What we finally got from our experiment

• Results:
  1 Construction of GFP detection device:
  1.1 Amplification of GFP gene
  The PCR product of GFP was cloned from pK7G2D vector, and we got the GFP product successfully (Fig 2-1).

  

  
  Fig 1. Electrophoresis of GFP PCR product. The lanes 1-4 showed the GFP bands.
  1.2 Purification of GFP PCR product
              The PCR product of GFP gene was purified by kit and the results were showed in Fig 2.
  
  Fig 2. Electrophoresis of purified GFP PCR product (lanes 1-3).
  1.3 Ligation of purified GFP to pEASY T1 simple vector
              To sequence the GFP gene we got, the purified GFP was firstly ligated to pEASY T1 simple vector. After sequencing, we selected the positive clone to extract the positive plasmid. Fig 3 showed the GFP-contained pEASY T1 simple vector we constructed.
  
  Fig 3. Electrophoresis of the GFP- contained pEASY T1 simple vector (lanes 1-4).
  1.4 Digestion of GFP gene from GFP- contained pEASY T1 simple vector
              After getting the positive plasmid, we digested the plasmid with the same restriction enzymes designed in the primers of GFP cloning. We got the GFP fragment (near the Marker 750 bp) by digestion from the GFP- contained pEASY T1 simple vector (Fig 4). And then we purified the target GFP fragment with kit.
  
  Fig 4. Electrophoresis of GFP contained pEASY T1 simple vector digestion (lanes 1-4).
  1.5 Digestion of pGEX-KG vector
              For prokaryotic expression of GFP protein in E. coli, we ligated the positive GFP fragment to the prokaryotic expression vector pGEX-KG. And then we digested the pGEX-KG vector with the same restriction enzymes designed in the primers of GFP cloning. Fig 5 showed that we successfully digested the pGEX-KG vector with the enzymes.
  
  Fig 5. Electrophoresis of digestion of pGEX-KG vector. Lanes 1-3 showed the digested pGEX-KG, and lane 4 showed the negative control, the complete pGEX-KG.
  1.6 Ligation of GFP fragment to pGEX-KG vector
              We ligated the GFP fragment to the digested pGEX-KG vector, and then the PCR method was used to detect the positive construction by amplifying the GFP fragment. Fig 6 showed the PCR results of the selected seven clones, and all the seven clones were positive clones.
  
  Fig 6. Electrophoresis of GFP fragment PCR from the selected clones (lanes 1-7).
  1.7 The validity of the detection device
              To detect the validity of our detection device, we transformed the device to the E. coli BL21. Then the GFP fluorescence was observed under fluorescence microscopy (Fig 7). The result showed our detection device worked, and we could use the prokaryotic expression system to express our major circuit.
  
  Fig 7. The GFP fluorescence detection of our detection device
  The process of the major circuit construction was similar to that of GFP detection device c. And the detailed process was divided into two parts as described in Material and methods. First we add a TEV protease before GFP reporter. The PCR product of TEV contained GFP was shown in Fig 8.
  
  Fig 8. Electrophoresis of TEV contained GFP PCR product. The lanes 1-4 showed the GFP bands.
  After the TEV contained GFP was introduced to pGEX-KG, we cloned the SmCPS1 genes (Fig 9), and then inserted SmCPS1 between thrombin and TEV protease sites.
  
  Fig 9. Electrophoresis of SmCPS1 PCR product (lanes 1-2).

