|
|
(101 intermediate revisions by 8 users not shown) |
Line 3: |
Line 3: |
| <!--[if IE 8 ]><html class="no-js ie ie8" lang="en"> <![endif]--> | | <!--[if IE 8 ]><html class="no-js ie ie8" lang="en"> <![endif]--> |
| <!--[if (gte IE 8)|!(IE)]><!--> | | <!--[if (gte IE 8)|!(IE)]><!--> |
− | <html class="no-js" lang="en"> | + | <html class="no-js" lang="en"> |
− | <!--<![endif]--> | + | <!--<![endif]--> |
− | <head> | + | <head> |
− | <!--- Basic Page Needs========================================================================= --> | + | <!--- Basic Page Needs========================================================================= --> |
− | <meta charset="utf-8">
| + | <meta charset="utf-8"/> |
− | <title>Standard</title>
| + | <title>Proof</title> |
− | <meta name="viewport" content="width=device-width, initial-scale=1.0, maximum-scale=1.2, user-scalable=yes" />
| + | <meta name="viewport" content="width=device-width, initial-scale=1.0, maximum-scale=1.2, user-scalable=yes" /> |
− | <meta name="description" content="Wiki of Peking iGEM 2016" />
| + | <meta name="description" content="Wiki of Peking iGEM 2016" /> |
− | <meta name="author" content="Li Jiamian & Wang Yuqing">
| + | <meta name="author" content="Li Jiamian & Wang Yuqing"/> |
− | <meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
| + | <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> |
− | <!-- Mobile Specific Metas===================================================================== --> | + | <!-- Mobile Specific Metas===================================================================== --> |
− | <meta name="viewport" content="width=device-width, initial-scale=1, maximum-scale=1">
| + | <meta name="viewport" content="width=device-width, initial-scale=1, maximum-scale=1"/> |
− | <!-- Fix Overwrite the original iGEM style=================================================== --> | + | <!-- Fix Overwrite the original iGEM style=================================================== --> |
− | <link href="https://2016.igem.org/Template:Peking/css/fix?action=raw&ctype=text/css" rel="stylesheet" />
| + | <link href="https://2016.igem.org/Template:Peking/css/fix?action=raw&ctype=text/css" rel="stylesheet" /> |
− | <!-- CSS======================================================================================= --> | + | <!-- CSS======================================================================================= --> |
− | <link href="https://2016.igem.org/Template:Peking/css/bootstrap_min?action=raw&ctype=text/css" rel="stylesheet" />
| + | <link href="https://2016.igem.org/Template:Peking/css/bootstrap_min?action=raw&ctype=text/css" rel="stylesheet" /> |
− | <link href="https://2016.igem.org/Template:Peking/css/style?action=raw&ctype=text/css" rel="stylesheet" />
| + | <link href="https://2016.igem.org/Template:Peking/css/style?action=raw&ctype=text/css" rel="stylesheet" /> |
− | <!-- flexslider================================================================================ --> | + | <!-- CSS======================================================================================= --> |
− | <link rel="stylesheet" type="text/css" media="all" href="https://2016.igem.org/Template:Peking/css/fstyle?action=raw&ctype=text/css" />
| + | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/default?action=raw&ctype=text/css"/> |
− | <link rel='stylesheet' id='responsive-css' href='https://2016.igem.org/Template:Peking/css/responsive?action=raw&ctype=text/css' type='text/css' media='all' />
| + | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/layout?action=raw&ctype=text/css"/> |
− | <link rel='stylesheet' id='polaroid-slider-css' href='https://2016.igem.org/Template:Peking/css/fpolaroid?action=raw&ctype=text/css' type='text/css' media='all' />
| + | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/media-queries?action=raw&ctype=text/css"/> |
− | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery?action=raw&ctype=text/javascript'></script>
| + | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/priorstyle?action=raw&ctype=text/css"/> |
− | <!-- CSS======================================================================================= --> | + | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/notebook_panel?action=raw&ctype=text/css"/> |
− | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/default?action=raw&ctype=text/css">
| + | <style> |
− | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/layout?action=raw&ctype=text/css">
| + | .texttitle{ |
− | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/media-queries?action=raw&ctype=text/css">
| + | color: #11abb0; |
− | <link href="normalstyle.css" rel="stylesheet" />
| + | font-size: 38px; |
− | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/priorstyle?action=raw&ctype=text/css">
| + | line-height: 48px; |
| + | margin-bottom: 12px; |
| + | font-family: raleway-bold, sans-serif !important; |
| + | background: transparent; |
| + | letter-spacing: 3px; |
| + | text-transform: uppercase; |
| + | font-weight: 350; |
| + | text-align: center; |
| + | } |
| + | sup{font-size:11px;} |
| + | .references{margin-top:150px;margin-bottom:40px;} |
| + | .references p{font-size:14px !important; color:#666161 !important;} |
| + | .classic-title {font-weight: 300;} |
| + | .classic-title span { |
| + | padding-bottom: 8px; |
| + | border-bottom: 1px solid #383232; |
| + | font-weight: 400; |
| + | } |
| + | figure{margin-top:40px;margin-bottom:40px;height:auto;} |
| + | .anchor{padding-top:100px;margin-top:-100px;} |
| + | </style> |
| + | |
| + | </head> |
| + | |
| + | |
| + | |
| + | <body> |
| + | |
| + | <!-- Navigation --> |
| + | <div id="navigation" class="navbar navbar-fixed-top"> |
| + | <div class="navbar-inner "> |
| + | <div class="container no-padding"> |
| + | <a class="show-menu" data-toggle="collapse" data-target=".nav-collapse"><span class="show-menu-bar"></span> |
| + | </a> |
| + | <div id="logo" style="max-width:170px"><a class="" href="https://2016.igem.org/Team:Peking"></a></div> |
| + | |
| + | <div class="nav-collapse collapse"> |
| + | <ul class="nav"> |
| + | <li class="menu-1"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking" >Home</a></li> |
| + | <li class="dropdown menu-2"><a class="dropdown-toggle" data-toggle="dropdown" href="#" > Achievements</a> |
| + | <ul class="dropdown-menu"> |
| + | <li><a href="https://2016.igem.org/Team:Peking/Results" >Results</a></li> |
| + | <li><a href="https://2016.igem.org/Team:Peking/Basic_Part" >Parts</a></li> |
| + | <li><a href="https://2016.igem.org/Team:Peking/Collaborations" >Collaborations</a></li> |
| + | </ul> |
| + | </li> |
| + | <li class="dropdown menu-3"><a class="dropdown-toggle" data-toggle="dropdown" href="#">Project</a> |
| + | <ul class="dropdown-menu"> |
| + | <li><a href="https://2016.igem.org/Team:Peking/Description" >Overview</a></li> |
| + | <li><a href="https://2016.igem.org/Team:Peking/Design" >Design</a></li> |
| + | <li><a href="https://2016.igem.org/Team:Peking/Crosslinking" >Crosslinking</a></li> |
| + | <li><a href="https://2016.igem.org/Team:Peking/Uranyl-adsorption" >Uranyl adsorption</a></li> |
| + | <li><a href="https://2016.igem.org/Team:Peking/Clearance" >Clearance</a></li> |
| + | <li><a href="https://2016.igem.org/Team:Peking/Secretion" >Secretion</a></li> |
| + | <li><a href="https://2016.igem.org/Team:Peking/Demonstrate" >Final Performance</a></li> |
| + | </ul> |
| + | </li> |
| + | <li class="dropdown menu-4"><a class="dropdown-toggle" data-toggle="dropdown" href="#" >Modeling</a> |
| + | <ul class="dropdown-menu"> |
| + | <li><a href="https://2016.igem.org/Team:Peking/Model/GelPoint" > Model of Gel Point </a></li> |
| + | <li><a href="https://2016.igem.org/Team:Peking/Model/MassDistribution" > Model of Mass Distribution</a></li> |
| + | <li><a href="https://2016.igem.org/Team:Peking/Software" >Software</a></li> |
| + | </ul> |
| + | </li> |
| + | <li class="dropdown menu-5"><a class="dropdown-toggle" data-toggle="dropdown" href="#" >Practices</a> |
| + | <ul class="dropdown-menu"> |
| + | <li><a href="https://2016.igem.org/Team:Peking/HP/Gold" >Overview</a></li> |
| + | <li><a href="https://2016.igem.org/Team:Peking/HP/311" >Field research</a></li> |
| + | <li><a href="https://2016.igem.org/Team:Peking/HP/questionnaire" >Questionnaire</a></li> |
| + | <li><a href="https://2016.igem.org/Team:Peking/HP/consulting" >Consulting</a></li> |
| + | <li><a href="https://2016.igem.org/Team:Peking/HP/otherHP" >Education & Other</a></li> |
| + | </ul> |
| + | </li> |
| + | <li class="menu-6"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking/Safety" >Safety</a> |
