μL
BstB Ⅰ	2μL
pTrc-HisB	20μL
ddH2O	12μL
Total	40μL
Reaction condition: 37^oC for 40 min

20μL ligation system
10× DNA Ligase Buffer	2μL
T4 DNA Ligase	1μL
linearized pTrcHisB	1μL
lsrK	3μL
ddH2O	13μL
Total	20μL
Reaction condition: 16^oC overnight

Verification PCR was performed to select the positive clones.

20μL PCR system ×2
2× Taq Master Mix	10μL
pTrc-JC-F	1μL
pTrc-JC-R	1μL
Bacterium solution	1μL
ddH2O	7μL
Total	20μL

}

PCR reaction condition
94^oC	10 min
94^oC	30 sec
58^oC	30 sec	30 cycles
72^oC	2 min
72^oC	10 min
16^oC	∞

4 positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.

20μL digestion system
10× FastDigest Buffer	2μL
Kpn Ⅰ	1μL
EcoR Ⅰ	1μL
pTrc-lsrK	6μL
ddH2O	10μL
Total	20μL
Reaction condition: 37^oC for 40 min

☞☟ Week18 (Seq 12–Seq 18)

➀
➁

We detected the expression of several overexpressed genes at the mRNA level by RT-PCR, and obtained positive results.

Relative expression of several overexpressed genes at the mRNA level

SDS-PAGE was performed to detect the expression of these genes at the protein level.

pTrcHisB, pLuxS, pLuxS-Mtn, pLsrACDB, pLsrACDBFG SDS-PAGE

☞☟ Week19 (Seq 19–Seq 25)

➀
➁

Cultured media of controllers were tested for the presence of AI-2 by inducing luminescence of Vibrio harveyi reporter strain BB170.

Relative fluorescence intensity of suppliers at specific times

Relative fluorescence intensity of consumers at specific times

HPLC was performed to detect the production of AI-2 of the strain pLuxS.

HPLC result of AI-2 production of luxS overexpression strain and negative control

☞☟ Week20 (Seq 26–Oct 02)

➀
➁

Biofilm studies and evaluation:
pTrcHisB, pLuxS, pLuxSMtn, pLsrACDB, pLsrACDBFG, pLsrACDBK, pLsrACDBFGK were diluted to OD~0.05 and reinoculated at a total volume of 200 μL at a 1:1 (v/v) ratio. IPTG (1 mM) was added at OD ~ 0.4, and biofilms were cultured for ~24 h (+/−30 min) at 30 ^oC in static conditions. After incubation, optical density was read on a plate reader at 600 nm. The supernatant was gently decanted, and each well was washed 3 times with 300 μL of sterile PBS to detach loosely adhered cells. The plate was then incubated at 60 ^oC with the lid off for 60 min, and afterwards, 250 μL of 0.1% crystal violet was added to each well and incubated for 15 min at room temperature. Crystal violet stain was aspirated with a pipette and excess stain was washed off by gently submerging and mixing in a tray filled with distilled water until washings were free of the stain. After the microplate was airdried, the dye was resolubilized by adding 250 μL of 95% ethanol, and incubated at room temperature with shaking for 30 min. The optical density of each well stained with crystal violet was measured at 540 nm.

Relative biofilm production of suppliers

Relative biofilm production of consumers

Cultured media of controllers were tested for the presence of AI-2 by HPLC. AI-2 output and uptake profiles of controllers were drawn according to the HPLC results.