  1. Site-directed mutagenesis

  SmCPS1 sequencing result (before Site-directed mutagenesis)：
  ATGGCCTCCTTATCCTCTACAATCCTCAGCCGCTCTCCGGCGGCCCGCCGCAGAATTACGCCGGCATCGGCTAAGCTTCACCTGCCGGAATGTTTCGCCATCAGTGCATGGATGGGCAGCAGCACTAAAAACCTTTCTCTCAGCTACCAACTTAATCACAAGAAAATATCAGTTGCCACAGTAGATGCGCCGCAGGTGCATGACCACGACGGCACTACCGTTCATCAAGGCCATGATGCGGTGAAGAATATTGAGGATCCCATTGAATACATCAGGACGTTGTTGAGGACGACGGGGGACGGGAGAATAAGCGTGTCGCCGTACGACACGGCGTGGGTGGCGATGATCAAGGACGTGGAGGGGCGGGACGGGCCCCAGTTCCCCTCCAGCCTCGAGTGGATCGTGCAGAATCAACTCGAGGATGGATCGTGGGGCGATCAGAAGCTTTTCTGCGTCTACGATCGCCTCGTCAATACCATCGCGTGCGTGGTAGCCTTGAGATCGTGGAATGTTCATGCTCACAAGGTCAAAAGAGGAGTGACGTACATCAAGGAAAATGTGGATAAACTTATGGAGGGAAATGAGGAGCACATGACTTGTGGGTTCGAAGTGGTGTTTCCGGCGCTTCTACAAAAAGCGAAAAGCTTAGGCATCGAAGATCTTCCTTACGATTCTCCGGCGGTGCAGGAGGTTTATCATGTCAGGGAACAAAAGTTGAAAAGGATTCCACTGGAGATTATGCACAAAATACCGACATCATTATTATTTAGTTTGGAAGGGCTCGAAAATTTGGATTGGGACAAACTTTTGAAACTGCAGTCAGCCGACGGTTCCTTCCTCACCTCTCCCTCCTCCACCGCCTTCGCGTTCATGCAAACCAAGGATGAAAAATGCTACCAATTCATCAAGAACACGATAGACACTTTCAACGGAGGAGCGCCACACACTTATCCCGTCGACGTGTTTGGAAGGCTCTGGGCGATCGACCGGCTGCAGCGCCTCGGAATTTCCCGCTTTTTTGAGCCGGAGATTGCTGATTGCTTAAGCCACATCCACAAATTTTGGACGGATAAGGGAGTTTTCAGTGGGAGAGAATCGGAGTTTTGCGACATTGACGATACATCCATGGGAATGAGGCTTATGAGGATGCATGGATATGATGTTGATCCAAATGTGCTGAGGAATTTCAAGCAGAAAGATGGTAAATTCTCTTGCTACGGCGGGCAGATGATCGAGTCGCCTTCTCCGATATACAATCTTTACAGAGCTTCTCAGCTCCGATTTCCCGGCGAGGAAATCCTCGAAGATGCGAAGAAATTCGCCTACGATTTCTTGAAAGAAAAACTAGCCAACAATCAGATTCTGGATAAATGGGTTATTTCTAAGCACTTGCCTGATGAGATCAAGCTCGGGCTAGAGATGCCGTGGCTCGCCACCCTACCCCGCGTCGAGGCGAAGTACTACATCCAGTACTACGCCGGCTCCGGCGACGTGTGGATCGGGAAGACGCTGTACAGGATGCCGGAGATCAGCAACGACACGTACCACGACCTAGCCAAGACGGATTTCAAGAGATGCCAAGCGAAGCATCAGTTCGAGTGGCTCTACATGCAAGAATGGTACGAGAGCTGCGGCATCGAGGAATTCGGGATAAGCAGAAAGGACCTTCTGCTTTCCTATTTCTTGGCGACCGCGAGCATCTTCGAGCTCGAGAGGACCAACGAGCGAATCGCGTGGGCCAAATCGCAGATCATCGCTAAGATGATCACTTCTTTCTTCAACAAGGAAACTACGTCGGAGGAGGACAAGCGAGCTCTTTTGAACGAGCTCGGAAACATTAATGGCCTCAACGACACAAACGGCGCAGGGAGAGAAGGTGGGGCCGGTAGCATTGCGCTAGCGACCCTCACTCAGTTCCTCGAGGGATTCGACAGATACACCAGACACCAGCTGAAAAATGCTTGGAGCGTATGGCTGACGCAGCTGCAACATGGCGAAGCAGACGACGCAGAGCTCCTAACCAACACGTTGAACATCTGCGCCGGCCACATCGCCTTCAGGGAAGAAATACTGGCGCACAACGAGTACAAAACTCTCTCCAACCTAACCAGCAAAATCTGTCGGCAACTTTCTTTCATTCAAAGCGAAAAGGAGATGGGAGTAGAGGGCGAGATCGCAGCGAAATCGAGCATAAAAAACAAGGAACTCGAAGAAGACATGCAAATGTTGGTGAAGTTGGTGCTTGAGAAATATGGGGGCATAGATAGAAATATAAAGAAAGCGTTTTTGGCAGTTGCGAAGACTTATTATTACAGAGCGTATCATGCCGCCGACACCATAGACACACACATGTTTAAAGTGCTTTTCGAGCCAGTCGCGTGA