| + | <li class="dropdown menu-7"><a class="dropdown-toggle" data-toggle="dropdown" href="#" >Lab</a> |
| + | <ul class="dropdown-menu"> |
| + | <li><a class="" href="https://2016.igem.org/Team:Peking/Team" >Team</a></li> |
| + | <li><a class="" href="https://2016.igem.org/Team:Peking/Attributions" >Attribution</a></li> |
| + | <li><a class="" href="https://2016.igem.org/Team:Peking/Notebook" >Notebook</a></li> |
| + | </ul> |
| + | </li> |
| + | <li class="menu-8"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking/Interlab" >Interlab</a> |
| + | </li> |
| + | </div> |
| + | </div> |
| + | </div> |
| + | </div> |
| + | <!--/Navigation --> |
| | | |
− | </head>
| |
| | | |
− | <body>
| |
− | <!-- Navigation -->
| |
− | <div id="navigation" class="navbar navbar-fixed-top">
| |
− | <div class="navbar-inner ">
| |
− | <div class="container no-padding">
| |
− | <a class="show-menu" data-toggle="collapse" data-target=".nav-collapse"><span class="show-menu-bar"></span>
| |
− | </a>
| |
− | <div id="logo" style="max-width:170px"><a class="" href="https://2016.igem.org/Team:Peking"></a></div>
| |
− |
| |
− | <div class="nav-collapse collapse">
| |
− | <ul class="nav">
| |
− | <li class="menu-1"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking" >Home</a></li>
| |
− | <li class="dropdown menu-2"><a class="dropdown-toggle" data-toggle="dropdown" href="#">Project</a>
| |
− | <ul class="dropdown-menu">
| |
− | <li><a href="https://2016.igem.org/Team:Peking/Description" >Decription</a></li>
| |
− | <li><a href="https://2016.igem.org/Team:Peking/Design" >Design</a></li>
| |
− | <li><a href="https://2016.igem.org/Team:Peking/Proof" >Proof of Concept</a></li>
| |
− | <li><a href="https://2016.igem.org/Team:Peking/Demonstrate" >Demonstrate</a></li>
| |
− | </ul>
| |
− | </li>
| |
− | <li class="dropdown menu-3"><a class="dropdown-toggle" data-toggle="dropdown" href="#" >Parts</a>
| |
− | <ul class="dropdown-menu">
| |
− | <li><a href="https://2016.igem.org/Team:Peking/Basic_Part" >Basic parts</a></li>
| |
− | <li><a href="https://2016.igem.org/Team:Peking/Composite_Part" >Composite parts</a></li>
| |
− | <li><a href="https://2016.igem.org/Team:Peking/Part_Collection" >Parts collection</a></li>
| |
− | </ul>
| |
− | </li>
| |
− | <li class="menu-4"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking/Human_Practices" >Practices</a></li>
| |
− | <li class="menu-5"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking/Collaborations" >Collaboration</a></li>
| |
− | <li class="menu-6"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking/Model" >Modeling</a></li>
| |
− | <li class="dropdown menu-7"><a class="dropdown-toggle" data-toggle="dropdown" href="#" >Lab</a>
| |
− | <ul class="dropdown-menu">
| |
− | <li><a class="" href="https://2016.igem.org/Team:Peking/Team" >Team</a></li>
| |
− | <li><a class="" href="https://2016.igem.org/Team:Peking/Attributions" >Attribution</a></li>
| |
− | <li><a class="" href="https://2016.igem.org/Team:Peking/Notebook" >Notebook</a></li>
| |
− | </ul>
| |
− | </li>
| |
− | <li class="dropdown menu-8"><a class="dropdown-toggle" data-toggle="dropdown" href="https://2016.igem.org/Team:Peking/Interlab" >Interlab</a>
| |
− | </li>
| |
− | </div>
| |
− | </div>
| |
− | </div>
| |
− | </div>
| |
− | <!--/Navigation -->
| |
| | | |
− | <!-- Page Title======================================================================== -->
| |
− | <div id="page-title">
| |
− | <div class="row">
| |
− | <div class="twelve columns centered text-center">
| |
− | <h1>Interlab<span>.</span></h1>
| |
− | <p class="title1" style="text-align:center">This is the special page for team members to learn how to edit.dslkf jadlka gkgjglsg lksdll asd kdfj asdf adf sadf asdf</p>
| |
− | </div>
| |
− | </div>
| |
− | </div>
| |
− | <!-- Page Title End-->
| |
| | | |
− | | + | <!-- Page Title======================================================================== --> |
| + | <div id="page-title"> |
| + | <div class="row"> |
| + | <div class="twelve columns centered text-center"> |
| + | <h1>Interlab</h1> |
| + | <p class="title1" style="text-align:center">The Peking iGEM 2016 team is participating in the third year of the iGEM Interlab study along with about 100 teams. We focused on quantifying expression of GFP in common, comparable or absolute units. </p> |