@@ Line 2: / Line 2: @@
 <html>
 <head>
-     <!--delete in wiki-->
-     <meta charset="utf-8">
+     <!--separatrix-->
-    <meta name="viewport" content="width=device-width, initial-scale=1">
+     <style>
-    <link rel="stylesheet" href="https://2016.igem.org/Template:NKU_China/css/jquery-ui?action=raw&ctype=text/css" />
+        .main#notebook {
-    <script src="https://2016.igem.org/Template:NKU_China/js/jquery?action=raw&ctype=text/javascript"></script>
+            padding: 0 8vw;
-    <script src="https://2016.igem.org/Template:NKU_China/js/jquery-ui?action=raw&ctype=text/javascript"></script>
+        }
-    <link rel="stylesheet" href="https://2016.igem.org/Template:NKU_China/css/share?action=raw&ctype=text/css">
+        #notebook .ui-accordion .ui-accordion-content {
+            height: calc(100vh - 13rem - 18px);
+            position: relative;
+            z-index: 3;
+            box-sizing: border-box;
+            background-color: transparent;
+        }
-    <style>
+        #notebook .ui-tabs {
-         main {
+            margin: 0.2rem;
-             width:86vw;
+            background-color: transparent;
          }
+        #notebook .ui-tabs .ui-tabs-nav .ui-tabs-anchor {
+             font-weight:normal;
+        }
+        #week16 .ui-tabs-anchor {
+            font-size:1.2rem;
+        }
+        #notebook .ui-tabs .ui-tabs-nav .ui-tabs-anchor.circle-number {
+            font-weight:bold;
+        }
+        #notebook .ui-tabs .ui-tabs-panel {
+            position: relative;
+            z-index: 0;
+            background-color: transparent;
+            height: calc(100vh - 17rem - 18px);
+            overflow: auto;
+         }
-         .ui-accordion-content .p, .ui-accordion .ui-tabs {
+         #notebook .ui-tabs-panel > .p, #notebook .ui-tabs-panel > ol, #notebook .ui-tabs-panel > ul {
-             margin:0.8rem 1.6rem;
+             margin: 0.8rem 1.6rem;
          }
-         .flex-container {
+         #notebook .flex-container {
-             display:flex;
+             display: flex;
              justify-content: space-around;
+            align-content: space-around;
              flex-wrap: wrap;
+            background-color: transparent;
          }
-         .ui-accordion .ui-accordion-content {
+         #notebook  .table-wrapper {
-             max-height:calc(100vh - 10rem);
+             margin: auto;
+            padding: 1rem;
+            position:relative;
          }
-        .ui-accordion .ui-tabs-panel table, .ui-accordion .ui-tabs-panel figure {
+         .table-wrapper div.rbrace {
-             /*background-color:initial;*/
+             font-weight:100;
+            color:dodgerblue;
+            position:absolute;
+            right:6.5rem;
+            bottom:5rem;
+            font-size:4rem;
+            z-index:4;
          }
-         .ui-accordion .ui-tabs-panel table caption {
-             border-top: 0.15rem solid;
+         #notebook  table {
-             border-bottom: 0.15rem solid;
+            margin: 0;
-             margin: auto;
+        }
+        #notebook table, #dongzhuoer td {
+            border: none;
+        }
+        #notebook  table {
+            font-size: 1rem;
+            padding: 0;
+        }
+        #notebook  table caption {
+             border-top: 0.1rem solid;
+             border-bottom: 0.1rem solid;
+             margin: 0;
              padding: 0.2rem 0;
-             box-sizing: border-box;
+             text-align: center;
+            background-color: white;
          }
-         .ui-accordion .ui-tabs-panel table tr {
+         #notebook  table tr {
              margin: 0;
              padding: 0;
+            background-color: white;
          }
-         .ui-accordion .ui-tabs-panel table td {
+         #notebook  table td {
-             border:none;
+             border: none;
              margin: 0;
              padding: 0.2rem 1.2rem;
          }
-         .ui-accordion .ui-tabs-panel table tr:last-child td {
+         #notebook table tr:last-child td {
-             border-bottom: 0.15rem solid;
+             border-bottom: 0.1rem solid;
          }
-         .ui-accordion .ui-tabs-panel figure {
+         figure {
              text-align: center;
+            font-size: 0.9rem;
+            margin: auto;
+            padding: 1rem;
          }
-         .ui-accordion .ui-tabs-panel figure img {
+         figure img {
-             margin: 0;
+             width: 100%;
-             padding: 0;
+             margin-bottom:0.25rem;
          }
-         .ui-accordion .ui-tabs-panel figure figcaption {
+         figure img.white {
-             font-size: 0.8rem;
+            background-color:white;
-             margin: 0;
+        }
-             padding: 0.25rem;
+        figure figcaption {
+            text-align:center;
+            line-height:1.25;
+        }
+        #notebook figure figcaption .p {
+             text-indent:0;
+             text-align:center;
+        }
+        #notebook .ui-tabs-panel li {
+             margin:0.3rem;
          }
      </style>
-     <style class="table-theme.css">
+     <style title="table-theme.css">
+        /**/
+        #notebook .table-theme-0 {
+            /*color: rgb(49,132,155);*/
+            background-color:transparent;
+            border-collapse:collapse;
+            /*color:blue;*/
+        }
+        #notebook .table-theme-0 tr {
+            background-color:transparent;
+        }
+        #notebook .table-theme-0 tr td {
+            background-color:transparent;
+            border:0.05rem solid white;
+            border-bottom-width:0.05rem;
+        }
+        #notebook .table-theme-0 tr:last-child td {
+            border-bottom-width:0.05rem;
+        }
+        #notebook .table-theme-0 caption {
+            border:none;
+            background-color:transparent;
+        }
          /*PCR system*/
-         .table-theme-1 {
+         #notebook .table-theme-1 {
              color: rgb(49,132,155);
-            min-width: 20rem;
          }
-         .table-theme-1 caption {
+         #notebook .table-theme-1 caption {
              border-top-color: rgb(75,172,198);
              border-bottom-color: rgb(75,172,198);
          }
-         .table-theme-1 table tr:last-child td {
+         #notebook .table-theme-1 table tr:last-child td {
              border-bottom-color: rgb(75,172,198);
          }
-         .table-theme-1 tr:nth-child(odd) {
+         #notebook .table-theme-1 tr:nth-child(odd) {
              background-color: rgb(210,234,241);
-        }
-        .table-theme-1 tr:nth-child(even) {
          }
          /*PCR reaction condition*/
-         .table-theme-2 {
+         #notebook .table-theme-2 {
              color: rgb(118,146,60);
-             min-width: 21rem;
+             position:relative;
          }
-         .table-theme-2 caption {
+         #notebook .table-theme-2 caption {
              border-top-color: rgb(155, 187, 89);
              border-bottom-color: rgb(155, 187, 89);
          }
-         .table-theme-2 table tr:last-child td {
+         #notebook .table-theme-2 table tr:last-child td {
              border-bottom-color: rgb(75,172,198);
          }
-         .table-theme-2 tr:nth-child(odd) {
+         #notebook .table-theme-2 tr:nth-child(odd) {
              background-color: rgb(230,238,213);
-        }
-        .table-theme-2 tr:nth-child(even) {
          }
          /*ligation system*/
-         .table-theme-3 {
+         #notebook .table-theme-3 {
              color: rgb(95, 73, 122);
-            min-width: 23rem;
          }
-         .table-theme-3 caption {
+         #notebook .table-theme-3 caption {
              border-top-color: rgb(128, 100, 162);
              border-bottom-color: rgb(128, 100, 162);
          }
-         .table-theme-3 table tr:last-child td {
+         #notebook .table-theme-3 table tr:last-child td {
              border-bottom-color: rgb(128, 100, 162);
          }
-         .table-theme-3 tr:nth-child(odd) {
+         #notebook .table-theme-3 tr:nth-child(odd) {
              background-color: rgb(223, 215, 232);
-        }
-        .table-theme-3 tr:nth-child(even) {
          }
          /*digestion system*/
-         .table-theme-4 {
+         #notebook .table-theme-4 {
              color: rgb(148, 54, 52);
-            min-width: 23.5rem;
          }
-         .table-theme-4 caption {
+         #notebook .table-theme-4 caption {
              border-top-color: rgb(192, 80, 77);
              border-bottom-color: rgb(192, 80, 77);
          }
-         .table-theme-4 table tr:last-child td {
+         #notebook .table-theme-4 table tr:last-child td {
              border-bottom-color: rgb(192, 80, 77);
          }
-         .table-theme-4 tr:nth-child(odd) {
+         #notebook .table-theme-4 tr:nth-child(odd) {
              background-color: rgb(239, 211, 210);
-        }
-        .table-theme-4 tr:nth-child(even) {
          }
          /*methylation  system*/
-         .table-theme-5 {
+         #notebook .table-theme-5 {
              color: rgb(227, 108, 10);
-            min-width: 30rem;
          }
-         .table-theme-5 caption {
+         #notebook .table-theme-5 caption {
              border-top-color: rgb(247, 150, 70);
              border-bottom-color: rgb(247, 150, 70);
          }
-         .table-theme-5 table tr:last-child td {
+         #notebook .table-theme-5 table tr:last-child td {
              border-bottom-color: rgb(247, 150, 70);
          }
-         .table-theme-5 tr:nth-child(odd) {
+         #notebook .table-theme-5 tr:nth-child(odd) {
              background-color: rgb(253, 228, 208);
-        }
-        .table-theme-5 tr:nth-child(even) {
          }
          /*Groups divided*/
-         .table-theme-6 {
+         #notebook .table-theme-6 {
              color: rgb(0, 0, 0);
-            min-width: 48rem;
          }
-         .table-theme-6 caption {
+         #notebook .table-theme-6 caption {
              border-top-color: rgb(0, 0, 0);
              border-bottom-color: rgb(0, 0, 0);
          }
-         .table-theme-6 table tr:last-child td {
+         #notebook .table-theme-6 table tr:last-child td {
              border-bottom-color: rgb(0, 0, 0);
          }
-         .table-theme-6 tr:nth-child(odd) {
+         #notebook .table-theme-6 tr:nth-child(odd) {
              background-color: rgb(192, 192, 192);
          }
+     </style>
-        .table-theme-6 tr:nth-child(even) {
+     <script title="ready-js">
-        }
-     </style>
-     <script id="ready-js">
          $(function () {
+            adjust_figure(1.2);
              $("#accordion").accordion({
                  header: ".accordion-header",
@@ Line 212: / Line 285: @@
                  heightStyle: 'content',
                  collapsible: true,
-                 active: 0,
+                 active: 18,
                  icons: false,
              });
              $('.tabs').each(
                  function (index, value) {
                      $(value).tabs({
                          event: "mouseover",
-                         heightStyle: 'content'
+                         heightStyle: 'content',
+                        active:2,
                      });
                  }
              )
+            $('#particles-js').hide();
          });
-     </script>
+     </script>
 </head>
 <body id="dongzhuoer">
      <div style="display:none">
-         <table class="table-theme-1" id="table5-1-1">
+         <table class="table-theme-1" id="50&mu;L PCR system &times;2">
              <caption>50&mu;L PCR system &times;2</caption>
              <tr>
@@ Line 257: / Line 335: @@
              </tr>
          </table>
-         <table class="table-theme-2" id="table5-1-2">
+         <table class="table-theme-2" id="PCR reaction condition">
              <caption>PCR reaction condition</caption>
              <tr>
-                 <td>94&#8451;</td>
+                 <td>94<sup>o</sup>C</td>
                  <td>10 min</td>
                  <td></td>
              </tr>
              <tr>
-                 <td>94&#8451;</td>
+                 <td>94<sup>o</sup>C</td>
                  <td>30 sec</td>
                  <td></td>
              </tr>
              <tr>
-                 <td>58&#8451;</td>
+                 <td>58<sup>o</sup>C</td>
                  <td>15 sec</td>
                  <td>30 cycles</td>
              </tr>
              <tr>
-                 <td>72&#8451;</td>
+                 <td>72<sup>o</sup>C</td>
                  <td>30 sec</td>
                  <td></td>
              </tr>
              <tr>
-                 <td>72&#8451;</td>
+                 <td>72<sup>o</sup>C</td>
                  <td>10 min</td>
                  <td></td>
              </tr>
              <tr>
-                 <td>16&#8451;</td>
+                 <td>16<sup>o</sup>C</td>
                  <td>&infin;</td>
                  <td></td>
              </tr>
          </table>
-         <table class="table-theme-3" id="table5-2-3">
+         <table class="table-theme-3" id="20&mu;L ligation system">
              <caption>20&mu;L ligation system</caption>
              <tr>
@@ Line 317: / Line 395: @@
              </tr>
              <tr>
-                 <td colspan="2">Reaction condition: 16&#8451; overnight</td>
+                 <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
              </tr>
          </table>
-         <table class="table-theme-4" id="table5-4-1">
+         <table class="table-theme-4" id="20&mu;L digestion  system">
              <caption>20&mu;L digestion  system</caption>
              <tr>
@@ Line 343: / Line 421: @@
              </tr>
              <tr>
-                 <td colspan="2">Reaction condition: 37&#8451; for 40 min</td>
+                 <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
              </tr>
          </table>
-         <table class="table-theme-5" id="table6-4-1">
+         <table class="table-theme-5" id="100&mu;L methylation  system">
              <caption>100&mu;L methylation  system</caption>
              <tr>
@@ Line 373: / Line 451: @@
              </tr>
              <tr>
-                 <td colspan="2">Reaction condition: 37&#8451; for 1 hour</td>
+                 <td colspan="2">Reaction condition: 37<sup>o</sup>C for 1 hour</td>
              </tr>
          </table>
-         <table class="table-theme-6" id="table12-1-1">
+         <table class="table-theme-6" id="Groups divided in this experiment">
              <caption>Groups divided in this experiment</caption>
              <tr>
@@ Line 391: / Line 469: @@
              </tr>
              <tr>
-                 <td>pWH-<i>luxS</i> + xyl</td>
+                 <td>pWH-<i>luxS</i> &plus; xyl</td>
                  <td><i>luxS</i> overexpression plasmid in GR286; induced by xylose</td>
              </tr>
@@ Line 408: / Line 486: @@
          </table>
          <figure>
-             <img src="image/notebook/notebook-6-13-1.png" width="347" height="284">
+             <img src="image/Notebook/notebook-6-13-1.png" width="347" height="284">
              <figcaption>
-                 Selecting positive clones by colony PCR<br>
+                 <div class="p"><span>Selection of positive clones by colony PCR</span></div>
                  (No.1 is positive control, No.2-6 are experimental groups. The result showed that we failed to transformed the plasmid pWH-<i>C2-luxS</i> into GR286)
              </figcaption>
          </figure>
      </div>
-     <main id="notebook">
+     <div id="particles-js"></div>
-         <div class="h1">Laboratory Notes</div>
+    <script src="https://2016.igem.org/Template:NKU_China/js/particlesJS?action=raw&ctype=text/javascript"></script>
+    <div class="main" id="notebook">
+         <div class="h1">Laboratory Notes</div>
          <div id="accordion">
              <div class="accordion-fragment" id="week1">
@@ Line 423: / Line 503: @@
                  </div>
                  <div class="accordion-content">
-                    <div class="p">
-                        In order to make sure our "consumer" efficient, we should first knock out the <i>luxS</i> gene in our engineering bacteria GR286(a simplified strain of <i>Bacillus amyloliquefaciens</i> LL3). We used a markerless gene replacement method  to knock out the <i>luxS</i> gene.
-                    </div>
                      <div class="tabs" id="tabs1">
                          <ul>
-                             <li><a href="#fragment1-1">&#10112;</a></li>
+                             <li><a href="#fragment1-1">begin</a></li>
-                             <li><a href="#fragment1-2">&#10113;</a></li>
+                            <li><a class="circle-number" href="#fragment1-2">&#10112;</a></li>
-                             <li><a href="#fragment1-3">&#10114;</a></li>
+                             <li><a class="circle-number" href="#fragment1-3">&#10113;</a></li>
+                             <li><a class="circle-number" href="#fragment1-4">&#10114;</a></li>
                          </ul>
                          <div id="fragment1-1">
                              <div class="p">
-                                 Construction of targeting vector : the upstream and downstream of <i>luxS</i> gene were combined by over-lapping PCR and ligated into plasmid pKSU.
+                                 In order to make sure the efficiency of our "consumer", we should first knock out the <i>luxS</i> gene in our engineering bacteria GR286(a simplified strain of <i>Bacillus amyloliquefaciens</i> LL3). We used a markerless gene replacement method to knock out the <i>luxS</i> gene.
                              </div>
                          </div>
                          <div id="fragment1-2">
                              <div class="p">
-                                 Transformed pKSU-&Delta;<i>luxS</i> into GR286, and selected out positive clones.
+                                 Construction of targeting vector : the upstream and downstream of <i>luxS</i> gene were combined by over-lapping PCR and ligated into plasmid pKSU.
+                            </div>
+                        </div>
+                        <div id="fragment1-3">
+                            <div class="p">
+                                pKSU-&Delta;<i>luxS</i> was transformed into GR286, and positive clones were selected.
                              </div>
                              <div class="flex-container">
-                                 <table class="table-theme-1" id="table1-2-1">
+                                 <div class="table-wrapper">
-                                    <caption>20&mu;L PCR system</caption>
+                                    <table class="table-theme-1" id="table1-2-1">
-                                    <tr>
+                                        <caption>20&mu;L PCR system</caption>
-                                        <td>2&times; Taq Master Mix</td>
+                                        <tr>
-                                        <td>10&mu;L</td>
+                                            <td>2&times; Taq Master Mix</td>
-                                    </tr>
+                                            <td>10&mu;L</td>
-                                    <tr>
+                                        </tr>
-                                        <td>pKSU-F</td>
+                                        <tr>
-                                        <td>1&mu;L</td>
+                                            <td>pKSU-F</td>
-                                    </tr>
+                                            <td>1&mu;L</td>
-                                    <tr>
+                                        </tr>
-                                        <td>pKSU-R</td>
+                                        <tr>
-                                        <td>1&mu;L</td>
+                                            <td>pKSU-R</td>
-                                    </tr>
+                                            <td>1&mu;L</td>
-                                    <tr>
+                                        </tr>
-                                        <td>Bacterium solution</td>
+                                        <tr>
-                                        <td>1&mu;L</td>
+                                            <td>Bacterium solution</td>
-                                    </tr>
+                                            <td>1&mu;L</td>
-                                    <tr>
+                                        </tr>
-                                        <td>ddH2O</td>
+                                        <tr>
-                                        <td>7&mu;L</td>
+                                            <td>ddH2O</td>
-                                    </tr>
+                                            <td>7&mu;L</td>
-                                    <tr>
+                                        </tr>
-                                        <td>Total</td>
+                                        <tr>
-                                        <td>20&mu;L</td>
+                                            <td>Total</td>
-                                    </tr>
+                                            <td>20&mu;L</td>
-                                </table>
+                                        </tr>
-                                 <table class="table-theme-2" id="table1-2-2">
+                                    </table>
-                                    <caption>PCR reaction condition</caption>
+                                 </div>
-                                    <tr>
+                                <div class="table-wrapper">
-                                        <td>94&#8451;</td>
+                                    <div class="rbrace">&#125;</div>
-                                        <td>10 min</td>
+                                    <table class="table-theme-2" id="table1-2-2">
-                                        <td></td>
-                                    </tr>
+                                        <caption>PCR reaction condition</caption>
-                                    <tr>
+                                        <tr>
-                                        <td>94&#8451;</td>
+                                            <td>94<sup>o</sup>C</td>
-                                        <td>30 sec</td>
+                                            <td>10 min</td>
-                                        <td></td>
+                                            <td></td>
-                                    </tr>
+                                        </tr>
-                                    <tr>
+                                        <tr>
-                                        <td>58&#8451;</td>
+                                            <td>94<sup>o</sup>C</td>
-                                        <td>30 sec</td>
+                                            <td>30 sec</td>
-                                        <td>30 cycles</td>
+                                            <td></td>
-                                    </tr>
+                                        </tr>
-                                    <tr>
+                                        <tr>
-                                        <td>72&#8451;</td>
+                                            <td>58<sup>o</sup>C</td>
-                                        <td>1 min 30 sec</td>
+                                            <td>30 sec</td>
-                                        <td></td>
+                                            <td>30 cycles</td>
-                                    </tr>
+                                        </tr>
-                                    <tr>
+                                        <tr>
-                                        <td>72&#8451;</td>
+                                            <td>72<sup>o</sup>C</td>
-                                        <td>10 min</td>
+                                            <td>1 min 30 sec</td>
-                                        <td></td>
+                                            <td></td>
-                                    </tr>
+                                        </tr>
-                                    <tr>
+                                        <tr>
-                                        <td>16&#8451;</td>
+                                            <td>72<sup>o</sup>C</td>
-                                        <td>&infin;</td>
+                                            <td>10 min</td>
-                                        <td></td>
+                                            <td></td>
-                                    </tr>
+                                        </tr>
-                                </table>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
                                  <figure>
-                                     <img src="https://static.igem.org/mediawiki/2016/e/e9/T--NKU_China--notebook-1-5-1.png" width="330" height="291">
+                                     <img src="https://static.igem.org/mediawiki/2016/e/e9/T--NKU_China--notebook-1-5-1.png">
-                                     <figcaption>Selecting positive clones by PCR</figcaption>
+                                     <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                    </figcaption>
                                  </figure>
                              </div>
                          </div>
-                         <div id="fragment1-3">
+                         <div id="fragment1-4">
                              <div class="p">
-                                 The transformants were cultured at 42&#8451; with chloramphenicol to select single-crossover clones.
+                                 The transformants were cultured at 42<sup>o</sup>C with chloramphenicol to select single-crossover clones.
                              </div>
                              <div class="flex-container">
-                                 <table class="table-theme-1" id="table1-3-1">
+                                 <div class="table-wrapper">
-                                    <caption>20&mu;L PCR system</caption>
+                                    <table class="table-theme-1" id="table1-3-1">
-                                    <tr>
+                                        <caption>20&mu;L PCR system</caption>
-                                        <td>2&times; Taq Master Mix</td>
+                                        <tr>
-                                        <td>10&mu;L</td>
+                                            <td>2&times; Taq Master Mix</td>
-                                    </tr>
+                                            <td>10&mu;L</td>
-                                    <tr>
+                                        </tr>
-                                        <td><i>luxS</i>-up-F</td>
+                                        <tr>
-                                        <td>1&mu;L</td>
+                                            <td><i>luxS</i>-up-F</td>
-                                    </tr>
+                                            <td>1&mu;L</td>
-                                    <tr>
+                                        </tr>
-                                        <td><i>luxS</i>-dn-R</td>
+                                        <tr>
-                                        <td>1&mu;L</td>
+                                            <td><i>luxS</i>-dn-R</td>
-                                    </tr>
+                                            <td>1&mu;L</td>
-                                    <tr>
+                                        </tr>
-                                        <td>Bacterium solution</td>
+                                        <tr>
-                                        <td>1&mu;L</td>