  After Site-directed mutagenesis：
  ATGGCCTCCTTATCCTCTACAATCCTCAGCCGCTCTCCGGCGGCCCGCCGCAGAATTACGCCGGCATCGGCTAAGCTTCACCTGCCGGAATGTTTCGCCATCAGTGCATGGATGGGCAGCAGCACTAAAAACCTTTCTCTCAGCTACCAACTTAATCACAAGAAAATATCAGTTGCCACAGTAGATGCGCCGCAGGTGCATGACCACGACGGCACTACCGTTCATCAAGGCCATGATGCGGTGAAGAATATTGAGGATCCCATTGAATACATCAGGACGTTGTTGAGGACGACGGGGGACGGGAGAATAAGCGTGTCGCCGTACGACACGGCGTGGGTGGCGATGATCAAGGACGTGGAGGGGCGGGACGGGCCCCAGTTCCCCTCCAGCCTCGAGTGGATCGTGCAGAATCAACTCGAGGATGGATCGTGGGGCGATCAGAAGCTTTTCTGCGTCTACGATCGCCTCGTCAATACCATCGCGTGCGTGGTAGCCTTGAGATCGTGGAATGTTCATGCTCACAAGGTCAAAAGAGGAGTGACGTACATCAAGGAAAATGTGGATAAACTTATGGAGGGAAATGAGGAGCACATGACTTGTGGGTTCGAAGTGGTGTTTCCGGCGCTTCTACAAAAAGCGAAAAGCTTAGGCATCGAAGATCTTCCTTACGATTCTCCGGCGGTGCAGGAGGTTTATCATGTCAGGGAACAAAAGTTGAAAAGGATTCCACTGGAGATTATGCACAAAATACCGACATCATTATTATTTAGTTTGGAAGGGCTCGAAAATTTGGATTGGGACAAACTTTTGAAACTCCAGTCAGCCGACGGTTCCTTCCTCACCTCTCCCTCCTCCACCGCCTTCGCGTTCATGCAAACCAAGGATGAAAAATGCTACCAATTCATCAAGAACACGATAGACACTTTCAACGGAGGAGCGCCACACACTTATCCCGTCGACGTGTTTGGAAGGCTCTGGGCGATCGACCGGCTCCAGCGCCTCGGAATTTCCCGCTTTTTTGAGCCGGAGATTGCTGATTGCTTAAGCCACATCCACAAATTTTGGACGGATAAGGGAGTTTTCAGTGGGAGAGAATCGGAGTTTTGCGACATTGACGATACATCCATGGGAATGAGGCTTATGAGGATGCATGGATATGATGTTGATCCAAATGTGCTGAGGAATTTCAAGCAGAAAGATGGTAAATTCTCTTGCTACGGCGGGCAGATGATCGAGTCGCCTTCTCCGATATACAATCTTTACAGAGCTTCTCAGCTCCGATTTCCCGGCGAGGAAATCCTCGAAGATGCGAAGAAATTCGCCTACGATTTCTTGAAAGAAAAACTAGCCAACAATCAGATTCTGGATAAATGGGTTATTTCTAAGCACTTGCCTGATGAGATCAAGCTCGGGCTAGAGATGCCGTGGCTCGCCACCCTACCCCGCGTCGAGGCGAAGTACTACATCCAGTACTACGCCGGCTCCGGCGACGTGTGGATCGGGAAGACGCTGTACAGGATGCCGGAGATCAGCAACGACACGTACCACGACCTAGCCAAGACGGATTTCAAGAGATGCCAAGCGAAGCATCAGTTCGAGTGGCTCTACATGCAAGAATGGTACGAGAGCTGCGGCATCGAGGAGTTCGGGATAAGCAGAAAGGACCTTCTGCTTTCCTATTTCTTGGCGACCGCGAGCATCTTCGAGCTCGAGAGGACCAACGAGCGAATCGCGTGGGCCAAATCGCAGATCATCGCTAAGATGATCACTTCTTTCTTCAACAAGGAAACTACGTCGGAGGAGGACAAGCGAGCTCTTTTGAACGAGCTCGGAAACATTAATGGCCTCAACGACACAAACGGCGCAGGGAGAGAAGGTGGGGCCGGTAGCATTGCGCTAGCGACCCTCACTCAGTTCCTCGAGGGATTCGACAGATACACCAGACACCAGCTGAAAAATGCTTGGAGCGTATGGCTGACGCAGCTGCAACATGGCGAAGCAGACGACGCAGAGCTCCTAACCAACACGTTGAACATCTGCGCCGGCCACATCGCCTTCAGGGAAGAAATACTGGCGCACAACGAGTACAAAACTCTCTCCAACCTAACCAGCAAAATCTGTCGGCAACTTTCTTTCATTCAAAGCGAAAAGGAGATGGGAGTAGAGGGCGAGATCGCAGCGAAATCGAGCATAAAAAACAAGGAACTCGAAGAAGACATGCAAATGTTGGTGAAGTTGGTGCTTGAGAAATATGGGGGCATAGATAGAAATATAAAGAAAGCGTTTTTGGCAGTTGCGAAGACTTATTATTACAGAGCGTATCATGCCGCCGACACCATAGACACACACATGTTTAAAGTGCTTTTCGAGCCAGTCGCGTGA