| + | </div> |
| + | </div> |
| + | </div> |
| + | <!-- Page Title End--> |
| + | |
| + | |
| + | |
| + | <style type="text/css"> |
| + | .texttitle{ |
| + | color: #11abb0; |
| + | font-size: 38px; |
| + | line-height: 48px; |
| + | margin-bottom: 12px; |
| + | font-family: raleway-bold, sans-serif; |
| + | background: transparent; |
| + | letter-spacing: 3px; |
| + | text-transform: uppercase; |
| + | font-weight: 350; |
| + | text-align: center; |
| + | } |
| + | #primary span{ |
| + | display:block; |
| + | word-break:break-all |
| + | } |
| + | |
| + | #page-wrap { |
| + | width: 25%; |
| + | margin: 0px; |
| + | position: relative; |
| + | } |
| + | |
| + | #sidebar { |
| + | width: 25%; |
| + | margin-left: 0px; |
| + | } |
| + | @media (min-width:1024px){ |
| + | #sidebar{position:relative;top:120px;max-width:200px;}} |
| + | @media (max-width: 1023px){ |
| + | #sidebar{display:none; |
| + | } |
| + | #page-wrap{display:none;} |
| + | } |
| + | |
| + | .classic-title { |
| + | margin-bottom: 16px; |
| + | border-bottom: 1px solid #eee; |
| + | font-weight: 300; |
| + | margin- |
| + | } |
| + | |
| + | |
| + | .classic-title span { |
| + | padding-bottom: 8px; |
| + | border-bottom: 1px solid #383232; |
| + | font-weight: 400; |
| + | } |
| + | |
| + | .p > small{ |
| + | margin-bottom:5px; |
| + | } |
| + | .texttext h4{ |
| + | margin-top:50px; |
| + | } |
| + | </style> |
| + | |
| + | |
| + | <script type="text/javascript"> |
| + | |
| + | |
| + | function menuFixed(id){ |
| + | var obj = document.getElementById(id); |
| + | var _getHeight = obj.offsetTop; |
| + | |
| + | window.onscroll = function(){ |
| + | changePos(id,_getHeight); |
| + | } |
| + | } |
| + | function changePos(id,height){ |
| + | var obj = document.getElementById(id);var windowBottom = $(window).scrollTop() + $(window).innerHeight(); |
| + | if(w>=1024){ |
| + | if($(window).scrollTop() + $(window).height() > $(document).height() - 230){ |
| + | $('#sidebar').fadeOut("fast");}else{$('#sidebar').fadeIn("fast");} |
| + | } |
| + | var scrollTop = document.documentElement.scrollTop || document.body.scrollTop -230; |
| + | var windowBottom = $(window).scrollTop() + $(window).innerHeight(); |
| + | var w = window.innerWidth; |
| + | |
| + | if(scrollTop < height){ obj.style.position = 'relative'; |
| + | }else{ |
| + | obj.style.position = 'fixed'; |
| + | } |
| + | } |
| + | </script> |
| + | |
| + | <script type="text/javascript"> |
| + | window.onload = function(){ |
| + | menuFixed('sidebar'); |
| + | } |
| + | </script> |
| + | |
| + | |
| + | |
| + | |
| + | |
| + | |
| + | <div id="page-content" class="row page"> |
| + | <div id="primary" class="twelve columns"> |
| | | |
− | <!-- Content=========================================================================== --> | + | <section> |
− | <div id="page-content" class="row page">
| + | <div class="row"> |
− | <div id="primary" class="twelve columns">
| + | |
− |
| + | |
− | <section>
| + | <div class="three columns"> |
− | <div class="row">
| + | <div id="page-wrap"> |
− |
| + | <div id="sidebar" style="color:#000000"> |
| | | |
− | <div class="tweleve columns">
| + | <h4>Methods</h4> |
− |
| + | <ul> |
− | <div>
| + | <li><a href="#background">Background</a></li> |
− | <h4>Background</h4>
| + | <li><a href="#design">Design</a></li> |
− | <p>“All of the 2016 iGEM teams are invited and encouraged to participate in the Third International InterLaboratory Measurement Study in synthetic biology.” Our team took part in this study which aimed to standardize the measurements of fluorescence in different labs. The main task was to quantify expression of GFP in common, comparable or absolute units. In our case, we measured fluorescence using plate reader.
| + | <li><a href="#materials">Materials</a></li> |
− | </p> | + | <li><a href="#protocol">Protocol</a></li> |
− | </div>
| + | </ul> |
− | | + | <h4>Description</h4> |
− | <div>
| + | <h4>Results</h4> |
− | <h4>Design</h4>
| + | <ul> |
− | <p>Fluorescence is widely used as a proxy for promoter activity by expressing fluorescent proteins such as green fluorescent protein (GFP). While this is an indirect measurement, it provides a useful insight into expression levels and has the significant advantage that it can be monitored continuously without disrupting cells.