+                                            <td>Bacterium solution</td>
-                                    </tr>
+                                            <td>1&mu;L</td>
-                                    <tr>
+                                        </tr>
-                                        <td>ddH2O</td>
+                                        <tr>
-                                        <td>7&mu;L</td>
+                                            <td>ddH2O</td>
-                                    </tr>
+                                            <td>7&mu;L</td>
-                                    <tr>
+                                        </tr>
-                                        <td>Total</td>
+                                        <tr>
-                                        <td>20&mu;L</td>
+                                            <td>Total</td>
-                                    </tr>
+                                            <td>20&mu;L</td>
-                                </table>
+                                        </tr>
-                                 <table class="table-theme-2" id="table1-3-2">
+                                    </table>
-                                    <caption>PCR reaction condition</caption>
+                                 </div>
-                                    <tr>
+                                <div class="table-wrapper">
-                                        <td>94&#8451;</td>
+                                    <div class="rbrace">&#125;</div>
-                                        <td>10 min</td>
+                                    <table class="table-theme-2" id="table1-3-2">
-                                        <td></td>
+                                        <caption>PCR reaction condition</caption>
-                                    </tr>
+                                        <tr>
-                                    <tr>
+                                            <td>94<sup>o</sup>C</td>
-                                        <td>94&#8451;</td>
+                                            <td>10 min</td>
-                                        <td>30 sec</td>
+                                            <td></td>
-                                        <td></td>
+                                        </tr>
-                                    </tr>
+                                        <tr>
-                                    <tr>
+                                            <td>94<sup>o</sup>C</td>
-                                        <td>56&#8451;</td>
+                                            <td>30 sec</td>
-                                        <td>30 sec</td>
+                                            <td></td>
-                                        <td>30 cycles</td>
+                                        </tr>
-                                    </tr>
+                                        <tr>
-                                    <tr>
+                                            <td>56<sup>o</sup>C</td>
-                                        <td>72&#8451;</td>
+                                            <td>30 sec</td>
-                                        <td>2 min</td>
+                                            <td>30 cycles</td>
-                                        <td></td>
+                                        </tr>
-                                    </tr>
+                                        <tr>
-                                    <tr>
+                                            <td>72<sup>o</sup>C</td>
-                                        <td>72&#8451;</td>
+                                            <td>2 min</td>
-                                        <td>10 min</td>
+                                            <td></td>
-                                        <td></td>
+                                        </tr>
-                                    </tr>
+                                        <tr>
-                                    <tr>
+                                            <td>72<sup>o</sup>C</td>
-                                        <td>16&#8451;</td>
+                                            <td>10 min</td>
-                                        <td>&infin;</td>
+                                            <td></td>
-                                        <td></td>
+                                        </tr>
-                                    </tr>
+                                        <tr>
-                                </table>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
                                  <figure>
-                                     <img src="https://static.igem.org/mediawiki/2016/d/de/T--NKU_China--notebook-1-5-2.jpeg" width="466" height="375">
+                                     <img src="https://static.igem.org/mediawiki/2016/d/de/T--NKU_China--notebook-1-5-2.jpeg">
                                      <figcaption>
-                                         Selecting single-crossover clones using PCR<br>
+                                         <div class="p"><span>Selection of single-crossover clones by PCR</span></div>
-                                         (No.1-4 are single-crossover strains, No.5 is positive control.)
+                                         (No.1-4 are single-crossover strains, <br>No.5 is positive control.)
                                      </figcaption>
                                  </figure>
                              </div>
                          </div>
                      </div>
@@ Line 593: / Line 688: @@
                      <div class="tabs" id="tabs2">
                          <ul>
-                             <li><a href="#fragment2-1">&#10112;</a></li>
+                             <li><a class="circle-number" href="#fragment2-1">&#10112;</a></li>
-                             <li><a href="#fragment2-2">&#10113;</a></li>
+                             <li><a class="circle-number" href="#fragment2-2">&#10113;</a></li>
                          </ul>
                          <div id="fragment2-1">
                              <div class="p">
-                                 The single-crossover strains were then cultured at LB medium and passaged every 12 hours for 4 generation.
+                                 The single-crossover strains were then cultured in LB medium and passaged every 12 hours for 4 generations.
                              </div>
                          </div>
                          <div id="fragment2-2">
                              <div class="p">
-                                 Cultured the last generation at medium with 5-fluorouracil to select double-crossover clones. Regretfully, we didn&#39;t get the double-crossover clones.
+                                 The last generation was cultured in medium with 5-fluorouracil to select double-crossover clones. Regretfully, we didn&#39;t get the double-crossover clones.
                              </div>
-                             <table class="table-theme-1" id="table2-2-1">
+                             <div class="flex-container">
-                                <caption>20&mu;L PCR system</caption>
+                                <div class="table-wrapper">
-                                <tr>
+                                    <table class="table-theme-1" id="table2-2-1">
-                                    <td>2&times; Taq Master Mix</td>
+                                        <caption>20&mu;L PCR system</caption>
-                                    <td>10&mu;L</td>
+                                        <tr>
-                                </tr>
+                                            <td>2&times; Taq Master Mix</td>
-                                <tr>
+                                            <td>10&mu;L</td>
-                                    <td><i>luxS</i>-up-F</td>
+                                        </tr>
-                                    <td>1&mu;L</td>
+                                        <tr>
-                                </tr>
+                                            <td><i>luxS</i>-up-F</td>
-                                <tr>
+                                            <td>1&mu;L</td>
-                                    <td><i>luxS</i>-dn-R</td>
+                                        </tr>
-                                    <td>1&mu;L</td>
+                                        <tr>
-                                </tr>
+                                            <td><i>luxS</i>-dn-R</td>
-                                <tr>
+                                            <td>1&mu;L</td>
-                                    <td>Bacterium solution</td>
+                                        </tr>
-                                    <td>1&mu;L</td>
+                                        <tr>
-                                </tr>
+                                            <td>Bacterium solution</td>
-                                <tr>
+                                            <td>1&mu;L</td>
-                                    <td>ddH2O</td>
+                                        </tr>
-                                    <td>7&mu;L</td>
+                                        <tr>
-                                </tr>
+                                            <td>ddH2O</td>
-                                <tr>
+                                            <td>7&mu;L</td>
-                                    <td>Total</td>
+                                        </tr>
-                                    <td>20&mu;L</td>
+                                        <tr>
-                                </tr>
+                                            <td>Total</td>
-                            </table>
+                                            <td>20&mu;L</td>
-                            <table class="table-theme-2" id="table2-2-2">
+                                        </tr>
-                                <caption>PCR reaction condition</caption>
+                                    </table>
-                                <tr>
+                                </div>
-                                    <td>94&#8451;</td>
+                                <div class="table-wrapper">
-                                    <td>10 min</td>
+                                    <div class="rbrace">&#125;</div>
-                                    <td></td>
+                                    <table class="table-theme-2" id="table2-2-2">
-                                </tr>
+                                        <caption>PCR reaction condition</caption>
-                                <tr>
+                                        <tr>
-                                    <td>94&#8451;</td>
+                                            <td>94<sup>o</sup>C</td>
-                                    <td>30 sec</td>
+                                            <td>10 min</td>
-                                    <td></td>
+                                            <td></td>
-                                </tr>
+                                        </tr>
-                                <tr>
+                                        <tr>
-                                    <td>56&#8451;</td>
+                                            <td>94<sup>o</sup>C</td>
-                                    <td>30 sec</td>
+                                            <td>30 sec</td>
-                                    <td>30 cycles</td>
+                                            <td></td>
-                                </tr>
+                                        </tr>
-                                <tr>
+                                        <tr>
-                                    <td>72&#8451;</td>
+                                            <td>56<sup>o</sup>C</td>
-                                    <td>2 min</td>
+                                            <td>30 sec</td>
-                                    <td></td>
+                                            <td>30 cycles</td>
-                                </tr>
+                                        </tr>
-                                <tr>
+                                        <tr>
-                                    <td>72&#8451;</td>
+                                            <td>72<sup>o</sup>C</td>
-                                    <td>10 min</td>
+                                            <td>2 min</td>
-                                    <td></td>
+                                            <td></td>
-                                </tr>
+                                        </tr>
-                                <tr>
+                                        <tr>
-                                    <td>16&#8451;</td>
+                                            <td>72<sup>o</sup>C</td>
-                                    <td>&infin;</td>
+                                            <td>10 min</td>
-                                    <td></td>
+                                            <td></td>
-                                </tr>
+                                        </tr>
-                            </table>
+                                        <tr>
-                            <figure>
+                                            <td>16<sup>o</sup>C</td>
-                                 <img src="https://static.igem.org/mediawiki/2016/3/3d/T--NKU_China--notebook-1-5-3.png" width="341" height="292">
+                                            <td>&infin;</td>
-                                <figcaption>
+                                            <td></td>
-                                    Selecting double-crossover clones using PCR<br>
+                                        </tr>
-                                    (No.1-5 are experimental groups, No.6 is wild GR286.<br>
+                                    </table>
-                                    The result showed that we failed to get the double-crossover clones.)
+                                </div>
-                                </figcaption>
+                                 <figure>
-                            </figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/3/3d/T--NKU_China--notebook-1-5-3.png">
-                         </div>
+                                    <figcaption>
+                                        <div class="p"><span>Selection of double-crossover clones by PCR</span></div>
+                                        (No.1-5 are experimental groups, No.6 is wild GR286. The result showed that we failed to get the double-crossover clones.)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                         </div>
                      </div>
                  </div>
@@ Line 684: / Line 785: @@
                      <div class="tabs" id="tabs3">
                          <ul>
-                             <li><a href="#fragment3-1">&#10112;</a></li>
+                             <li><a class="circle-number" href="#fragment3-1">&#10112;</a></li>
-                             <li><a href="#fragment3-2">&#10113;</a></li>
+                             <li><a class="circle-number" href="#fragment3-2">&#10113;</a></li>
-                             <li><a href="#fragment3-3">&#10114;</a></li>
+                             <li><a class="circle-number" href="#fragment3-3">&#10114;</a></li>
                          </ul>
                          <div id="fragment3-1">
                              <div class="p">
-                                 We cultured transformants at 42&#8451; with chloramphenicol again and selected the  single-crossover clones successfully.
+                                 Transformants were cultured at 42<sup>o</sup>C with chloramphenicol again and the single-crossover clones were selected successfully.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table3-1-1">
+                                        <caption>20&mu;L PCR system</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-up-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-dn-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table3-1-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>56<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/9/93/T--NKU_China--notebook-1-5-4.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of single-crossover clones by PCR</span></div>
+                                        (No.1&amp;2&amp;4 are single-crossover strains,No.5 is positive control. )
+                                    </figcaption>
+                                </figure>
                              </div>
-                            <table class="table-theme-1" id="table3-1-1">
-                                <caption>20&mu;L PCR system</caption>
-                                <tr>
-                                    <td>2&times; Taq Master Mix</td>
-                                    <td>10&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td><i>luxS</i>-up-F</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td><i>luxS</i>-dn-R</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Bacterium solution</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>ddH2O</td>
-                                    <td>7&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Total</td>
-                                    <td>20&mu;L</td>
-                                </tr>
-                            </table>
-                            <table class="table-theme-2" id="table3-1-2">
-                                <caption>PCR reaction condition</caption>
-                                <tr>
-                                    <td>94&#8451;</td>
-                                    <td>10 min</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>94&#8451;</td>
-                                    <td>30 sec</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>56&#8451;</td>
-                                    <td>30 sec</td>
-                                    <td>30 cycles</td>
-                                </tr>
-                                <tr>
-                                    <td>72&#8451;</td>
-                                    <td>2 min</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>72&#8451;</td>
-                                    <td>10 min</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>16&#8451;</td>
-                                    <td>&infin;</td>
-                                    <td></td>
-                                </tr>
-                            </table>
-                            <figure>
-                                <img src="https://static.igem.org/mediawiki/2016/9/93/T--NKU_China--notebook-1-5-4.png" width="350" height="292">
-                                <figcaption>
-                                    Selecting single-crossover clones using PCR<br>
-                                    (No.1&amp;2&amp;4 are single-crossover strains,No.5 is positive control. )
-                                </figcaption>
-                            </figure>
                          </div>
                          <div id="fragment3-2">
                              <div class="p">
-                                 The single-crossover strains were then cultured at LB medium and passaged every 12 hours for 4 generations.
+                                 The single-crossover strains were then cultured in LB medium and passaged every 12 hours for 4 generations.
                              </div>
                          </div>
                          <div id="fragment3-3">
                              <div class="p">
-                                 Cultured the last generation at medium with 5-fluorouracil to select double-crossover clones. We finally got our aimed strain&#8212;GR286&Delta;<i>luxS</i>.
+                                 The last generation was cultured in medium with 5-fluorouracil to select double-crossover clones. We finally obtained our aimed strain&#8212;GR286&Delta;<i>luxS</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table3-3-1">
+                                        <caption>20&mu;L PCR system</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-up-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-dn-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table3-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>56<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/a/aa/T--NKU_China--notebook-1-5-5.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of &Delta;<i>luxS</i> clones by PCR</span></div>
+                                        (The No.4 is the aimed strain&horbar;GR286&Delta;<i>luxS</i>)
+                                    </figcaption>
+                                </figure>
                              </div>
-                            <table class="table-theme-1" id="table3-3-1">
-                                <caption>20&mu;L PCR system</caption>
-                                <tr>
-                                    <td>2&times; Taq Master Mix</td>
-                                    <td>10&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td><i>luxS</i>-up-F</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td><i>luxS</i>-dn-R</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Bacterium solution</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>ddH2O</td>
-                                    <td>7&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Total</td>
-                                    <td>20&mu;L</td>
-                                </tr>
-                            </table>
-                            <table class="table-theme-2" id="table3-3-2">
-                                <caption>PCR reaction condition</caption>
-                                <tr>
-                                    <td>94&#8451;</td>
-                                    <td>10 min</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>94&#8451;</td>
-                                    <td>30 sec</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>56&#8451;</td>
-                                    <td>30 sec</td>
-                                    <td>30 cycles</td>
-                                </tr>
-                                <tr>
-                                    <td>72&#8451;</td>
-                                    <td>2 min</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>72&#8451;</td>
-                                    <td>10 min</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>16&#8451;</td>
-                                    <td>&infin;</td>
-                                    <td></td>
-                                </tr>
-                            </table>
-                            <figure>
-                                <img src="https://static.igem.org/mediawiki/2016/a/aa/T--NKU_China--notebook-1-5-5.png" width="254" height="209">
-                                <figcaption>
-                                    Selecting the strain lacking of <i>luxS</i> gene using PCR<br>
-                                    (The No.4 is the aimed strain<U+00A1><U+00AA>GR286&Delta;<i>luxS</i>)
-                                </figcaption>
-                            </figure>
                          </div>
                      </div>
@@ Line 847: / Line 962: @@
                      <div class="tabs" id="tabs4">
                          <ul>
-                             <li><a href="#fragment4-1">&#10112;</a></li>
+                             <li><a class="circle-number" href="#fragment4-1">&#10112;</a></li>
-                             <li><a href="#fragment4-2">&#10113;</a></li>
+                             <li><a class="circle-number" href="#fragment4-2">&#10113;</a></li>
-                             <li><a href="#fragment4-3">&#10114;</a></li>
+                             <li><a class="circle-number" href="#fragment4-3">&#10114;</a></li>
-                             <li><a href="#fragment4-4">&#10115;</a></li>
+                             <li><a class="circle-number" href="#fragment4-4">&#10115;</a></li>
-                             <li><a href="#fragment4-5">&#10116;</a></li>
+                             <li><a class="circle-number" href="#fragment4-5">&#10116;</a></li>
-                             <li><a href="#fragment4-6">&#10117;</a></li>
+                             <li><a class="circle-number" href="#fragment4-6">&#10117;</a></li>
                          </ul>
                          <div id="fragment4-1">
                              <div class="p">
-                                 Cultured the GR286&Delta;<i>luxS</i> strain and made it competence for future use.
+                                 The GR286&Delta;<i>luxS</i> strain was cultured and made competent for future use.
                              </div>
                          </div>
                          <div id="fragment4-2">
                              <div class="p">
-                                 Cloned the <i>lsrACDB</i> gene from <i>Bacillus thuringiensis</i> and ligated it to T-vector.
+                                 The <i>lsrACDB</i> gene from <i>Bacillus thuringiensis</i> was cloned and ligated to T-vector.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table4-2-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i>-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i>-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table4-2-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>57<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>4 min 30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table4-2-3">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pMD19 T-Simple Vector</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
                              </div>
-                            <table class="table-theme-1" id="table4-2-1">
-                                <caption>50&mu;L PCR system &times;2</caption>
-                                <tr>
-                                    <td>2&times; Taq Master Mix</td>
-                                    <td>25&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td><i>lsrACDB</i>-F</td>
-                                    <td>2&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td><i>lsrACDB</i>-R</td>
-                                    <td>2&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Bacterium solution</td>
-                                    <td>2&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>ddH2O</td>
-                                    <td>19&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Total</td>
-                                    <td>50&mu;L</td>
-                                </tr>
-                            </table>
-                            <table class="table-theme-2" id="table4-2-2">
-                                <caption>PCR reaction condition</caption>
-                                <tr>
-                                    <td>94&#8451;</td>
-                                    <td>10 min</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>94&#8451;</td>
-                                    <td>30 sec</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>57&#8451;</td>
-                                    <td>30 sec</td>
-                                    <td>30 cycles</td>
-                                </tr>
-                                <tr>
-                                    <td>72&#8451;</td>
-                                    <td>4 min 30 sec</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>72&#8451;</td>
-                                    <td>10 min</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>16&#8451;</td>
-                                    <td>&infin;</td>
