Difference between revisions of "Team:Mingdao/Parts"

Lpp and OmpA are outer membrane proteins of E. coli. Lpp-OmpA (LO) hybrid can direct heterologous proteins to bacterial cell surface. In 2015, NCTU-Formosa used it to display scFv (single chain fragment variable) antibodies on the surface of E. coli. They found that a fusion protein cannot be possible to be created under the standard BioBrick assembly rule, that is EcoRI(E)-XbaI(X)-GENE-SpeI(S)-PstI(P). The A part of EX-LO-SP and the B part of EX-scFV-SP, for example, are connected by cutting and ligation of SpeI plus PstI for the A part and XbaI plus PstI for the B part. The SCAR generated by XbaI/SpeI (ACTAGA) will form a stop codon just in front of the ATG start codon of the scFV protein of the B part. This situation has been officially mentioned by the BioBrick standard assembly.

Figure 5: Limitation of cloning a fusion protein by standard biobrick assembly

Therefore, in 2015, NCTU-Formosa created a novel part (BBa_K1694002) putting NcoI site between the LO part and SpeI site. However, when considering cloning, we found that an extra NcoI site is present on Cm resistance gene making it difficult be a vector for gene cloning.

In 2016, Mingdao improved the part by replacing NcoI site with BamHI site (BBa_K1991004). Also, we’ve confirmed and prove the function of LO directing a fusion protein to the cell surface with enzyme activity in our project.

Figure 6: Alternative methods of cloning a fusion protein on Biobrick parts designed and created by NCTU-FORMOSA in 2015 and MINGDAO in 2016

BBa_K1991004: Lpp-OmpA-BamHI/pSB1C3 (PDF; VF2) The DNA fragment of Lpp-OmpA was amplified by PCR using BBa_K1694035 as a template with a primer containing BamHI site and digested by EcoRI and SpeI, followed by cloning onto pSB1C3 which was cut by EcoRI and SpeI. The part has been confirmed by sequencing.

BBa_K1991007: Pcons-RBS-LO-BamHI/pSB1C3 (PDF; VF2) The DNA fragment of Pcons-RBS-Lpp-OmpA was amplified by PCR using BBa_K1694035 as a template with a primer containing BamHI site and digested by EcoRI and SpeI, followed by cloning onto pSB1C3 which was cut by EcoRI and SpeI. The part has been confirmed by sequencing.

LO-AOX1-His/pSB1C3

Registry: BBa_K1991005
Source: Escherichia coli & Pichia pastoris
Original Part: BBa_K1991000, BBa_K1991004
Notebook: PDF; Sequencing: VF2, VR

Primers:
1. AOX1-BamHI-F: 5’- GAACGAGGATCCATGGCTATTCCGGAAGAGTT -3’
2. T7T-SpeI-PstI-R: 5’- AAGAGACTGCAGCGGCCGCTACTAGTATATAGTTCCTCCTTTCAG -3’

Cloning Procedure:
The DNA fragment of AOX1-His was amplified by PCR and digested by BamHI and PstI, followed by cloning onto LO-BamHI/pSB1C3 which was cut by BamHI and PstI. The part has been confirmed by sequencing.

LO-AOX2-His/pSB1C3

Registry:BBa_K1991006
Source: Escherichia coli & Pichia pastoris
Original Part: BBa_K1991001, BBa_K1991004
Notebook: PDF; Sequencing: VF2, VR

Primers:
1. AOX2-BamHI-F: 5’- AAACGAGGATCCATGGCCATCCCTGAGGAATTTG -3’
2. T7T-SpeI-PstI-R: 5’- AAGAGACTGCAGCGGCCGCTACTAGTATATAGTTCCTCCTTTCAG -3’

Cloning Procedure:
The DNA fragment of AOX2-His was amplified by PCR and digested by BamHI and PstI, followed by cloning onto LO-BamHI/pSB1C3 which was cut by BamHI and PstI. The part has been confirmed by sequencing.