| + | <li><a href="#sequencing">Sequencing</a></li> |
− | </p> | + | <li><a href="#data">Data</a></li> |
− | <p>Fluorescence/OD600 is routinely used to give an adjustment of the relative expression per cell.</p>
| + | </ul> |
− | <p>We aim to do this using the supplied FITC as a standard reference material. You will measure the fluorescence of your instrument using a dilution series of this reference material to construct a standard curve. We have previously performed this standard curve on our own instrument alongside a standard curve for purified GFP. Using these standard curves alongside your own standard curve for FITC it is thus possible to transform your relative measurements of fluorescence into absolute measurements of GFP molecules.</p>
| + | <h4>Discussion</h4> |
− | <p>However, we aim to control for instrument variability, at least to some degree, by measuring a standard scattering solution of a mono-dispersed silica suspension (LUDOX). The objective is to see if a simple, single fixed-point measurement can be used as a ratiometric adjustment to provide greater uniformity in fluorescence/OD600 measurements across sites.</p>
| + | </div> |
| + | </div> |
| + | |
| + | |
| </div> | | </div> |
| | | |
| | | |
− | <div>
| + | <div class="nine columns texttext"> |
− | <h4>Materials and methods</h4>
| + | <div class="texttitle">Methods</div> |
− | <h6>Used plasmids</h6>
| + | <div> |
− | <p style="margin:0 0 0 0">• Plasmid DNA (100 pg/uL in 10uL of Buffer EB)</p>
| + | <a id="background"></a> |
− | <div style="padding-left:20px">
| + | <h3 class="classic-title";"><span>Background</span></h3> |
− | <p>
| + | <p>“All of the 2016 iGEM teams are invited and encouraged to participate in the Third International InterLaboratory Measurement Study in synthetic biology.” Our team took part in this study which aimed to standardize the measurements of fluorescence in different labs. The main task was to quantify expression of GFP in common, comparable or absolute units. In our case, we measured fluorescence using plate reader. |
− | o Test Device 1: J23101.B0034.E0040.B0015 in pSB1C3<br>
| + | </p> |
− | o Test Device 2: J23106.B0034.E0040.B0015 in pSB1C3<br>
| + | </div> |
− | o Test Device 3: J23117.B0034.E0040.B0015 in pSB1C3<br>
| + | |
− | o Positive Control Device: I20270 in pSB1C3 Also located in Kit Plate 3, well 8P<br>
| + | <div> |
− | o Negative Control Device: R0040 in pSB1C3 Also located in Kit Plate 2, well 6F<br>
| + | <a id="design"></a> |
− | </p>
| + | <h3 class="classic-title";"><span>Design</span></h3> |
− | </div>
| + | <p>Fluorescence is widely used as a proxy for promoter activity by expressing fluorescent proteins such as green fluorescent protein (GFP). Despite this is an indirect measurement, it provides a useful insight into expression levels and has significant advantage that it could be ontinuously monitored without disrupting cells. |
− |
| + | </p> |
| + | <p>Fluorescence/OD600 is routinely used to give an adjustment of the relative expression per cell.</p> |
| + | <p>We aim to do this using the supplied FITC as a standard reference material. The standard curve could be constructed via measuring the fluorescence of a dilution series. We have previously performed this standard curve on our own instrument alongside a standard curve for purified GFP. Using these standard curves alongside your own standard curve for FITC it is thus possible to transform your relative measurements of fluorescence into absolute measurements of GFP molecules.</p> |
| + | <p>However, we aim to contain instrument variability, at least to some degree, by measuring a standard scattering solution of a mono-dispersed silica suspension (LUDOX). The objective is to see if a simple, single fixed-point measurement can be used as a ratiometric adjustment to provide greater uniformity in fluorescence/OD600 measurements across sites.</p> |
| + | </div> |
| + | |
| + | |
| + | <div> |
| + | <a id="materials"></a> |
| + | <h3 class="classic-title";"><span>Materials and methods</span></h3> |