-                                    <td></td>
-                                </tr>
-                            </table>
-                            <table class="table-theme-3" id="table4-2-3">
-                                <caption>20&mu;L ligation system</caption>
-                                <tr>
-                                    <td>10&times; DNA Ligase Buffer</td>
-                                    <td>2&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>T4 DNA Ligase</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>pMD19 T-Simple Vector</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td><i>lsrACDB</i></td>
-                                    <td>3&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>ddH2O</td>
-                                    <td>13&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Total</td>
-                                    <td>20&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td colspan="2">Reaction condition: 16&#8451; overnight</td>
-                                </tr>
-                            </table>
                          </div>
                          <div id="fragment4-3">
                              <div class="p">
-                                 Transformed the T-<i>lsrACDB</i> into DH5&alpha; and coated plate, and then selected positive clones by colony PCR.
+                                 The T-<i>lsrACDB</i> was transformed into DH5&alpha; and plate was coated, and then positive clones were selected.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table4-3-1">
+                                        <caption>20&mu;L PCR system</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>M13F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>M13R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table4-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>59<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>4 min 30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/7/72/T--NKU_China--notebook-1-5-6.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                        (No. 3&amp;4 are positive results)
+                                    </figcaption>
+                                </figure>
                              </div>
-                            <table class="table-theme-1" id="table4-3-1">
-                                <caption>20&mu;L PCR system</caption>
-                                <tr>
-                                    <td>2&times; Taq Master Mix</td>
-                                    <td>10&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>M13F</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>M13R</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Bacterium solution</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>ddH2O</td>
-                                    <td>7&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Total</td>
-                                    <td>20&mu;L</td>
-                                </tr>
-                            </table>
-                            <table class="table-theme-2" id="table4-3-2">
-                                <caption>PCR reaction condition</caption>
-                                <tr>
-                                    <td>94&#8451;</td>
-                                    <td>10 min</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>94&#8451;</td>
-                                    <td>30 sec</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>59&#8451;</td>
-                                    <td>30 sec</td>
-                                    <td>30 cycles</td>
-                                </tr>
-                                <tr>
-                                    <td>72&#8451;</td>
-                                    <td>4 min 30 sec</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>72&#8451;</td>
-                                    <td>10 min</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>16&#8451;</td>
-                                    <td>&infin;</td>
-                                    <td></td>
-                                </tr>
-                            </table>
-                            <figure>
-                                <img src="https://static.igem.org/mediawiki/2016/7/72/T--NKU_China--notebook-1-5-6.png" width="215" height="180">
-                                <figcaption>
-                                    Selecting positive clones by PCR<br>
-                                    (No. 3&amp;4 are positive results)
-                                </figcaption>
-                            </figure>
                          </div>
                          <div id="fragment4-4">
                              <div class="p">
-                                 After restriction enzyme digestion verification, we sent them to sequencing. Unfortunately, the sequencing result showed some mutations in cloning gene.
+                                 After restriction enzyme digestion verification, the positive clones were then sequenced. Unfortunately, the sequencing result showed some mutations inside the target gene.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table4-4-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T-<i>lsrACDB</i></td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/9/91/T--NKU_China--notebook-1-5-7.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                        (No.1 are <i>lsrACDB</i> fragement, No.2 are linearized T-vector.)
+                                    </figcaption>
+                                </figure>
                              </div>
-                            <table class="table-theme-4" id="table4-4-1">
-                                <caption>20&mu;L digestion  system</caption>
-                                <tr>
-                                    <td>10&times; FastDigest Buffer</td>
-                                    <td>2&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>BamH &#8544;</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>T-<i>lsrACDB</i></td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>ddH2O</td>
-                                    <td>7&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Total</td>
-                                    <td>20&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td colspan="2">Reaction condition: 37&#8451; for 40 min</td>
-                                </tr>
-                            </table>
-                            <figure>
-                                <img src="https://static.igem.org/mediawiki/2016/9/91/T--NKU_China--notebook-1-5-7.png" width="201" height="322">
-                                <figcaption>
-                                    Restriction enzyme digestion verification<br>
-                                    (No.1 are <i>lsrACDB</i> fragement, No.2 are linearized T-vector.)
-                                </figcaption>
-                            </figure>
                          </div>
                          <div id="fragment4-5">
                              <div class="p">
-                                 We repeated the process of gene cloning but there were still some mutations.
+                                 The gene cloning process was repeated but there were still some mutations.
                              </div>
                          </div>
@@ Line 1,075: / Line 1,210: @@
                          </div>
                      </div>
                  </div>
              </div>
              <div class="accordion-fragment" id="week5">
@@ Line 1,082: / Line 1,217: @@
                  </div>
                  <div class="accordion-content">
-                    <div class="p">
-                        This week, we started to construct another controller&#8213;supplier.
-                    </div>
                      <div class="tabs" id="tabs5">
                          <ul>
-                             <li><a href="#fragment5-1">&#10112;</a></li>
+                             <li><a href="#fragment5-1">begin</a></li>
-                             <li><a href="#fragment5-2">&#10113;</a></li>
+                            <li><a class="circle-number" href="#fragment5-2">&#10112;</a></li>
-                             <li><a href="#fragment5-3">&#10114;</a></li>
+                             <li><a class="circle-number" href="#fragment5-3">&#10113;</a></li>
-                             <li><a href="#fragment5-4">&#10115;</a></li>
+                             <li><a class="circle-number" href="#fragment5-4">&#10114;</a></li>
+                             <li><a class="circle-number" href="#fragment5-5">&#10115;</a></li>
                          </ul>
                          <div id="fragment5-1">
                              <div class="p">
-                                 We cloned a strong promoter <i>C2</i> from former kit and cloned <i>luxS</i> gene from GR286.
+                                 This week, we started to construct another controller&#8213;supplier.
                              </div>
-                            <table class="table-theme-1" id="table5-1-1">
-                                <caption>50&mu;L PCR system &times;2</caption>
-                                <tr>
-                                    <td>2&times; Taq Master Mix</td>
-                                    <td>25&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>C2-F</td>
-                                    <td>2&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>C2-R</td>
-                                    <td>2&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>p-C2</td>
-                                    <td>2&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>ddH2O</td>
-                                    <td>19&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Total</td>
-                                    <td>50&mu;L</td>
-                                </tr>
-                            </table>
-                            <table class="table-theme-2" id="table5-1-2">
-                                <caption>PCR reaction condition</caption>
-                                <tr>
-                                    <td>94&#8451;</td>
-                                    <td>10 min</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>94&#8451;</td>
-                                    <td>30 sec</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>58&#8451;</td>
-                                    <td>15 sec</td>
-                                    <td>30 cycles</td>
-                                </tr>
-                                <tr>
-                                    <td>72&#8451;</td>
-                                    <td>30 sec</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>72&#8451;</td>
-                                    <td>10 min</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>16&#8451;</td>
-                                    <td>&infin;</td>
-                                    <td></td>
-                                </tr>
-                            </table>
-                            <table class="table-theme-1" id="table5-1-3">
-                                <caption>50&mu;L PCR system &times;2</caption>
-                                <tr>
-                                    <td>2&times; Taq Master Mix</td>
-                                    <td>25&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td><i>luxS</i>-F</td>
-                                    <td>2&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td><i>luxS</i>-R</td>
-                                    <td>2&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Bacterium solution</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>GR286</td>
-                                    <td>2&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>ddH2O</td>
-                                    <td>19&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Total</td>
-                                    <td>50&mu;L</td>
-                                </tr>
-                            </table>
-                            <table class="table-theme-2" id="table5-1-4">
-                                <caption>PCR reaction condition</caption>
-                                <tr>
-                                    <td>94&#8451;</td>
-                                    <td>10 min</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>94&#8451;</td>
-                                    <td>30 sec</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>59&#8451;</td>
-                                    <td>30 sec</td>
-                                    <td>30 cycles</td>
-                                </tr>
-                                <tr>
-                                    <td>72&#8451;</td>
-                                    <td>30 sec</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>72&#8451;</td>
-                                    <td>10 min</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>16&#8451;</td>
-                                    <td>&infin;</td>
-                                    <td></td>
-                                </tr>
-                            </table>
-                            <figure>
-                                <img src="https://static.igem.org/mediawiki/2016/d/dc/T--NKU_China--notebook-1-5-8.png" width="201" height="322">
-                                <figcaption>
-                                    Cloning promoter <i>C2</i> and <i>luxS</i> using PCR<br>
-                                    (NO.1&amp;2 are <i>C2</i>, No.3&amp;4 are <i>luxS</i>)
-                                </figcaption>
-                            </figure>
                          </div>
-                        <div id="fragment5-2">
+                            <div id="fragment5-2">
-                            <div class="p">
+                                <div class="p">
-                                 Fuse the two segments together by fusion PCR, and ligated it into T-vector. Then, transformed the vector into DH5&alpha;.
+                                    A strong promoter <i>C2</i> was cloned from former kit and <i>luxS</i> gene was cloned from GR286.
+                                 </div>
+                                <div class="flex-container">
+                                    <div class="table-wrapper">
+                                        <table class="table-theme-1" id="table5-1-1">
+                                            <caption>50&mu;L PCR system &times;2</caption>
+                                            <tr>
+                                                <td>2&times; Taq Master Mix</td>
+                                                <td>25&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>C2-F</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>C2-R</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>p-C2</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>ddH2O</td>
+                                                <td>19&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Total</td>
+                                                <td>50&mu;L</td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                    <div class="table-wrapper">
+                                        <div class="rbrace">&#125;</div>
+                                        <table class="table-theme-2" id="table5-1-2">
+                                            <caption>PCR reaction condition</caption>
+                                            <tr>
+                                                <td>94<sup>o</sup>C</td>
+                                                <td>10 min</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>94<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>58<sup>o</sup>C</td>
+                                                <td>15 sec</td>
+                                                <td>30 cycles</td>
+                                            </tr>
+                                            <tr>
+                                                <td>72<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>72<sup>o</sup>C</td>
+                                                <td>10 min</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>16<sup>o</sup>C</td>
+                                                <td>&infin;</td>
+                                                <td></td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                    <div class="table-wrapper">
+                                        <table class="table-theme-1" id="table5-1-3">
+                                            <caption>50&mu;L PCR system &times;2</caption>
+                                            <tr>
+                                                <td>2&times; Taq Master Mix</td>
+                                                <td>25&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td><i>luxS</i>-F</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td><i>luxS</i>-R</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Bacterium solution</td>
+                                                <td>1&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>GR286</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>ddH2O</td>
+                                                <td>19&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Total</td>
+                                                <td>50&mu;L</td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                    <div class="table-wrapper">
+                                        <div class="rbrace">&#125;</div>
+                                        <table class="table-theme-2" id="table5-1-4">
+                                            <caption>PCR reaction condition</caption>
+                                            <tr>
+                                                <td>94<sup>o</sup>C</td>
+                                                <td>10 min</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>94<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>59<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td>30 cycles</td>
+                                            </tr>
+                                            <tr>
+                                                <td>72<sup>o</sup>C</td>
+                                                <td>30 sec</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>72<sup>o</sup>C</td>
+                                                <td>10 min</td>
+                                                <td></td>
+                                            </tr>
+                                            <tr>
+                                                <td>16<sup>o</sup>C</td>
+                                                <td>&infin;</td>
+                                                <td></td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                    <figure>
+                                        <img src="https://static.igem.org/mediawiki/2016/d/dc/T--NKU_China--notebook-1-5-8.png">
+                                        <figcaption>
+                                            <div class="p"><span>PCR cloning product of promoter <i>C2</i> and gene <i>luxS</i></span></div>
+                                            (NO.1&amp;2 are <i>C2</i>, No.3&amp;4 are <i>luxS</i>)
+                                        </figcaption>
+                                    </figure>
+                                </div>
                              </div>
-                             <table class="table-theme-1" id="table5-2-1">
+                             <div id="fragment5-3">
-                                <caption>50&mu;L PCR system &times;2</caption>
+                                <div class="p">
-                                <tr>
+                                    Two segments were fused together by fusion PCR and ligated into T-vector. After that, the vector was transformed into DH5&alpha;.
-                                    <td>2&times; Taq Master Mix</td>
+                                </div>
-                                    <td>25&mu;L</td>
+                                <div class="flex-container">
-                                </tr>
+                                    <div class="table-wrapper">
-                                <tr>
+                                        <table class="table-theme-1" id="table5-2-1">
-                                    <td>C2-F</td>
+                                            <caption>50&mu;L PCR system &times;2</caption>
-                                    <td>2&mu;L</td>
+                                            <tr>
-                                </tr>
+                                                <td>2&times; Taq Master Mix</td>
-                                <tr>
+                                                <td>25&mu;L</td>
-                                    <td><i>luxS</i>-R</td>
+                                            </tr>
-                                    <td>2&mu;L</td>
+                                            <tr>
-                                </tr>
+                                                <td>C2-F</td>
-                                <tr>
+                                                <td>2&mu;L</td>
-                                    <td>C2</td>
+                                            </tr>
-                                    <td>2&mu;L</td>
+                                            <tr>
-                                </tr>
+                                                <td><i>luxS</i>-R</td>
-                                <tr>
+                                                <td>2&mu;L</td>
-                                    <td><i>luxS</i></td>
+                                            </tr>
-                                    <td>2&mu;L</td>
+                                            <tr>
-                                </tr>
+                                                <td>C2</td>
-                                <tr>
+                                                <td>2&mu;L</td>
-                                    <td>ddH2O</td>
+                                            </tr>
-                                    <td>17&mu;L</td>
+                                            <tr>
-                                </tr>
+                                                <td><i>luxS</i></td>
-                                <tr>
+                                                <td>2&mu;L</td>
-                                    <td>Total</td>
+                                            </tr>
-                                    <td>50&mu;L</td>
+                                            <tr>
-                                </tr>
+                                                <td>ddH2O</td>
-                            </table>
+                                                <td>17&mu;L</td>
-                            <table class="table-theme-2" id="table5-2-2">
+                                            </tr>
-                                <caption>PCR reaction condition</caption>
+                                            <tr>
-                                <tr>
+                                                <td>Total</td>
-                                    <td>94&#8451;</td>
+                                                <td>50&mu;L</td>
-                                    <td>10 min</td>
+                                            </tr>
-                                    <td></td>
+                                        </table>
-                                </tr>
+                                    </div>
-                                <tr>
+                                    <div class="table-wrapper">
-                                    <td>94&#8451;</td>
+                                        <div class="rbrace">&#125;</div>
-                                    <td>30 sec</td>
+                                        <table class="table-theme-2" id="table5-2-2">
-                                    <td></td>
+                                            <caption>PCR reaction condition</caption>
-                                </tr>
+                                            <tr>
-                                <tr>
+                                                <td>94<sup>o</sup>C</td>
-                                    <td>59&#8451;</td>
+                                                <td>10 min</td>
-                                    <td>30 sec</td>
+                                                <td></td>
-                                    <td>30 cycles</td>
+                                            </tr>
-                                </tr>
+                                            <tr>
-                                <tr>
+                                                <td>94<sup>o</sup>C</td>
-                                    <td>72&#8451;</td>
+                                                <td>30 sec</td>
-                                    <td>40 sec</td>
+                                                <td></td>
-                                    <td></td>
+                                            </tr>
-                                </tr>
+                                            <tr>
-                                <tr>
+                                                <td>59<sup>o</sup>C</td>
-                                    <td>72&#8451;</td>
+                                                <td>30 sec</td>
-                                    <td>10 min</td>
+                                                <td>30 cycles</td>
-                                    <td></td>
+                                            </tr>
-                                </tr>
+                                            <tr>
-                                <tr>
+                                                <td>72<sup>o</sup>C</td>
-                                    <td>16&#8451;</td>
+                                                <td>40 sec</td>
-                                    <td>&infin;</td>
+                                                <td></td>
-                                    <td></td>
+                                            </tr>
-                                </tr>
+                                            <tr>
-                            </table>
+                                                <td>72<sup>o</sup>C</td>
-                            <table class="table-theme-3" id="table5-2-3">
+                                                <td>10 min</td>
-                                <caption>20&mu;L ligation system</caption>
+                                                <td></td>
-                                <tr>
+                                            </tr>
-                                    <td>10&times; DNA Ligase Buffer</td>
+                                            <tr>
-                                    <td>2&mu;L</td>
+                                                <td>16<sup>o</sup>C</td>
-                                </tr>
+                                                <td>&infin;</td>
-                                <tr>
+                                                <td></td>
-                                    <td>T4 DNA Ligase</td>
+                                            </tr>
-                                    <td>1&mu;L</td>
+                                        </table>
-                                </tr>
+                                    </div>
-                                <tr>
+                                    <div class="table-wrapper">