   

  1. Expression of SmCPS1 with our device

  To get the optimal bacterial culture condition of Tac Promoter -RBS -GST -Thrombin protease -SmCPS1 -TEV -GFP -Terminator device, we compared the intensity of fluorescence of the bacteria under different temperature, concentration of IPTG, cultivation time and optical density (OD). Higher intensity of fluorescence indicates higher expression of GFP and higher production of fusion protein expressed by Promoter -RBS -GST -Thrombin protease -SmCPS1 -TEV -GFP -Terminator device under a better working condition.
  Figure 10 indicates that the highest fluorescence intensity appears at 37℃, but as the temperature goes higher more inclusion bodies will be produced, which would cause negative effects on our experiment. Thus, the temperature in our later experiments are all set at 20℃.
  Figure 10, 11, 12, 13 show that at 20℃, IPTG 1.0mmoL, culture time 12 h, and OD 0.6 with IPTG induction make the optimal condition, under which we performed culture of our genetically-engineered bacteria and synthesis of SmCPS1 protein.

   

  

  Figure 10. Fluorescence Intensity of E. coli under different temperature.
  This figure showed the result of green fluorescence intensity test of the bacteria (Tac Promoter -RBS -GST -Thrombin protease -SmCPS1 -TEV -GFP -Terminator device) when OD =0.8, Concentration of IPTG=1.0mmoL and after 10 hours of cultivation.

   

  

  Figure 11. Fluorescence Intensity of E. coli induced by different concentration of IPTG
  This figure showed the results of the green fluorescence intensity test of the bacteria (Tac Promoter -RBS -GST -Thrombin protease -SmCPS1 -TEV -GFP -Terminator device) when OD=0.8, temperature = 20℃, and after 10 hours of cultivation.
  

  

  
  Figure 12. Fluorescence Intensity of E. coli after different time of cultivation

  This figure showed the results of the green fluorescence intensity test of the bacteria (Tac Promoter -RBS -GST -Thrombin protease -SmCPS1 -TEV -GFP -Terminator device) when OD = 0.8, temperature = 20℃, and induced by 1.0mmol IPTG .

  

  Figure 13. Fluorescence Intensity of E. coli with different OD
  This figure showed the result of green fluorescence intensity test of the bacteria (Tac Promoter -RBS -GST -Thrombin protease -SmCPS1 -TEV -GFP -Terminator device) when temperature = 20℃, concentration of IPTG = 1.0mmol, and after 10 hours of cultivation.

  Then we used the optimal condition to produce our target recombinant proteins. During the enrichment of the bacterial process, we checked the GFP fluorescence of the bacterial. And the result showed that the GFP fluorescence was observed (Fig 14). It indicated that our SmCPS1-GFP recombinant protein has been expressed in the bacteria
  

  

  Fig 14 The GFP fluorescence of the bacterial precipitation.

  After ultrasonication, we used the SDS-PAGE electrophoresis to detect our target protein, and the result showed that we successfully produced our recombinant protein (Fig 15).
  

  

  Fig 15 Th e SDS-PAGE electrophoresis of recombinant protein

  
  Lane 1, total protein without IPTG induction; Lane 2, supernatant without IPTG induction; Lane 3, total protein with IPTG induction; Lane 4, supernatant with IPTG induction. Black arrow shows the targeted recombinant proteins.
  In order to verify the successful expression of SmCPS1 with our device, we performed sonication on E. coli cells and smashed them. Then the supernatant fluid and total protein were collected for the SDS protein electrophoresis. The results of the SDS-PAGE showed that with induction of IPTG, the protein SmCPS1 can be successfully expressed by our device, with size of 136 KD, which is in accordance with our expectation.

   

           Next we committed Western Blot method to detect the existence of GST tag by using GST antibody. The results showed that, under both situations, bacteria successfully expressed our recombinant protein. It also showed that, the concentration of soluble SmCPS1 produced by the IPTG-induced bacteria is much greater than that of the protein produced by the non-IPTG-induced one (Fig 16).
  
  Fig 16 Western blot result using GST antibody. Lane a, total protein without IPTG induction; Lane b, total protein with IPTG induction; Lane c, supernatant without IPTG induction; Lane d, supernatant with IPTG induction.