| + | <h5>Plasmids used</h5> |
| + | <p style="margin:0 0 0 0">• Plasmid DNA (100 pg/uL in 10uL of Buffer EB)</p> |
| + | <div style="padding-left:20px"> |
| + | <p> |
| + | o Test Device 1: J23101.B0034.E0040.B0015 in pSB1C3<br> |
| + | o Test Device 2: J23106.B0034.E0040.B0015 in pSB1C3<br> |
| + | o Test Device 3: J23117.B0034.E0040.B0015 in pSB1C3<br> |
| + | o Positive Control Device: I20270 in pSB1C3 (Also located in Kit Plate 3, well 8P)<br> |
| + | o Negative Control Device: R0040 in pSB1C3 (Also located in Kit Plate 2, well 6F)<br> |
| + | </p> |
| + | </div> |
| + | |
| + | |
| + | <h5>Strain used</h5> |
| + | <p>• <i>Escherichia coli</i> TOP10</p> |
| + | |
| + | <h5>Materials</h5> |
| + | <p> |
| + | • FITC Standard: one tube with dried down FITC for creating a FITC standard<br> |
| + | • LUDOX: one tube with 30% colloidal silica suspended in 1mL of water<br> |
| + | • 1xPBS (phosphate buffered saline)<br> |
| + | • LB (Luria Bertani) media<br> |
| + | • Chloramphenicol (stock concentration 25 mg/mL dissolved in EtOH)<br> |
| + | • 50 ml Falcon tube (or equivalent) or 250 ml shake flask for cell growth<br> |
| + | • 1.5 ml eppendorf tubes for sample storage<br> |
| + | • Ice bucket with ice<br> |
| + | • Pipettes<br> |
| + | • 96 well plate <br> |
| + | </p> |
| + | |
| + | <h5>Machines</h5> |
| + | <p> |
| + | • Thermo VARIOSKAN FLASH<br> |
| + | • MAPADA UV-3100PC SPECTROPHOTOMETER<br> |
| + | • YKKY(FM40)<br> |
| + | • AISITE electro-heating standing-temperature cultivator<br> |
| + | • HONOUR INCURATOR SHAKER<br> |
| + | |
| + | </p> |
| + | |
| + | <h5>Software</h5> |
| + | <p> |
| + | • Microsoft Excel<br> |
| + | |
| + | </p> |
| + | |
| + | <h5>Methods</h5> |
| + | <p style="margin:0 0 0 0">• Calibration</p> |
| + | <div style="padding-left:45px"> |
| + | <p> |
| + | o OD600 Reference point<br> |
| + | o FITC fluorescence standard curve<br> |
| + | o Test Device 3: J23117.B0034.E0040.B0015 in pSB1C3<br> |
| + | </p> |
| + | </div> |
| + | <p style="margin:0 0 0 0">• Cell measurement</p> |
| + | <div style="padding-left:45px"> |
| + | <p> |
| + | o Transformation<br> |
| + | o Measurements <br> |
| + | </p> |
| + | </div> |
| + | |
| + | |
| + | </div> |
| + | |
| + | |
| + | <a id="protocol"></a> |
| + | <h3 class="classic-title";"><span>Protocols</span></h3> |
| + | <div style="padding-left:45px"> |
| + | <p><a href="https://2016.igem.org/Team:Peking/Interlab/Protocol:Calibration">>>Calibration</a><br> |
| + | <a href="https://2016.igem.org/Team:Peking/Interlab/Protocol:Cell_measurement">>>Cell measurement</a></p> |
| + | </div> |
| + | |
| + | |
| + | <div class="texttitle">Description</div> |
| + | <img src="https://static.igem.org/mediawiki/2016/9/97/T--Peking--image_interlab_1.jpg"> |
| + | <br> |
| + | <img src="https://static.igem.org/mediawiki/2016/a/ab/T--Peking--image_interlab_2.jpg"> |
| + | <p style="text-align:center;"><b>Figure 1. Above: from left to right: D1, D2, D3, Negative, Positive. Below: five mediums containing five different bacteria.</b></p> |
| + | <br> |
| + | <p>Plasmids containing promoters and GFP were taken from The 2016 DNA Distribution Kit and all devices were transformed into <i>E. coli</i>. Fluorescence of colonies was checked up under UV light. </p> |
| + | <p>5 ml of liquid LB-M medium with chloramphenicol were inoculated with two chosen colonies of each device. Liquid cultures were incubated for 16~18 hours in HONOUR INCURATOR SHAKER placed in incubator. OD of these cultures was measured by MAPADA UV-3100PC SPECTROPHOTOMETER and diluted to 0.02. Fluorescence of biological and also technical replicates was measured using Thermo VARIOSKAN FLASH following our protocol. |
| + | </p> |
| + | <a id="sequencing"></a> |
| + | <br> |
| + | <div class="texttitle">Results</div> |
| + | <h3 class="classic-title";"><span>Sequencing</span></h3> |
| + | <p> • Device 1: J23101+I13504<br> |
| + | • Device 2: J23106+I13504<br> |
| + | • Device 3: J23117+I13504<br> |
| + | • Positive Control Device: I20270 in pSB1C3<br> |
| + | • Negative Control Device: R0040 in pSB1C3 </p> |