-                                    <td>pMD19 T-Simple Vector</td>
+                                        <table class="table-theme-3" id="table5-2-3">
-                                    <td>1&mu;L</td>
+                                            <caption>20&mu;L ligation system</caption>
-                                </tr>
+                                            <tr>
-                                <tr>
+                                                <td>10&times; DNA Ligase Buffer</td>
-                                    <td><i>C2-luxS</i></td>
+                                                <td>2&mu;L</td>
-                                    <td>4&mu;L</td>
+                                            </tr>
-                                </tr>
+                                            <tr>
-                                <tr>
+                                                <td>T4 DNA Ligase</td>
-                                    <td>ddH2O</td>
+                                                <td>1&mu;L</td>
-                                    <td>12&mu;L</td>
+                                            </tr>
-                                </tr>
+                                            <tr>
-                                <tr>
+                                                <td>pMD19 T-Simple Vector</td>
-                                    <td>Total</td>
+                                                <td>1&mu;L</td>
-                                    <td>20&mu;L</td>
+                                            </tr>
-                                </tr>
+                                            <tr>
-                                <tr>
+                                                <td><i>C2-luxS</i></td>
-                                    <td colspan="2">Reaction condition: 16&#8451; overnight</td>
+                                                <td>4&mu;L</td>
-                                </tr>
+                                            </tr>
-                            </table>
+                                            <tr>
-                        </div>
+                                                <td>ddH2O</td>
-                        <div id="fragment5-3">
+                                                <td>12&mu;L</td>
-                            <div class="p">
+                                            </tr>
-                                Selected the positive clones by colony PCR.
+                                            <tr>
+                                                <td>Total</td>
+                                                <td>20&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                </div>
                              </div>
-                             <table class="table-theme-1" id="table5-3-1">
+                             <div id="fragment5-4">
-                                <caption>20&mu;L PCR system</caption>
+                                <div class="p">
-                                <tr>
+                                    Positive clones were selected by colony PCR.
-                                    <td>2&times; Taq Master Mix</td>
+                                </div>
-                                    <td>10&mu;L</td>
+                                <div class="flex-container">
-                                </tr>
+                                    <div class="table-wrapper">
-                                <tr>
+                                        <table class="table-theme-1" id="table5-3-1">
-                                    <td>M13-F</td>
+                                            <caption>20&mu;L PCR system</caption>
-                                    <td>1&mu;L</td>
+                                            <tr>
-                                </tr>
+                                                <td>2&times; Taq Master Mix</td>
-                                <tr>
+                                                <td>10&mu;L</td>
-                                    <td>M13-R</td>
+                                            </tr>
-                                    <td>1&mu;L</td>
+                                            <tr>
-                                </tr>
+                                                <td>M13-F</td>
-                                <tr>
+                                                <td>1&mu;L</td>
-                                    <td>Bacterium solution</td>
+                                            </tr>
-                                    <td>1&mu;L</td>
+                                            <tr>
-                                </tr>
+                                                <td>M13-R</td>
-                                <tr>
+                                                <td>1&mu;L</td>
-                                    <td>ddH2O</td>
+                                            </tr>
-                                    <td>7&mu;L</td>
+                                            <tr>
-                                </tr>
+                                                <td>Bacterium solution</td>
-                                <tr>
+                                                <td>1&mu;L</td>
-                                    <td>Total</td>
+                                            </tr>
-                                    <td>20&mu;L</td>
+                                            <tr>
-                                </tr>
+                                                <td>ddH2O</td>
-                            </table>
+                                                <td>7&mu;L</td>
-                            <table class="table-theme-2" id="table5-3-2">
+                                            </tr>
-                                <caption>PCR reaction condition</caption>
+                                            <tr>
-                                <tr>
+                                                <td>Total</td>
-                                    <td>94&#8451;</td>
+                                                <td>20&mu;L</td>
-                                    <td>10 min</td>
+                                            </tr>
-                                    <td></td>
+                                        </table>
-                                </tr>
+                                    </div>
-                                <tr>
+                                    <div class="table-wrapper">
-                                    <td>94&#8451;</td>
+                                        <div class="rbrace">&#125;</div>
-                                    <td>30 sec</td>
+                                        <table class="table-theme-2" id="table5-3-2">
-                                    <td></td>
+                                            <caption>PCR reaction condition</caption>
-                                </tr>
+                                            <tr>
-                                <tr>
+                                                <td>94<sup>o</sup>C</td>
-                                    <td>59&#8451;</td>
+                                                <td>10 min</td>
-                                    <td>30 sec</td>
+                                                <td></td>
-                                    <td>30 cycles</td>
+                                            </tr>
-                                </tr>
+                                            <tr>
-                                <tr>
+                                                <td>94<sup>o</sup>C</td>
-                                    <td>72&#8451;</td>
+                                                <td>30 sec</td>
-                                    <td>40 sec</td>
+                                                <td></td>
-                                    <td></td>
+                                            </tr>
-                                </tr>
+                                            <tr>
-                                <tr>
+                                                <td>59<sup>o</sup>C</td>
-                                    <td>72&#8451;</td>
+                                                <td>30 sec</td>
-                                    <td>10 min</td>
+                                                <td>30 cycles</td>
-                                    <td></td>
+                                            </tr>
-                                </tr>
+                                            <tr>
-                                <tr>
+                                                <td>72<sup>o</sup>C</td>
-                                    <td>16&#8451;</td>
+                                                <td>40 sec</td>
-                                    <td>&infin;</td>
+                                                <td></td>
-                                    <td></td>
+                                            </tr>
-                                </tr>
+                                            <tr>
-                            </table>
+                                                <td>72<sup>o</sup>C</td>
-                            <figure>
+                                                <td>10 min</td>
-                                <img src="https://static.igem.org/mediawiki/2016/c/c9/T--NKU_China--notebook-1-5-9.png" width="308" height="303">
+                                                <td></td>
-                                <figcaption>
+                                            </tr>
-                                    Selecting positive clones by colony PCR
+                                            <tr>
-                                </figcaption>
+                                                <td>16<sup>o</sup>C</td>
-                            </figure>
+                                                <td>&infin;</td>
-                        </div>
+                                                <td></td>
-                        <div id="fragment5-4">
+                                            </tr>
-                            <div class="p">
+                                        </table>
-                                We chose 4 positive strains to culture overnight and extracted the plasmid. After restriction enzyme digestion verification, we sent them to sequencing.
+                                    </div>
+                                    <figure>
+                                        <img src="https://static.igem.org/mediawiki/2016/c/c9/T--NKU_China--notebook-1-5-9.png">
+                                        <figcaption>
+                                            <div class="p"><span>PCR cloning product of promoter <i>C2</i> and gene <i>luxS</i></span></div>
+                                        </figcaption>
+                                    </figure>
+                                </div>
+                            </div>
+                            <div id="fragment5-5">
+                                <div class="p">
+positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                                </div>
+                                <div class="flex-container">
+                                    <div class="table-wrapper">
+                                        <table class="table-theme-4" id="table5-4-1">
+                                            <caption>20&mu;L digestion  system</caption>
+                                            <tr>
+                                                <td>10&times; FastDigest Buffer</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>BamH &#8544;</td>
+                                                <td>1&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>T-<i>lsrACDB</i></td>
+                                                <td>1&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>ddH2O</td>
+                                                <td>7&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Total</td>
+                                                <td>20&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                    <figure>
+                                        <img src="https://static.igem.org/mediawiki/2016/f/fb/T--NKU_China--notebook-1-5-10.png">
+                                        <figcaption>
+                                            <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                            (No.1 are linearized T-vector, No.2 are <i>C2-luxS</i> fragment.)
+                                        </figcaption>
+                                    </figure>
+                                </div>
                              </div>
-                            <table class="table-theme-4" id="table5-4-1">
-                                <caption>20&mu;L digestion  system</caption>
-                                <tr>
-                                    <td>10&times; FastDigest Buffer</td>
-                                    <td>2&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>BamH &#8544;</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>T-<i>lsrACDB</i></td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>ddH2O</td>
-                                    <td>7&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Total</td>
-                                    <td>20&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td colspan="2">Reaction condition: 37&#8451; for 40 min</td>
-                                </tr>
-                            </table>
-                            <figure>
-                                <img src="https://static.igem.org/mediawiki/2016/f/fb/T--NKU_China--notebook-1-5-10.png" width="317" height="202">
-                                <figcaption>
-                                    Restriction enzyme digestion verification<br>
-                                    (No.1 are linearized T-vector, No.2 are <i>C2-luxS</i> fragment.)
-                                </figcaption>
-                            </figure>
                          </div>
-                    </div>
                  </div>
              </div>
@@ Line 1,446: / Line 1,616: @@
                      <div class="tabs" id="tabs6">
                          <ul>
-                             <li><a href="#fragment6-1">&#10112;</a></li>
+                             <li><a class="circle-number" href="#fragment6-1">&#10112;</a></li>
-                             <li><a href="#fragment6-2">&#10113;</a></li>
+                             <li><a class="circle-number" href="#fragment6-2">&#10113;</a></li>
-                             <li><a href="#fragment6-3">&#10114;</a></li>
+                             <li><a class="circle-number" href="#fragment6-3">&#10114;</a></li>
-                             <li><a href="#fragment6-4">&#10115;</a></li>
+                             <li><a class="circle-number" href="#fragment6-4">&#10115;</a></li>
-                             <li><a href="#fragment6-5">&#10116;</a></li>
+                             <li><a class="circle-number" href="#fragment6-5">&#10116;</a></li>
                          </ul>
                          <div id="fragment6-1">
                              <div class="p">
-                                 The sequencing result showed there&#39;s a correct strain. So we can use the strain for the following experiment. We obtained the correct plasmid T-<i>C2-luxS</i> from DH5&alpha;. Then we got the fragment <i>C2-luxS</i> by digestion and gel extraction.
+                                 The sequencing result showed that there was a correct strain and thus it could be used for the following experiments. We obtained the correct plasmid T-<i>C2-luxS</i> from DH5&alpha;. Then the fragment <i>C2-luxS</i> was obtained by digestion and gel extraction.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table6-1-1">
+                                        <caption>40&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T-<i>C2-luxS</i></td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>9&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
                              </div>
-                            <table class="table-theme-4" id="table6-1-1">
-                                <caption>40&mu;L digestion  system</caption>
-                                <tr>
-                                    <td>10&times; FastDigest Buffer</td>
-                                    <td>4&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>BamH &#8544;</td>
-                                    <td>2&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>T-<i>C2-luxS</i></td>
-                                    <td>25&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>ddH2O</td>
-                                    <td>9&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Total</td>
-                                    <td>20&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td colspan="2">Reaction condition: 37&#8451; for 40 min</td>
-                                </tr>
-                            </table>
                          </div>
                          <div id="fragment6-2">
                              <div class="p">
-                                 Ligated the <i>C2-luxS</i> to linearized plasmid pWH1520, and transformed it into DH5&alpha;.
+                                 The <i>C2-luxS</i> fragment was ligated to linearized plasmid pWH1520, and then the ligation product was transformed into DH5&alpha;.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table6-2-1">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pMD19 T-Simple Vector</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>C2-luxS</i></td>
+                                            <td>5&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>11&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
                              </div>
-                            <table class="table-theme-3" id="table6-2-1">
-                                <caption>20&mu;L ligation system</caption>
-                                <tr>
-                                    <td>10&times; DNA Ligase Buffer</td>
-                                    <td>2&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>T4 DNA Ligase</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>pMD19 T-Simple Vector</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td><i>C2-luxS</i></td>
-                                    <td>5&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>ddH2O</td>
-                                    <td>11&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Total</td>
-                                    <td>20&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td colspan="2">Reaction condition: 16&#8451; overnight</td>
-                                </tr>
-                            </table>
                          </div>
                          <div id="fragment6-3">
                              <div class="p">
-                                 Extracted the plasmid pWH-<i>C2-luxS</i> from DH5&alpha;. To prevent the plasmid from DAM&DCM methylation, we transformed it into <i>E.coli</i> JM110.
+                                 The plasmid pWH-<i>C2-luxS</i> was extracted from DH5&alpha;. To prevent the plasmid from DAM&DCM methylation, we transformed it into <i>E.coli</i> JM110.
                              </div>
                          </div>
                          <div id="fragment6-4">
                              <div class="p">
-                                 Extracted the plasmid pWH-<i>C2-luxS</i> from JM110,and dealt with it by BamH &#8544; methylase.
+                                 The plasmid pWH-<i>C2-luxS</i> was extracted from JM110,and then it was treated with BamH &#8544; methylase.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-5" id="table6-4-1">
+                                        <caption>100&mu;L methylation  system</caption>
+                                        <tr>
+                                            <td>10&times; BamH &#8544; methyltransferase Buffer</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544; methyltransferase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>S-adenosylmethionine</td>
+                                            <td>0.5&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH-<i>C2-luxS</i></td>
+                                            <td>80&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>8.5&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>100&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 1 hour</td>
+                                        </tr>
+                                    </table>
+                                </div>
                              </div>
-                            <table class="table-theme-5" id="table6-4-1">
-                                <caption>100&mu;L methylation  system</caption>
-                                <tr>
-                                    <td>10&times; BamH &#8544; methyltransferase Buffer</td>
-                                    <td>10&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>BamH &#8544; methyltransferase</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>S-adenosylmethionine</td>
-                                    <td>0.5&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>pWH-<i>C2-luxS</i></td>
-                                    <td>80&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>ddH2O</td>
-                                    <td>8.5&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Total</td>
-                                    <td>100&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td colspan="2">Reaction condition: 37&#8451; for 1 hour</td>
-                                </tr>
-                            </table>
                          </div>
                          <div id="fragment6-5">
                              <div class="p">
-                                 Transformed the plasmid into GR286 by electroporation.[Failed]
+                                 The plasmid was transformed into GR286 by electroporation.[Failed]
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/e/e0/T--NKU_China--notebook-6-13-1.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by colony PCR</span></div>
+                                        (No.1 is positive control, No.2-6 are experimental groups. The result showed that we failed to transformed the plasmid pWH-<i>C2-luxS</i> into GR286)
+                                    </figcaption>
+                                </figure>
                              </div>
-                            <figure>
-                                <img src="https://static.igem.org/mediawiki/2016/e/e0/T--NKU_China--notebook-6-13-1.png" width="347" height="284">
-                                <figcaption>
-                                    Selecting positive clones by colony PCR<br>
-                                    (No.1 is positive control, No.2-6 are experimental groups.<br>
-                                    The result showed that we failed to transformed the plasmid pWH-<i>C2-luxS</i> into GR286)
-                                </figcaption>
-                            </figure>
                          </div>
                      </div>
@@ Line 1,582: / Line 1,764: @@
                      <div class="tabs" id="tabs7">
                          <ul>
-                             <li><a href="#fragment7-1">&#10112;</a></li>
+                             <li><a class="circle-number" href="#fragment7-1">&#10112;</a></li>
-                             <li><a href="#fragment7-2">&#10113;</a></li>
+                             <li><a class="circle-number" href="#fragment7-2">&#10113;</a></li>
-                             <li><a href="#fragment7-3">&#10114;</a></li>
+                             <li><a class="circle-number" href="#fragment7-3">&#10114;</a></li>
                          </ul>
                          <div id="fragment7-1">
                              <div class="p">
-                                 This week, we tried to use different voltages to transform the plasmid. Sadly, all of these tries got bad results.
+                                 This week, we tried to use different voltages to transform the plasmid. Sadly, all of these attempts rendered negative results.
                              </div>
                          </div>
                          <div id="fragment7-2">
                              <div class="p">
-                                 We considered whether the <i>luxS</i> gene is a little toxic for GR286, and the bacteria tends to refuse the gene when we added a strong promoter in front of it. So, we planned to use induced expression to reconstruction our expression vector.
+                                 We considered whether the <i>luxS</i> gene is toxic for GR286, and the bacteria tends to reject the gene when a strong promoter is inserted upstream of it. So, we planned to use inducible promoter to reconstruct our expression vector.
                              </div>
                          </div>
                          <div id="fragment7-3">
                              <div class="p">
-                                 The plasmid pWH1520 contains the strong <i>xylA</i> promoter originating, and transcription from this promoter is xylose inducible. So, the gene of interest carries its own ribosome binding sequence (RBS) and translation initiation codon. Based on these points, we redesigned primers.
+                                 The plasmid pWH1520 contains a strong <i>xylA</i> promoter originating from <i>Bacillus megaterium</i>, and transcription initiated by this promoter is xylose-inducible. Also, the gene of interest carries its own ribosome binding sequence (RBS) and translation initiation codon. Based on these points, we redesigned primers.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/e/eb/T--NKU_China--notebook-6-13-2.png">
+                                    <figcaption>
+                                    </figcaption>
+                                </figure>
                              </div>
-                            <figure>
-                                <img src="https://static.igem.org/mediawiki/2016/e/eb/T--NKU_China--notebook-6-13-2.png" width="654" height="652">
-                                <figcaption>
-                                </figcaption>
-                            </figure>
                          </div>
                      </div>
@@ Line 1,618: / Line 1,800: @@
                      <div class="tabs" id="tabs8">
                          <ul>
-                             <li><a href="#fragment8-1">&#10112;</a></li>
+                             <li><a class="circle-number" href="#fragment8-1">&#10112;</a></li>
-                             <li><a href="#fragment8-2">&#10113;</a></li>
+                             <li><a class="circle-number" href="#fragment8-2">&#10113;</a></li>
-                             <li><a href="#fragment8-3">&#10114;</a></li>
+                             <li><a class="circle-number" href="#fragment8-3">&#10114;</a></li>
-                             <li><a href="#fragment8-4">&#10115;</a></li>
+                             <li><a class="circle-number" href="#fragment8-4">&#10115;</a></li>
                          </ul>
                          <div id="fragment8-1">
                              <div class="p">
-                                 We cloned <i>luxS</i> gene from GR286 using our new primers.