To analyze the AOX gene expression, we run on a SDS-PAGE gel and observed by Coomassie Blue staining. The overnight-cultured E. coli were centrifuged and lysed with Lysis Buffer (12.5 mM Tris pH 6.8, 4% SDS). The resulting lysates were subjected to SDS-PAGE with a 10% polyacrylamide gel. The gel was stained with 0.25% Coomassie Brilliant Blue R250 for 2 hours and destained until the protein bands were clear. As the data showed in Figure 2, LO protein was expressed at around the estimated molecular weight of 17 kDa, LO-AOX fusion protein at 91 kDa and AOX protein at 79 kDa. The protein expression level was consistent with the data of GFP in Figure 1, demonstrating the low gene expression level of a LO fusion protein. However, so far we cannot confirm whether LO fusion protein is able to direct AOX or GFP proteins displayed on the cell surface of E. coli. We’re planning to do a subcellular fractionation to separate the outer membrane proteins for analysis in the future.

Figure 2: AOX protein analysis. SDS-PAG and Coomassie Blue staining were used to observe protein expression level. Lane 1: wild-type E. coli as a mock control; Lane 2: LO outer membrane protein [BBa_K1991007] (17 kDa) expression in E. coli; Lane 3: LO-AOX fusion protein [BBa_K1991009] (91 kDa) expression in E. coli.; Lane 4: AOX protein [BBa_K1991003] (79 kDa) expression in E. coli.

After AOX gene expression was confirmed, we want to know its enzyme activity. AOX catalyzes the oxidation of alcohol in the following chemical reaction C2H5OH + O2 CH3CHO + H2O2 and generates hydrogen peroxide. We examined the activity of AOX enzyme by measuring H2O2 production from the oxidation of ethanol. Fluorimetric Hydrogen Peroxide Assay Kit of Sigma-Aldrich was used for the study. In the kit, the red peroxidase substrate is designed to react with hydrogen peroxide to generate red fluorescence signal that can be detected at Ex/Em = 540/590 nm in the microplate reader. We prepared 1ml of overnight cultured E. coli displaying LO-AOX enzyme [BBa_K1991009]. The bacteria were centrifuged and resolved in Assay Buffer provided by the Sigma-Aldrich kit. Then, the resulting lysates were mixed with the increasing concentrations of ethanol from 0%, 0.025%, 0.05%, 0.075%, 0.10%, 0.15% to 0.2% for 3 minutes at room temperature. The tested alcohol concentrations were at the range from 0.03% (the alcohol law limit for safety driving) to 0.2% (people may lose consciousness at this level). The following procedure was according to the manufacture’s instruction. The data were read out at Ex/Em = 540/590 nm in the microplate reader (BioTek Microplate Spectrophotometer). As Figure 2 showed, the intensities of AOX activity were significantly and linearly correlated to the concentration of ethanol in a dose-dependent manner. The results indicated that LO-AOX enzyme we produced has a functional enzyme activity and reacted with alcohol concentration dose-dependently, implying we can use this assay to measure the unknown sample of alcohol.

Figure 2: AOX protein analysis. SDS-PAG and Coomassie Blue staining were used to observe protein expression level. Lane 1: wild-type E. coli as a mock control; Lane 2: LO outer membrane protein [BBa_K1991007] (17 kDa) expression in E. coli; Lane 3: LO-AOX fusion protein [BBa_K1991009] (91 kDa) expression in E. coli.; Lane 4: AOX protein [BBa_K1991003] (79 kDa) expression in E. coli.

The following is the message from iGEM team NCTU-FORMOSA:

“To test the enzyme activity of AOX protein, which catalyzes the oxidation of alcohol and generates H2O2 products, produced by iGEM Team Mingdao, we performed HRP-TMB assay. TMB (3,3',5,5'-Tetramethylbenzidine) is oxidized and changed to a deep blue color during the enzymatic degradation of H2O2 by horse radish peroxidase (HRP). The concentration of H2O2 can be determined by checking the color change, indicating TMB assay can be used to examine the enzyme activity of AOX with the substrate of alcohol.

We cultivated 3ml of the E.coli DH5α carrying the Mingdao iGEM team’s biobrick (i.e., Pcons-RBS-LO-AOX/pSB1C3, BBa_K1991009) in the LB media supplemented with Chloramphenicol. And we prepared another one as the control which didn’t have any plasmid. The next day, we centrifuged 1mL of bacteria expressing LO-AOX enzyme followed by being suspended in PBS. The control group was adjusted to the OD values at the same level of the LO-AOX group. After mixing bacterial samples with ethanol, TMB was added as a substrate of HRP and incubated in the dark for 3 min. The color of solution was significantly changed to blue at an OD650 of 1.51 compared to 1.21 in the control group, clearly demonstrating the ethanol was oxidized by AOX. As a result, we proved the function of their BioBrick by testing the AOX enzyme activity.”