| + | <p> |
| + | >BBa_J23101 Part-only sequence (35 bp)<br> |
| + | <span style="padding-left:45px">Tttacagctagctcagtcctaggtattatgctagc</span></p><p> |
| + | >BBa_J23106 Part-only sequence (35 bp)<br> |
| + | <span style="padding-left:45px">Tttacggctagctcagtcctaggtatagtgctagc</span></p><p> |
| + | >BBa_J23117 Part-only sequence (35 bp)<br> |
| + | <span style="padding-left:45px">Ttgacagctagctcagtcctagggattgtgctagc</span></p><p> |
| + | >BBa_I13504 Part-only sequence (875 bp)<br> |
| + | <span style="padding-left:45px">Aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata</span></p><p> |
| + | >BBa_I20270 Part-only sequence (919 bp)<br> |
| + | <span style="padding-left:45px">Ttgatggctagctcagtcctaggtacaatgctagctactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata</span></p><p> |
| + | >BBa_R0040 Part-only sequence (54 bp)<br> |
| + | <span style="padding-left:45px">tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac</span> |
| + | </p></p> |
| + | |
| + | <a id="data"></a> |
| + | <h3 class="classic-title";"><span>Data</span></h3> |
| + | <h4>OD600 Reference Point</h4> |
| + | <p><b>Table 1. OD600 Reference Point.</b></p> |
| + | <img src="https://static.igem.org/mediawiki/2016/f/f4/T--Peking--image_interlab_3.png"> |
| + | <br> |
| + | <h4>FITC Standard Curve</h4> |
| + | <p ><b>Table 2. Data of FITC standard curve.</b></p> |
| + | <img src="https://static.igem.org/mediawiki/2016/1/1b/T--Peking--image_interlab_4.png"> |
| + | <img src="https://static.igem.org/mediawiki/2016/0/03/T--Peking--image_interlab_5.png"> |
| + | <p ><b>Figure 2. FITC standard curve.</b></p> |
| + | <br> |
| + | <h4>Normalization</h4> |
| + | <p ><b>Table 3. Normalization.</b></p> |
| + | <img src="https://static.igem.org/mediawiki/2016/d/db/T--Peking--image_interlab_6.png"> |
| + | <br> |
| + | <h4>Cell Measurement</h4> |
| + | <p ><b>Table 4. Raw data of Abs600 measurement.</b></p> |
| + | <img src="https://static.igem.org/mediawiki/2016/0/04/T--Peking--image_interlab_7.png"> |
| + | <p ><b>Table 5. Blank subtraction and correction of Abs600 measurement.</b></p> |
| + | |
| + | |
| + | |
| + | |
| + | |
| + | <img src="https://static.igem.org/mediawiki/2016/e/ee/T--Peking--image_interlab_8.png"> |
| + | <img src="https://static.igem.org/mediawiki/2016/7/71/T--Peking--image_interlab_9.png"> |
| + | <p ><b>Figure 3. Blank subtraction and correction of Abs600 measurement.</b></p> |
| + | <p ><b>Table 6. Raw data of fluorescence measurement.</b></p> |
| + | <img src="https://static.igem.org/mediawiki/2016/5/52/T--Peking--image_interlab_10.png"> |
| + | <p ><b>Table 7. Blank substraction and correction of fluorescence measurement.</b></p> |
| + | <img src="https://static.igem.org/mediawiki/2016/3/32/T--Peking--image_interlab_11.png"> |
| + | <img src="https://static.igem.org/mediawiki/2016/6/67/T--Peking--image_interlab_12.png"> |
| + | <p ><b>Figure 4. Blank subtraction and correction of fluorescence measurement.</b></p> |
| + | <p ><b>Table 8.Raw data of Fl/Abs600.</b></p> |
| + | <img src="https://static.igem.org/mediawiki/2016/d/d3/T--Peking--image_interlab_13.png"> |
| + | <p ><b>Table 9. Raw data of average and SD.</b></p> |
| + | <img src="https://static.igem.org/mediawiki/2016/a/a1/T--Peking--image_interlab_14.png"> |
| + | <img src="https://static.igem.org/mediawiki/2016/0/07/T--Peking--image_interlab_15.png"> |
| + | <p ><b>Figure 4. Average level of devices.</b></p> |
| + | |
| + | |
| + | |
| + | |
| + | |
| + | |
| + | <div class="texttitle">Discussion</div> |
| + | <p>It is noticeable that the promoter of the Device 1 is strongest followed by the promoter of the Device 2 and Device 3.</p> |
| + | |
| + | <h3 class="classic-title";"><span>Appendix</span></h3> |
| + | <p>Individuals responsible for conducting InterLab study |
| + | • Dong Yiming measured the devices. |
| + | • Li Cheng processed the data. |
| + | </p> |
| + | |
| + | |
| | | |
− | <h6>Used strain</h6>
| + | </div> |
− | <p>• <i>Escherichia coli</i> TOP10</p>
| + | </div> <!-- row End --> |
| + | |
| | | |