+                                 <i>luxS</i> gene was cloned from GR286 using our new primers.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table8-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>YD-luxS-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>YD-luxS-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table8-1-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>40 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/3/3a/T--NKU_China--notebook-6-13-3.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>luxS</i></span></div>
+                                    </figcaption>
+                                </figure>
                              </div>
-                            <table class="table-theme-1" id="table8-1-1">
-                                <caption>50&mu;L PCR system &times;2</caption>
-                                <tr>
-                                    <td>2&times; Taq Master Mix</td>
-                                    <td>25&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>YD-luxS-F</td>
-                                    <td>2&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>YD-luxS-R</td>
-                                    <td>2&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Bacterium solution</td>
-                                    <td>2&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>ddH2O</td>
-                                    <td>19&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Total</td>
-                                    <td>50&mu;L</td>
-                                </tr>
-                            </table>
-                            <table class="table-theme-2" id="table8-1-2">
-                                <caption>PCR reaction condition</caption>
-                                <tr>
-                                    <td>94&#8451;</td>
-                                    <td>10 min</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>94&#8451;</td>
-                                    <td>30 sec</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>58&#8451;</td>
-                                    <td>30 sec</td>
-                                    <td>30 cycles</td>
-                                </tr>
-                                <tr>
-                                    <td>72&#8451;</td>
-                                    <td>40 sec</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>72&#8451;</td>
-                                    <td>10 min</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>16&#8451;</td>
-                                    <td>&infin;</td>
-                                    <td></td>
-                                </tr>
-                            </table>
-                            <figure>
-                                <img src="https://static.igem.org/mediawiki/2016/3/3a/T--NKU_China--notebook-6-13-3.png" width="200" height="348">
-                                <figcaption>
-                                    Cloning <i>luxS</i> gene by PCR
-                                </figcaption>
-                            </figure>
                          </div>
                          <div id="fragment8-2">
                              <div class="p">
-                                 Purified the <i>luxS</i> fragment by gel extraction, and ligated it into linearized pWH1520. Then, transformed the vector into DH5&alpha;.
+                                 The <i>luxS</i> fragment was purified by gel extraction, and ligated into linearized pWH1520. Then the vector was transformed into DH5&alpha;.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table8-2-1">
+                                        <caption>40&mu;L digestion  system &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH1520</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>9&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table8-2-2">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>linearized pWH1520</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
                              </div>
-                            <table class="table-theme-4" id="table8-2-1">
-                                <caption>40&mu;L digestion  system &times;2</caption>
-                                <tr>
-                                    <td>10&times; FastDigest Buffer</td>
-                                    <td>4&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>BamH &#8544;</td>
-                                    <td>2&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>pWH1520</td>
-                                    <td>25&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>ddH2O</td>
-                                    <td>9&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Total</td>
-                                    <td>40&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td colspan="2">Reaction condition: 37&#8451; for 40 min</td>
-                                </tr>
-                            </table>
-                            <table class="table-theme-3" id="table8-2-2">
-                                <caption>20&mu;L ligation system</caption>
-                                <tr>
-                                    <td>10&times; DNA Ligase Buffer</td>
-                                    <td>2&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>T4 DNA Ligase</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>linearized pWH1520</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td><i>luxS</i></td>
-                                    <td>3&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>ddH2O</td>
-                                    <td>13&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Total</td>
-                                    <td>20&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td colspan="2">Reaction condition: 16&#8451; overnight</td>
-                                </tr>
-                            </table>
                          </div>
                          <div id="fragment8-3">
                              <div class="p">
-                                 Selected the positive clones by colony PCR.
+                                 Positive clones were selected by colony PCR.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table8-3-1">
+                                        <caption>20&mu;L PCR system</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table8-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>40 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/4/49/T--NKU_China--notebook-6-13-4.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by colony PCR</span></div>
+                                    </figcaption>
+                                </figure>
                              </div>
-                            <table class="table-theme-1" id="table8-3-1">
-                                <caption>20&mu;L PCR system</caption>
-                                <tr>
-                                    <td>2&times; Taq Master Mix</td>
-                                    <td>10&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>pWH-F</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>pWH-R</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Bacterium solution</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>ddH2O</td>
-                                    <td>7&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Total</td>
-                                    <td>20&mu;L</td>
-                                </tr>
-                            </table>
-                            <table class="table-theme-2" id="table8-3-2">
-                                <caption>PCR reaction condition</caption>
-                                <tr>
-                                    <td>94&#8451;</td>
-                                    <td>10 min</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>94&#8451;</td>
-                                    <td>30 sec</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>58&#8451;</td>
-                                    <td>30 sec</td>
-                                    <td>30 cycles</td>
-                                </tr>
-                                <tr>
-                                    <td>72&#8451;</td>
-                                    <td>40 sec</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>72&#8451;</td>
-                                    <td>10 min</td>
-                                    <td></td>
-                                </tr>
-                                <tr>
-                                    <td>16&#8451;</td>
-                                    <td>&infin;</td>
-                                    <td></td>
-                                </tr>
-                            </table>
-                            <figure>
-                                <img src="https://static.igem.org/mediawiki/2016/4/49/T--NKU_China--notebook-6-13-4.png" width="347" height="284">
-                                <figcaption>
-                                </figcaption>
-                            </figure>
                          </div>
                          <div id="fragment8-4">
                              <div class="p">
-                                 We chose 4 positive strains to culture overnight and extracted the plasmid. After restriction enzyme digestion verification, we sent them to sequencing.
+positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table8-4-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH-<i>luxs</i></td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/3/35/T--NKU_China--notebook-6-13-5.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                        (No.1 are linearized pWH1520, No.2 are <i>luxS</i> fragments.)
+                                    </figcaption>
+                                </figure>
                              </div>
-                            <table class="table-theme-4" id="table8-4-1">
-                                <caption>20&mu;L digestion  system</caption>
-                                <tr>
-                                    <td>10&times; FastDigest Buffer</td>
-                                    <td>2&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>BamH &#8544;</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>pWH-<i>luxs</i></td>
-                                    <td>10&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>ddH2O</td>
-                                    <td>7&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Total</td>
-                                    <td>20&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td colspan="2">Reaction condition: 37&#8451; for 40 min</td>
-                                </tr>
-                            </table>
-                            <figure>
-                                <img src="https://static.igem.org/mediawiki/2016/3/35/T--NKU_China--notebook-6-13-5.png" width="347" height="284">
-                                <figcaption>
-                                    Restriction enzyme digestion verification<br>
-                                    (No.1 are linearized pWH1520, No.2 are <i>luxS</i> fragments.)
-                                </figcaption>
-                            </figure>
                          </div>
@@ Line 1,874: / Line 2,081: @@
                      <div class="tabs" id="tabs9">
                          <ul>
-                             <li><a href="#fragment9-1">&#10112;</a></li>
+                             <li><a class="circle-number" href="#fragment9-1">&#10112;</a></li>
-                             <li><a href="#fragment9-2">&#10113;</a></li>
+                             <li><a class="circle-number" href="#fragment9-2">&#10113;</a></li>
-                             <li><a href="#fragment9-3">&#10114;</a></li>
+                             <li><a class="circle-number" href="#fragment9-3">&#10114;</a></li>
+                            <li><a href="#fragment9-4">end</a></li>
                          </ul>
                          <div id="fragment9-1">
                              <div class="p">
-                                 The sequencing result showed there&#39;s three correct strains. So we can choose a correct strain for the following experiment. We extracted the correct plasmid pWH-<i>luxS</i> from DH5&alpha;. To prevent the plasmid from DAM&DCM methylation, we transformed it into E.coli JM110.
+                                 The sequencing result showed there&#39;s three positive strains. So one positive strain was chosen to be used for the following experiments. The pWH-<i>luxS</i> plasmid was extracted from the chosen strain. To prevent the plasmid from DAM&DCM methylation, we transformed it into E.coli JM110.
                              </div>
                          </div>
                          <div id="fragment9-2">
                              <div class="p">
-                                 Extracted the plasmid pWH -<i>luxS</i> from JM110,and dealt with it by BamH &#8544; methylase.
+                                 the plasmid pWH-<i>luxS</i> was extracted from JM110,and it was treated withBamH &#8544; methylase.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-5" id="table6-4-1">
+                                        <caption>100&mu;L methylation  system</caption>
+                                        <tr>
+                                            <td>10&times; BamH &#8544; methyltransferase Buffer</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544; methyltransferase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>S-adenosylmethionine</td>
+                                            <td>0.5&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH-<i>C2-luxS</i></td>
+                                            <td>80&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>8.5&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>100&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 1 hour</td>
+                                        </tr>
+                                    </table>
+                                </div>
                              </div>
-                            <table class="table-theme-5" id="table6-4-1">
-                                <caption>100&mu;L methylation  system</caption>
-                                <tr>
-                                    <td>10&times; BamH &#8544; methyltransferase Buffer</td>
-                                    <td>10&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>BamH &#8544; methyltransferase</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>S-adenosylmethionine</td>
-                                    <td>0.5&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>pWH-<i>C2-luxS</i></td>
-                                    <td>80&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>ddH2O</td>
-                                    <td>8.5&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Total</td>
-                                    <td>100&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td colspan="2">Reaction condition: 37&#8451; for 1 hour</td>
-                                </tr>
-                            </table>
                          </div>
                          <div id="fragment9-3">
                              <div class="p">
-                                 Transformed the plasmid into GR286 by electroporation, and selected positive clones.
+                                 The plasmid was transformed into GR286 by electroporation, and positive clones were selected.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/a/aa/T--NKU_China--notebook-6-13-6.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by colony PCR</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment9-4">
+                            <div class="p">
+                                The construction of supplier was accomplished!
                              </div>
-                            <figure>
-                                <img src="https://static.igem.org/mediawiki/2016/a/aa/T--NKU_China--notebook-6-13-6.png" width="347" height="284">
-                                <figcaption>
-                                    Selecting positive clones by colony PCR
-                                </figcaption>
-                            </figure>
                          </div>
-                    </div>
-                    <div class="p">
-                        The construction of supplier was complished!
                      </div>
                  </div>
@@ Line 1,943: / Line 2,158: @@
                      <div class="tabs" id="tabs10">
                          <ul>
-                             <li><a href="#fragment10-1">&#10112;</a></li>
+                             <li><a class="circle-number" href="#fragment10-1">&#10112;</a></li>
-                             <li><a href="#fragment10-2">&#10113;</a></li>
+                             <li><a class="circle-number" href="#fragment10-2">&#10113;</a></li>
                          </ul>
                          <div id="fragment10-1">
                              <div class="p">
-                                 Our synthetic <i>lsrACDB</i> gene came back. We first used restriction-ligation method to ligate <i>lsrACDB</i> to plasmid pWH1520, but we failed to select positive after several tries.
+                                 We have received the product of synthetic <i>lsrACDB</i> gene. We first used restriction-ligation method to ligate <i>lsrACDB</i> to plasmid pWH1520, but we failed to select positive after several tries.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table10-1-1">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>linearized pWH1520</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
                              </div>
-                            <table class="table-theme-3" id="table10-1-1">
-                                <caption>20&mu;L ligation system</caption>
-                                <tr>
-                                    <td>10&times; DNA Ligase Buffer</td>
-                                    <td>2&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>T4 DNA Ligase</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>linearized pWH1520</td>
-                                    <td>1&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td><i>lsrACDB</i></td>
-                                    <td>3&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>ddH2O</td>
-                                    <td>13&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td>Total</td>
-                                    <td>20&mu;L</td>
-                                </tr>
-                                <tr>
-                                    <td colspan="2">Reaction condition: 16&#8451; overnight</td>
-                                </tr>
-                            </table>
                          </div>
                          <div id="fragment10-2">
                              <div class="p">
-                                 Considering the <i>lsrACDB</i> gene is a large fragment (4500bp), we used ClonExpress technique cloning the gene again to improve the efficiency of ligation. We divided the <i>lsrACDB</i> sequence into two parts and cloned them separately. Then we ligated the two segments to the plasmid pWH1520 and transformed it into DH5&alpha;. After that, we used PCR to select the positive clones. However, we didn&#39;t get a good result.
+                                 Considering that the <i>lsrACDB</i> gene is a large fragment (4500bp), we used ClonExpress technique to clone the gene again to improve the efficiency of ligation. The <i>lsrACDB</i> sequence was divided into two parts and they were cloned separately. Then the two segments were ligated to the plasmid pWH1520 and the recombinant vector was transformed into DH5&alpha;. After that, verification PCR was used to select the positive clones. However, we didn&#39;t get a good result.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/1/17/T--NKU_China--notebook-6-13-7.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by colony PCR</span></div>
+                                        (No.6 is positive control, No.1-5 are experimental groups)
+                                    </figcaption>
+                                </figure>
                              </div>
-                            <figure>
-                                <img src="https://static.igem.org/mediawiki/2016/1/17/T--NKU_China--notebook-6-13-7.png" width="285" height="207">
-                                <figcaption>
-                                    Selecting positive clones by colony PCR<br>
-                                    (No.6 is positive control, No.1-5 are experimental groups)
-                                </figcaption>
-                            </figure>
                          </div>
                      </div>
@@ Line 2,001: / Line 2,222: @@
                  </div>
                  <div class="accordion-content">
-                     <div class="p">
+                     <div class="tabs" id="tabs10">
-                         We learnt a new method called circular polymerase extension cloning (CPEC) for high-throughput cloning of complex and combinatorial DNA libraries, and we decided to use this method to try ligating our <i>lsrACDB</i> gene. It&#39;s encouraging that we succeeded to ligate the <i>lsrACDB</i> gene to the plasmid pHT-01.
+                         <ul>
+                            <li><a class="circle-number" href="#fragment11-1">&#10112;</a></li>
+                        </ul>
+                        <div id="fragment11-1">
+                            <div class="p">
+                                We learnt a new method called circular polymerase extension cloning (CPEC) for high-throughput cloning of complex and combinatorial DNA libraries, and we decided to use this method to try to ligate our <i>lsrACDB</i> gene. It&#39;s encouraging that we succeeded to ligate the <i>lsrACDB</i> gene to the plasmid pHT-01.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/c/c2/T--NKU_China--notebook-6-13-8.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by colony PCR</span></div>
+                                        (No.3-6 are positive clones)
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/7/7a/T--NKU_China--notebook-6-13-9.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                        (No.2&amp;3 are positive results.)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
                      </div>
-                    <figure>
-                        <img src="https://static.igem.org/mediawiki/2016/c/c2/T--NKU_China--notebook-6-13-8.png" width="396" height="322">
-                        <figcaption>
-                            Selecting positive clones by colony PCR<br>
-                            (No.3-6 are positive clones)
-                        </figcaption>
-                    </figure>
-                    <figure>
-                        <img src="https://static.igem.org/mediawiki/2016/7/7a/T--NKU_China--notebook-6-13-9.png" width="319" height="409">
-                        <figcaption>
-                            Restriction enzyme digestion verification<br>
-                            (No.2&amp;3 are positive results.)
-                        </figcaption>
-                    </figure>
                  </div>
              </div>
@@ Line 2,027: / Line 2,257: @@
                      <div class="tabs" id="tabs12">
                          <ul>
-                             <li><a href="#fragment12-1">&#10112;</a></li>
+                             <li><a class="circle-number" href="#fragment12-1">&#10112;</a></li>
-                             <li><a href="#fragment12-2">&#10113;</a></li>
+                             <li><a class="circle-number" href="#fragment12-2">&#10113;</a></li>
                          </ul>
                          <div id="fragment12-1">
                              <div class="p">
-                                 Since we have constructed "supplier" and part of "consumer", we decided to measure the growth curve to explore the function of our "controller".
+                                 Since we have already successfully constructed "supplier" and part of "consumer", we decided to measure the growth curve to explore the function of our "controller".
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-6" id="table12-1-1">
+                                        <caption>Groups divided in this experiment</caption>
+                                        <tr>
+                                            <td>GR286</td>
+                                            <td>wild strain as control group</td>
+                                        </tr>
+                                        <tr>
+                                            <td>GR286&Delta;<i>luxS</i></td>
+                                            <td>GR286 without <i>luxS</i> gene</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH-<i>luxS</i></td>
+                                            <td><i>luxS</i> overexpression plasmid in GR286; without induced by xylose</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH-<i>luxS</i> &plus; xyl</td>
+                                            <td><i>luxS</i> overexpression plasmid in GR286; induced by xylose</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pWH1520</td>
+                                            <td>empty plasmid in GR286 as control group</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pHT-<i>lsrACDB</i></td>
+                                            <td><i>lsrACDB</i> overexpression plasmid in GR286&Delta;<i>luxS</i></td>
+                                        </tr>
+                                        <tr>
+                                            <td>pHT-01</td>
+                                            <td>empty plasmid in GR286&Delta;<i>luxS</i> as control group</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/a/ad/T--NKU_China--notebook-6-13-10.png">
+                                    <figcaption>
+                                        <div class="p"><span>OD<sub>600</sub> of different groups at specific times</span></div>
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/0/00/T--NKU_China--notebook-6-13-11.png">
+                                    <figcaption>
+                                        <div class="p"><span>Growth curve of GR286 and GR286&Delta;<i>luxS</i></span></div>
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/a/a9/T--NKU_China--notebook-6-13-12.png">
+                                    <figcaption>
+                                        <div class="p"><span>Growth curve of pWH-<i>luxS</i>, pWH-<i>luxS</i> &plus; xyl and pWH1520</span></div>
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/6/6b/T--NKU_China--notebook-6-13-13.png">
+                                    <figcaption>
+                                        <div class="p"><span>Growth curve of pHT-<i>lsrACDB</i> and pHT-01</span></div>
+                                    </figcaption>
+                                </figure>
                              </div>
-                            <table class="table-theme-6" id="table12-1-1">
-                                <caption>Groups divided in this experiment</caption>
-                                <tr>
-                                    <td>GR286</td>
-                                    <td>wild strain as control group</td>
-                                </tr>
-                                <tr>
-                                    <td>GR286&Delta;<i>luxS</i></td>
-                                    <td>GR286 without <i>luxS</i> gene</td>
-                                </tr>
-                                <tr>
-                                    <td>pWH-<i>luxS</i></td>
-                                    <td><i>luxS</i> overexpression plasmid in GR286; without induced by xylose</td>
-                                </tr>
-                                <tr>
-                                    <td>pWH-<i>luxS</i> + xyl</td>
-                                    <td><i>luxS</i> overexpression plasmid in GR286; induced by xylose</td>
-                                </tr>
-                                <tr>
-                                    <td>pWH1520</td>
-                                    <td>empty plasmid in GR286 as control group</td>
-                                </tr>
-                                <tr>
-                                    <td>pHT-<i>lsrACDB</i></td>
-                                    <td><i>lsrACDB</i> overexpression plasmid in GR286&Delta;<i>luxS</i></td>
-                                </tr>
-                                <tr>
-                                    <td>pHT-01</td>
-                                    <td>empty plasmid in GR286&Delta;<i>luxS</i> as control group</td>
-                                </tr>
-                            </table>
-                            <figure>
-                                <img src="https://static.igem.org/mediawiki/2016/a/ad/T--NKU_China--notebook-6-13-10.png" width="779" height="298">
-                                <figcaption>
-                                </figcaption>
-                            </figure>
-                            <figure>
-                                <img src="https://static.igem.org/mediawiki/2016/0/00/T--NKU_China--notebook-6-13-11.png" width="596" height="359">
-                                <figcaption>
-                                </figcaption>
-                            </figure>
-                            <figure>
-                                <img src="https://static.igem.org/mediawiki/2016/a/a9/T--NKU_China--notebook-6-13-12.png" width="584" height="349">
-                                <figcaption>
-                                </figcaption>
-                            </figure>
-                            <figure>
-                                <img src="https://static.igem.org/mediawiki/2016/6/6b/T--NKU_China--notebook-6-13-13.png" width="579" height="354">
-                                <figcaption>
-                                </figcaption>
-                            </figure>
                          </div>
                          <div id="fragment12-2">
                              <div class="p">
-                                 Cultured media of our supplier was tested for the presence of AI-2 by inducing luminescence in <i>Vibrio harveyi</i> reporter strain BB170.
+                                 Cultured media of our supplier was tested for the presence of AI-2 by inducing luminescence of <i>Vibrio harveyi</i> reporter strain BB170.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/a/a4/T--NKU_China--notebook-6-13-14.png">
+                                    <figcaption>
+                                        <div class="p"><span>Fluorescence intensity of different groups at specific times</span></div>
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/c/c5/T--NKU_China--notebook-6-13-15.png">
+                                    <figcaption>
+                                        <div class="p"><span>Relative fluorescence intensity of different groups</span></div>
+                                    </figcaption>
+                                </figure>
                              </div>
-                            <figure>
-                                <img src="https://static.igem.org/mediawiki/2016/a/a4/T--NKU_China--notebook-6-13-14.png" width="485" height="341">
-                                <figcaption>
-                                </figcaption>
-                            </figure>
-                            <figure>
-                                <img src="https://static.igem.org/mediawiki/2016/c/c5/T--NKU_China--notebook-6-13-15.png" width="608" height="72">
-                                <figcaption>
-                                </figcaption>
-                            </figure>
                          </div>
                      </div>
@@ Line 2,111: / Line 2,353: @@
                      <div class="tabs" id="tabs12">
                          <ul>
-                             <li><a href="#fragment12-1">&#10112;</a></li>
+                             <li><a class="circle-number" href="#fragment13-1">&#10112;</a></li>
-                             <li><a href="#fragment12-2">&#10113;</a></li>
+                             <li><a class="circle-number" href="#fragment13-2">&#10113;</a></li>
                          </ul>
-                         <div id="fragment12-1">
+                         <div id="fragment13-1">
                              <div class="p">
-                                 For our consumer, we should also clone the <i>lsrK</i> and <i>lsrFG</i> gene for phosphorylating and degrading AI-2. We used ClonExpress technique cloning the two genes and ligated them to plasmid pHT-01 successfully.
+                                 For our consumer, we should also overexpress the <i>lsrK</i> and <i>lsrFG</i> gene for phosphorylating and degrading phosphorylated AI-2. We used ClonExpress technique to clone the two genes and ligate them to plasmid pHT-01 successfully.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/c/c5/T--NKU_China--notebook-6-13-16.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                        (No.1&3&4 are positive results. )
+                                    </figcaption>
+                                </figure>
                              </div>
-                            <figure>
-                                <img src="https://static.igem.org/mediawiki/2016/c/c5/T--NKU_China--notebook-6-13-16.png" width="429" height="320">
-                                <figcaption>
-                                    Restriction enzyme digestion verification<br>
-                                    (No.1&3&4 are positive results. )
-                                </figcaption>
-                            </figure>
                          </div>
-                         <div id="fragment12-2">
+                         <div id="fragment13-2">
                              <div class="p">
-                                 We cocultured the supplier with BB170 and tested the fluoresent intensity to explore the function of supplier. (negative result)
+                                 We co-cultured the supplier with BB170 and tested the fluorescence intensity to explore the function of supplier. (negative result)
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/f/f1/T--NKU_China--notebook-6-13-17.png">
+                                    <figcaption>
+                                        <div class="p"><span>Fluorescence intensity of BB170 and co-culture medium</span></div>
+                                    </figcaption>
+                                </figure>
                              </div>
-                            <figure>
-                                <img src="https://static.igem.org/mediawiki/2016/f/f1/T--NKU_China--notebook-6-13-17.png" width="424" height="272">
-                                <figcaption>
-                                </figcaption>
-                            </figure>
                          </div>
                      </div>
@@ Line 2,144: / Line 2,391: @@
                  </div>
                  <div class="accordion-content">
+                     <div class="tabs" id="tabs14">
+                        <ul>
+                            <li><a href="#fragment14">begin</a></li>
+                            <li><a href="#fragment14-0">outline</a></li>
+                            <li><a href="#fragment14-1-1">1.1</a></li>
+                            <li><a href="#fragment14-1-2">1.2</a></li>
+                            <li><a href="#fragment14-1-3">1.3</a></li>
+                        </ul>
+                        <div id="fragment14">
+                            <div class="p">Since the controller we constructed with GR286 did not demonstrate positive results, we decided to substitute GR286 with <i>Escherichia coli</i> whose AI-2 metabolic pathway had been elucidated as the chassis of our controller.</div>
+                            <ul>
+                                <li>
+                                    The strains to be constructed are shown in the tables below.
+                                    <div class="flex-container">
+                                        <div class="table-wrapper">
+                                            <table class="table-theme-0" style="font-weight:bold">
+                                                <caption>AI-2 supplier</caption>
+                                                <tr>
+                                                    <td></td>
+                                                    <td>LuxS</td>
+                                                    <td>Mtn</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pTrcHisB</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pLuxS</td>
+                                                    <td>Induced</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pLuxS-Mtn</td>
+                                                    <td>Induced</td>
+                                                    <td>Induced</td>
+                                                </tr>
+                                            </table>
+                                        </div>
+                                        <div class="table-wrapper">
+                                            <table class="table-theme-0" style="font-weight:bold">
+                                                <caption>AI-2 consumer</caption>
+                                                <tr>
+                                                    <td></td>
+                                                    <td>LsrACDB</td>
+                                                    <td>LsrK</td>
+                                                    <td>LsrFG</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pTrcHisB</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pLsrACDB</td>
+                                                    <td>Induced</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pLsrFG</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td>Induced</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pLsrK</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td>Induced</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pLsrACDBFG</td>
+                                                    <td>Induced</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                    <td>Induced</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pLsrACDBK</td>
+                                                    <td>Induced</td>
+                                                    <td>Constitutive</td>
+                                                    <td style="font-weight:normal">Native</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>plsrACDBFGK</td>
+                                                    <td>Induced</td>
+                                                    <td>Constitutive</td>
+                                                    <td>Induced</td>
+                                                </tr>
+                                            </table>
+                                        </div>
+                                    </div>
+                                </li>
+                                <li>
+                                    The sequences of <i>lsrACDB</i>, <i>lsrFG</i>, <i>lsrK</i>, <i>luxS</i>, <i>mtn</i> gene in <i>E.coli K12</i> were searched in NCBI, and primers were designed according to the gene sequences. The primers used in the construction of AI-2 controller are shown in the table below.
+                                    <div class="flex-container">
+                                        <div class="table-wrapper">
+                                            <table class="table-theme-0" style="word-break:break-all">
+                                                <caption>Primers used in the construction of AI-2 controller</caption>
+                                                <tr>
+                                                    <td style="min-width:7.5rem">Primer name</td>
+                                                    <td>Sequence</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDBFG</i>1-F</td>
+                                                    <td>CGACGATGACGATAAGGATCCATGCAAACGAGTGATACCCGC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDBFG</i>1-R</td>
+                                                    <td>TGTTTGGCGTTTCCGGCAGCGGTGCGGAGAGC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDBFG</i>2-F</td>
+                                                    <td>TGTTTGGCGTTTCCGCGATTG</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDBFG</i>2-R</td>
+                                                    <td>GCACTCTCACACCACGTTGCATGGCGCGTTTC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDBFG</i>3-F</td>
+                                                    <td>GTGGTGTGAGAGTGCTGAC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDBFG</i>3-R</td>
+                                                    <td>ACCAGCTGCAGATCTCGAGCTCGTCACGGCATCAACCCATTGAAC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDB</i>1-F</td>
+                                                    <td>CGACGATGACGATAAGGATCCATGCAAACGAGTGATACCCGC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDB</i>1-R</td>
+                                                    <td>ACCGGAACCGCCGAGCAAACTAATGCCGCCCAGCAC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDB</i>2-F</td>
+                                                    <td>CTCGGCGGTTCCGGTGCGAT</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrACDB</i>2-R</td>
+                                                    <td>ACCAGCTGCAGATCTCGAGCTCGTCAGAAATCGTATTTGCCG</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>luxS</i>-F</td>
+                                                    <td>ATGACGATAAGGATCCGAGCTCGATGCCGTTGTTAGATAGCTTC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>luxS</i>-R</td>
+                                                    <td>GGACTCCCCCGGGGGACTAAATGTGCAGTTCCTGCAACTTC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>mtn</i>-F</td>
+                                                    <td>TCCCCCGGGGGAGTCCTCTCCCGCGTGAGAAATAC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>mtn</i>-R</td>
+                                                    <td>TATGGTACCAGCTGCAGATCTCTTAGCCATGTGCAAGTTTCTG</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>luxS</i>-Fd</td>
+                                                    <td>GGAATTCCCTAAATGTGCAGTTCCTGCAACTTC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>luxS</i>-Rv</td>
+                                                    <td>GGGGTACCCCATGCCGTTGTTAGATAGCTTCACAG</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrK</i>-Fd</td>
+                                                    <td>GGGGTACCCCATGGCTCGACTCTTTACC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrK</i>-Rv</td>
+                                                    <td>GGAATTCCCTATAACCCAGGCGCTTTCC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrFG</i>-Fd</td>
+                                                    <td>CGGGATCCCGATGGCAGATTTAGACGATATTAAAGATGG</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrFG</i>-Rv</td>
+                                                    <td>GAAGATCTTCTCACGGCATCAACCCATTGAAC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrK</i>-F</td>
+                                                    <td>AACTGCAGAACCAATGCATTGGTTTACGGCTAGCTCAGTCCTAGGTATAGTGCTAGCAAAGAGGAGAAAATGGCTCGACTCTTTACC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td><i>lsrK</i>-R</td>
+                                                    <td>TTCGAACTATAACCCAGGCGCTTTCC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>BK-JC-F</td>
+                                                    <td>TTTCAGTGTATGTCGCGGATGC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>GK-JC-F</td>
+                                                    <td>TTGCGCTTCGATGTCTTACAGG</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pTrc-JC-F</td>
+                                                    <td>TGGGCACTCGACCGGAATTATC</td>
+                                                </tr>
+                                                <tr>
+                                                    <td>pTrc-JC-R</td>
+                                                    <td>GCTACTGCCGCCAGGCAAATTC</td>
+                                                </tr>
+                                            </table>
+                                        </div>
+                                    </div>
+                                </li>
+                            </ul>
+                        </div>
+                        <div id="fragment14-0">
+                            <ol>
+                                <li>Construction of pLuxS-Mtn</li>
+                            </ol>
+                        </div>
+                        <div id="fragment14-1-1">
+                            <div class="p">
+                                <i>luxS</i> gene was cloned from <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table14-1-1-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table14-1-1-1-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>63<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/f/f7/T--NKU_China--notebook-14-17-01.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>luxS</i></span></div>
+                                    </figcaption>
+                                </figure>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table14-1-1-1-3">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>mtn</i>-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>mtn</i>-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table14-1-1-1-4">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>63<sup>o</sup>C</td>
+                                            <td>30sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>45 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/6/66/T--NKU_China--notebook-14-17-02.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>mtn</i></span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment14-1-2">
+                            <div class="p">
+                                ClonExpress technique was used to ligate <i>luxS</i> and <i>mtn</i> genes to plasmid pTrcHisB. The recombinant vector pTrc-<i>luxS</i>-<i>mtn</i> was transformed into <i>E.coli K12</i>. After that, verification PCR was performed to select the positive clones.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table14-1-1-2-1">
+                                        <caption>20&mu;L PCR system</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table14-1-1-2-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>1 min 30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/e/e4/T--NKU_China--notebook-14-17-03.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                        (NO.3&amp;5&amp;8 are positive results)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment14-1-3">
+                            <div class="p">
+positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table14-1-3-1-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Sac &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bgl &#8545;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>luxS</i>-<i>mtn</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/8/83/T--NKU_China--notebook-14-17-04.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                        (No.1 are linearized pTrcHisB, No.2 are <i>luxS</i>-<i>mtn</i> fragment. )
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week15">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week15 (Aug 22&ndash;Aug 28)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs15">
+                        <ul>
+                            <li><a href="#fragment15-0">outline</a></li>
+                            <li><a href="#fragment15-1-1">1.1</a></li>
+                            <li><a href="#fragment15-1-2">1.2</a></li>
+                            <li><a href="#fragment15-1-3">1.3</a></li>
+                            <li><a href="#fragment15-1-4">1.4</a></li>
+                            <li><a href="#fragment15-2-1">2.1</a></li>
+                            <li><a href="#fragment15-2-2">2.2</a></li>
+                            <li><a href="#fragment15-2-3">2.3</a></li>
+                            <li><a href="#fragment15-3-1">3.1</a></li>
+                            <li><a href="#fragment15-3-2">3.2</a></li>
+                            <li><a href="#fragment15-3-3">3.3</a></li>
+                        </ul>
+                        <div id="fragment15-0">
+                            <ol>
+                                <li>Construction of pLuxS</li>
+                                <li>Construction of pLsrACDB</li>
+                                <li>Construction of pLsrACDBFG</li>
+                            </ol>
+                        </div>
+                        <div id="fragment15-1-1">
+                            <div class="p">
+                                <i>luxS</i> gene was cloned from <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table15-1-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-Fd</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i>-Rv</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table15-1-1-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>60<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/b/bc/T--NKU_China--notebook-14-17-05.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>luxS</i></span></div>
+                                        </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-1-2">
+                            <div class="p">
+                                The <i>luxS</i> gene was purified by gel extraction. Then, both the <i>luxS</i> segment and pTrcHisB vector were treated with restriction enzyme. After that, <i>luxS</i> gene was ligated to linearized pTrcHisB, and the ligation product was transformed into <i>E.coli K12</i>.                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <div class="table-wrapper">
+                                        <table class="table-theme-4" id="table15-1-2-1">
+                                            <caption>40&mu;L digestion  system &times;2</caption>
+                                            <tr>
+                                                <td>10&times; FastDigest Buffer</td>
+                                                <td>4&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Kpn &#8544;</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>EcoR &#8544;</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td><i>luxS</i></td>
+                                                <td>25&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>ddH2O</td>
+                                                <td>7&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Total</td>
+                                                <td>40&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                    <div class="table-wrapper">
+                                        <table class="table-theme-4" id="table15-1-2-2">
+                                            <caption>40&mu;L digestion  system &times;2</caption>
+                                            <tr>
+                                                <td>10&times; FastDigest Buffer</td>
+                                                <td>4&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Kpn &#8544;</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>EcoR &#8544;</td>
+                                                <td>2&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>pTrcHisB</td>
+                                                <td>20&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>ddH2O</td>
+                                                <td>12&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td>Total</td>
+                                                <td>40&mu;L</td>
+                                            </tr>
+                                            <tr>
+                                                <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                            </tr>
+                                        </table>
+                                    </div>
+                                    <table class="table-theme-3" id="table15-1-2-3">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>linearized pTrcHisB</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxS</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment15-1-3">
+                            <div class="p">
+                                Verification PCR was performed to select the positive clones.                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table15-1-3-1">
+                                        <caption>20&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table15-1-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>50 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/6/65/T--NKU_China--notebook-14-17-06.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-1-4">
+                            <div class="p">
+                                One positive strain was chosen to be cultured overnight and plasmid was extracted. After restriction enzyme digestion verification, the positive clone was sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table15-1-4-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Kpn &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>EcoR &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>luxS</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/c/ca/T--NKU_China--notebook-14-17-07.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                        (No.1 is linearized pTrcHisB &plus; <i>luxS</i>, No.2 is plasmid pTrc-<i>luxS</i>. )
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-2-1">
+                            <div class="p">
+                                The <i>lsrACDBFG</i> sequence was divided into three parts and they were cloned separately. Then the three segments were ligated to the linearized pTrcHisB by ClonExpress technique, and the recombinant vector was transformed into DH5&alpha;.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table15-2-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i>1-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i>1-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table15-2-1-2">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i>2-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDB</i>2-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table15-2-1-3">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>60<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min 20 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/b/b6/T--NKU_China--notebook-14-17-08.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of segment <i>lsrACDB1</i>,<i>lsrACDB1</i>2</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-2-2">
+                            <div class="p">
+                                Verification PCR was performed to select the positive clones.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/e/e1/T--NKU_China--notebook-14-17-09.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-2-3">
+                            <div class="p">
+positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table15-2-3-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Sac &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrACDB</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/5/5d/T--NKU_China--notebook-14-17-10.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-3-1">
+                            <div class="p">
+                                The <i>lsrACDBFG</i> sequence was divided into three parts and they were cloned separately. Then the three segments were ligated to the linearized pTrcHisB by ClonExpress technique, and the recombinant vector was transformed into DH5&alpha;.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table15-3-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDBFG</i>1-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDBFG</i>1-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table15-3-1-2">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDBFG</i>2-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDBFG</i>2-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table15-3-1-3">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDBFG</i>3-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrACDBFG</i>3-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table15-3-1-4">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/6/69/T--NKU_China--notebook-14-17-11.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of segment <i>lsrACDBFG</i>1,<i>lsrACDBFG</i>2, <i>lsrACDBFG</i>3</span>
+                                        </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-3-2">
+                            <div class="p">
+                                Verification PCR was performed to select the positive clones.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/9/97/T--NKU_China--notebook-14-17-12.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment15-3-3">
+                            <div class="p">
+positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table15-3-2-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Sac &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrACDB</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/3/33/T--NKU_China--notebook-14-17-13.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                        (No.1-4 are linearized pTrcHisB &plus; <i>lsrACDBFG</i>, No.5 is plasmid pTrc-<i>lsrACDBFG</i>.)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week16">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week16 (Aug 29&ndash;Sep 04)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs16">
+                        <ul>
+                            <li><a href="#fragment16-0">outline</a></li>
+                            <li><a href="#fragment16-1-1">1.1</a></li>
+                            <li><a href="#fragment16-1-2">1.2</a></li>
+                            <li><a href="#fragment16-1-3">1.3</a></li>
+                            <li><a href="#fragment16-1-4">1.4</a></li>
+                            <li><a href="#fragment16-2-1">2.1</a></li>
+                            <li><a href="#fragment16-2-2">2.2</a></li>
+                            <li><a href="#fragment16-2-3">2.3</a></li>
+                            <li><a href="#fragment16-2-4">2.4</a></li>
+                            <li><a href="#fragment16-3-1">3.1</a></li>
+                            <li><a href="#fragment16-3-2">3.2</a></li>
+                            <li><a href="#fragment16-3-3">3.3</a></li>
+                            <li><a href="#fragment16-3-4">3.4</a></li>
+                        </ul>
+                        <div id="fragment16-0">
+                            <ol>
+                                <li>Construction of pLsrFG</li>
+                                <li>Construction of pLsrACDBK</li>
+                                <li>Construction of pLsrACDBFGK</li>
+                            </ol>
+                        </div>
+                        <div id="fragment16-1-1">
+                            <div class="p">
+                                <i>lsrFG</i> gene was cloned from <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table16-1-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrFG</i>-Fd</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrFG</i>-Rv</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table16-1-1-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>1 min 15 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/5/5c/T--NKU_China--notebook-14-17-14.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>lsrFG</i></span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment16-1-2">
+                            <div class="p">
+                                The <i>lsrFG</i> gene was purified by gel extraction. Then, both the <i>lsrFG</i> segment and pTrcHisB vector were treated with restriction enzyme. After that, <i>lsrFG</i> gene was ligated to linearized pTrcHisB, and the ligation product was transformed into <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-1-2-1">
+                                        <caption>40&mu;L digestion  system &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bgl &#8545;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrFG</i></td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-1-2-2">
+                                        <caption>40&mu;L digestion  system &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bgl &#8545;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrcHisB</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>12&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table16-1-2-3">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pMD19 T-Simple Vector</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>luxSFG</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment16-1-3">
+                            <div class="p">
+                                Verification PCR was performed to select the positive clones.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table16-1-3-1">
+                                        <caption>20&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table16-1-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>1 min 30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/5/5b/T--NKU_China--notebook-14-17-15.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                        (NO. 1&amp;3 are positive results)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment16-1-4">
+                            <div class="p">
+                                Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-1-4-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BamH &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bgl &#8545;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrFG</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/b/b0/T--NKU_China--notebook-14-17-16.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment16-2-1">
+                            <div class="p">
+                                <i>lsrK</i> gene was cloned from <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table16-2-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i>-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i>-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table16-2-1-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>55<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>1 min 40 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/8/85/T--NKU_China--notebook-14-17-17.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>lsrK</i></span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment16-2-2">
+                            <div class="p">
+                                The <i>lsrK</i> gene was purified by gel extraction. Then, both the <i>lsrK</i> segment and pTrc-<i>lsrACDB</i> vector were treated with restriction enzyme. After that, <i>lsrK</i> gene was ligated to linearized pTrc-<i>lsrACDB</i>, and the ligation product was transformed into <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-2-2-1">
+                                        <caption>40&mu;L digestion  system &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Pst &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BstB &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i></td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-2-2-2">
+                                        <caption>40&mu;L digestion  system &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Pst &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BstB &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrACDB</i></td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table16-2-2-3">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>linearized pTrc-<i>lsrACDB</i></td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment16-2-3">
+                            <div class="p">
+                                Verification PCR was performed to select the positive clones.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table16-2-3-1">
+                                        <caption>20&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BK-JC-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table16-2-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/c/cb/T--NKU_China--notebook-14-17-18.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                        (NO. 1&amp;3 are positive results)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment16-2-4">
+                            <div class="p">
+                                Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-2-4-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Pst &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BstB &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrACDBK</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/5/56/T--NKU_China--notebook-14-17-19.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment16-3-1">
+                            <div class="p">
+                                <i>lsrK</i> gene was cloned from <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table16-3-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i>-F</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i>-R</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table16-3-1-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>55<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>1 min 40 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/8/85/T--NKU_China--notebook-14-17-17.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>lsrK</i></span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment16-3-2">
+                            <div class="p">
+                                The <i>lsrK</i> gene was purified by gel extraction. Then, both the <i>lsrK</i> segment and pTrc-<i>lsrACDBFG</i> vector were treated with restriction enzyme. After that, <i>lsrK</i> gene was ligated to linearized pTrc-<i>lsrACDBFG</i>, and the ligation product was transformed into <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-3-2-1">
+                                        <caption>40&mu;L digestion  system &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Pst &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BstB &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i></td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-3-2-2">
+                                        <caption>40&mu;L digestion  system &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Pst &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BstB &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrACDBFG</i></td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>12&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table16-3-2-3">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>linearized pTrc-<i>lsrACDFGB</i></td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment16-3-3">
+                            <div class="p">
+                                Verification PCR was performed to select the positive clones.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table16-3-3-1">
+                                        <caption>20&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>GK-JC-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table16-3-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/7/78/T--NKU_China--notebook-14-17-20.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                        (NO.3 is positive result)
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment16-3-4">
+                            <div class="p">
+                                Two positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table16-3-4-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Pst &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BstB &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrACDBKFGK</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/e/e2/T--NKU_China--notebook-14-17-21.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week17">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week17 (Sep 05&ndash;Sep 11)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs17">
+                        <ul>
+                            <li><a href="#fragment17-0">outline</a></li>
+                            <li><a href="#fragment17-1-1">1.1</a></li>
+                            <li><a href="#fragment17-1-2">1.2</a></li>
+                            <li><a href="#fragment17-1-3">1.3</a></li>
+                            <li><a href="#fragment17-1-4">1.4</a></li>
+                        </ul>
+                        <div id="fragment17-0">
+                            <ol>
+                                <li>Construction of pLsrK</li>
+                            </ol>
+                        </div>
+                        <div id="fragment17-1-1">
+                            <div class="p">
+                                <i>lsrK</i> gene was cloned from <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table17-1-1-1">
+                                        <caption>50&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>PrimeSTAR Max Premix(2&times;)</td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i>-Fd</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i>-Rv</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>E.coli K12</i></td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>19&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>50&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table17-1-2-1">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>55<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>1 min 40 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/2/24/T--NKU_China--notebook-14-17-22.png">
+                                    <figcaption>
+                                        <div class="p"><span>PCR cloning product of gene <i>lsrK</i></span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment17-1-2">
+                            <div class="p">
+                                The <i>lsrK</i> gene was purified by gel extraction. Then, both the <i>lsrK</i> segment and pTrc-<i>lsrACDBFG</i> vector were treated with restriction enzyme. After that, <i>lsrK</i> gene was ligated to linearized pTrc-<i>lsrACDBFG</i>, and the ligation product was transformed into <i>E.coli K12</i>.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table17-1-2-1">
+                                        <caption>40&mu;L digestion  system &times;2 &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Kpn &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>EcoR &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i></td>
+                                            <td>25&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table17-1-2-2">
+                                        <caption>40&mu;L digestion  system &times;2 &times;2</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>4&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Pst &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>BstB &#8544;</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-HisB</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>12&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>40&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <table class="table-theme-3" id="table17-1-2-3">
+                                        <caption>20&mu;L ligation system</caption>
+                                        <tr>
+                                            <td>10&times; DNA Ligase Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>T4 DNA Ligase</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>linearized pTrcHisB</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td><i>lsrK</i></td>
+                                            <td>3&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>13&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 16<sup>o</sup>C overnight</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                            </div>
+                        </div>
+                        <div id="fragment17-1-3">
+                            <div class="p">
+                                Verification PCR was performed to select the positive clones.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-1" id="table17-1-3-1">
+                                        <caption>20&mu;L PCR system &times;2</caption>
+                                        <tr>
+                                            <td>2&times; Taq Master Mix</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-F</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-JC-R</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Bacterium solution</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>7&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <div class="table-wrapper">
+                                    <div class="rbrace">&#125;</div>
+                                    <table class="table-theme-2" id="table17-1-3-2">
+                                        <caption>PCR reaction condition</caption>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>94<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>58<sup>o</sup>C</td>
+                                            <td>30 sec</td>
+                                            <td>30 cycles</td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>2 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>72<sup>o</sup>C</td>
+                                            <td>10 min</td>
+                                            <td></td>
+                                        </tr>
+                                        <tr>
+                                            <td>16<sup>o</sup>C</td>
+                                            <td>&infin;</td>
+                                            <td></td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/3/30/T--NKU_China--notebook-14-17-23.png">
+                                    <figcaption>
+                                        <div class="p"><span>Selection of positive clones by PCR</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment17-1-4">
+                            <div class="p">
+positive strains were chosen to be cultured overnight and plasmids were extracted. After restriction enzyme digestion verification, the positive clones were sequenced.
+                            </div>
+                            <div class="flex-container">
+                                <div class="table-wrapper">
+                                    <table class="table-theme-4" id="table17-1-4-1">
+                                        <caption>20&mu;L digestion  system</caption>
+                                        <tr>
+                                            <td>10&times; FastDigest Buffer</td>
+                                            <td>2&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Kpn &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>EcoR &#8544;</td>
+                                            <td>1&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>pTrc-<i>lsrK</i></td>
+                                            <td>6&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>ddH2O</td>
+                                            <td>10&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td>Total</td>
+                                            <td>20&mu;L</td>
+                                        </tr>
+                                        <tr>
+                                            <td colspan="2">Reaction condition: 37<sup>o</sup>C for 40 min</td>
+                                        </tr>
+                                    </table>
+                                </div>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/2/22/T--NKU_China--notebook-14-17-24.png">
+                                    <figcaption>
+                                        <div class="p"><span>Restriction enzyme digestion verification</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week18">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week18 (Seq 12&ndash;Seq 18)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs7">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment18-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment18-2">&#10113;</a></li>
+                        </ul>
+                        <div id="fragment18-1">
+                            <div class="p">
+                                We detected the expression of several overexpressed genes at the mRNA level by RT-PCR, and obtained positive results.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/f/f8/T--NKU_China--notebook-18-20-01.png" class="white">
+                                    <figcaption>
+                                        <div class="p"><span>Relative expression of several overexpressed genes at the mRNA level</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment18-2">
+                            <div class="p">
+                                SDS-PAGE was performed to detect the expression of these genes at the protein level.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/d/d2/T--NKU_China--notebook-18-20-02.png" class="white">
+                                    <figcaption>
+                                        <div class="p"><span>pTrcHisB, pLuxS, pLuxS-Mtn, pLsrACDB, pLsrACDBFG SDS-PAGE</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week19">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week19 (Seq 19&ndash;Seq 25)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs7">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment19-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment19-2">&#10113;</a></li>
+                        </ul>
+                        <div id="fragment19-1">
+                            <div class="p">
+                                Cultured media of controllers were tested for the presence of AI-2 by inducing luminescence of <i>Vibrio harveyi</i> reporter strain BB170.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/4/4c/T--NKU_China--notebook-18-20-03.jpg">
+                                    <figcaption>
+                                        <div class="p"><span>Relative fluorescence intensity of suppliers at specific times</span></div>
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/f/f7/T--NKU_China--notebook-18-20-04.jpg">
+                                    <figcaption>
+                                        <div class="p"><span>Relative fluorescence intensity of consumers at specific times</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment19-2">
+                            <div class="p">
+                                HPLC was performed to detect the production of AI-2 of the strain pLuxS.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/d/d9/T--NKU_China--notebook-18-20-05.png">
+                                    <figcaption>
+                                        <div class="p"><span>HPLC result of AI-2 production of luxS overexpression strain and negative control</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
+                </div>
+            </div>
+            <div class="accordion-fragment" id="week20">
+                <div class="accordion-header">
+                    <span class="default">&#9758;</span><span class="active">&#9759;</span>&nbsp;Week20 (Seq 26&ndash;Oct 02)
+                </div>
+                <div class="accordion-content">
+                    <div class="tabs" id="tabs7">
+                        <ul>
+                            <li><a class="circle-number" href="#fragment20-1">&#10112;</a></li>
+                            <li><a class="circle-number" href="#fragment20-2">&#10113;</a></li>
+                        </ul>
+                        <div id="fragment20-1">
+                            <div class="p">
+                                Biofilm studies and evaluation:<br>
+                                pTrcHisB, pLuxS, pLuxSMtn, pLsrACDB, pLsrACDBFG, pLsrACDBK, pLsrACDBFGK were diluted to OD~0.05 and reinoculated at a total volume of 200 &mu;L at a 1:1 (v/v) ratio. IPTG (1 mM) was added at OD ~ 0.4, and biofilms were cultured for ~24 h (&plus;/&minus;30 min) at 30 <sup>o</sup>C in static conditions. After incubation, optical density was read on a plate reader at 600 nm. The supernatant was gently decanted, and each well was washed 3 times with 300 &mu;L of sterile PBS to detach loosely adhered cells. The plate was then incubated at 60 <sup>o</sup>C  with the lid off for 60 min, and afterwards, 250 &mu;L of 0.1% crystal violet was added to each well and incubated for 15 min at room temperature. Crystal violet stain was aspirated with a pipette and excess stain was washed off by gently submerging and mixing in a tray filled with distilled water until washings were free of the stain. After the microplate was airdried, the dye was resolubilized by adding 250 &mu;L of 95% ethanol, and incubated at room temperature with shaking for 30 min. The optical density of each well stained with crystal violet was measured at 540 nm.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/3/33/T--NKU_China--notebook-18-20-06.jpg">
+                                    <figcaption>
+                                        <div class="p"><span>Relative biofilm production of suppliers</span></div>
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/8/8b/T--NKU_China--notebook-18-20-07.jpg">
+                                    <figcaption>
+                                        <div class="p"><span>Relative biofilm production of consumers</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                        <div id="fragment20-2">
+                            <div class="p">
+                                Cultured media of controllers were tested for the presence of AI-2 by HPLC. AI-2 output and uptake profiles of controllers were drawn according to the HPLC results.
+                            </div>
+                            <div class="flex-container">
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/e/ed/T--NKU_China--notebook-18-20-08.jpg">
+                                    <figcaption>
+                                        <div class="p"><span>AI-2 output profiles of suppliers</span></div>
+                                    </figcaption>
+                                </figure>
+                                <figure>
+                                    <img src="https://static.igem.org/mediawiki/2016/0/04/T--NKU_China--notebook-18-20-09.jpg">
+                                    <figcaption>
+                                        <div class="p"><span>AI-2 uptake profiles of consumers</span></div>
+                                    </figcaption>
+                                </figure>
+                            </div>
+                        </div>
+                    </div>
                  </div>
              </div>
          </div>
-     </main>
+     </div>
 </body>
 </html>
+{{NKU_China/footer}}