− | <h6>Used material</h6>
| + | </section> <!-- section end --> |
− | <p style="margin:0 0 0 0">
| + | </div> <!-- primary end --> |
− | • FITC Standard: one tube with dried down FITC for creating a FITC standard<br>
| + | </div> <!-- page-content End--> |
− | • LUDOX: one tube with 30% colloidal silica suspended in 1mL of water<br>
| + | </div> <!-- Content End--> |
− | • 1xPBS (phosphate buffered saline)<br>
| + | |
− | • Terrific broth (at half strength: 0.5x TB) or can use LB (Luria Bertani) media as an alternative<br>
| + | |
− | • Chloramphenicol (stock concentration 25 mg/mL dissolved in EtOH)<br>
| + | |
− | • 50 ml Falcon tube (or equivalent) or 250 ml shake flask for cell growth<br>
| + | |
− | • 1.5 ml eppendorf tubes for sample storage<br>
| + | |
− | • Ice bucket with ice<br>
| + | |
− | • Pipettes<br>
| + | |
− | • 96 well plate <br>
| + | |
− | </p>
| + | |
− |
| + | |
− | </div>
| + | |
− |
| + | |
− |
| + | |
− |
| + | |
− |
| + | |
− |
| + | |
− | </div>
| + | |
| | | |
| | | |
Line 163: |
Line 467: |
| | | |
| | | |
− | </div> <!-- row End -->
| |
− | </section> <!-- section end -->
| |
− | </div> <!-- primary end -->
| |
− | </div> <!-- page-content End-->
| |
− | </div> <!-- Content End-->
| |
| | | |
| | | |
− | <!-- footer============================================================================== -->
| |
− | <style>
| |
− | footer .copyright span:before {
| |
− | content: "|";
| |
− | padding-left: 10px;
| |
− | padding-right: 12px;
| |
− | color: #b4bbbb;
| |
− | }
| |
− | footer .copyright span:after {
| |
− | content: "|";
| |
− | padding-left: 10px;
| |
− | padding-right: 12px;
| |
− | color: #b4bbbb;
| |
− | }
| |
− | </style>
| |
− | <footer id="page-footer">
| |
− | <div class="row">
| |
− | <div class="twelve columns" >
| |
− | <ul class="copyright">
| |
− | <!--<li>© 2014 Sparrow</li> -->
| |
− | <li><a href="2016.igem.org/Team:Peking">Home</a> <a href="mailto:pkuigem2016@126.com">Contact</a></li>
| |
− | <span> ©2016 PEKING IGEM. All Rights Reserved.</span>
| |
− | <li><a href="http://getbootstrap.com/2.3.2/">Based on Bootstrap</a></li>
| |
− | </ul>
| |
− | </div>
| |
− | <div id="go-top" style="display: block;"><a title="Back to Top" href="#">Go To Top</a></div>
| |
− | </div>
| |
− | </footer> <!-- Footer End-->
| |
| | | |
| | | |
− | <!-- Java Script======================================================================= -->
| |
− | <script>window.jQuery || document.write('<script src="https://2016.igem.org/Template:Peking/Javascript/jquery_1_10_2_min?action=raw&ctype=text/javascript"><\/script>')</script>
| |
− | <script type="text/javascript" src="https://2016.igem.org/Template:Peking/Javascript/jquery_migrate_1_2_1_min?action=raw&ctype=text/javascript"></script>
| |
| | | |
− | <script src="https://2016.igem.org/Template:Peking/Javascript/jquery_flexslider?action=raw&ctype=text/javascript"></script>
| |
− | <script src="https://2016.igem.org/Template:Peking/Javascript/doubleaptogo?action=raw&ctype=text/javascript"></script>
| |
− | <script src="https://2016.igem.org/Template:Peking/Javascript/init?action=raw&ctype=text/javascript"></script>
| |
| | | |
− | <!--quotations from flexslider: start--> | + | <!-- footer============================================================================== --> |
− | <script src='https://2016.igem.org/Template:Peking/Javascript/modernizr_js?action=raw&ctype=text/javascript'></script> | + | <style> |
− | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery_polaroid?action=raw&ctype=text/javascript'></script> | + | footer .copyright span:before { |
− | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery_easing?action=raw&ctype=text/javascript'></script> | + | content: "|"; |
− | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery_transform_0_8_0_min?action=raw&ctype=text/javascript'></script> | + | padding-left: 10px; |
− | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery_preloader?action=raw&ctype=text/javascript'></script> | + | padding-right: 12px; |
− | <!--quotations from flexslider: end--> | + | color: #b4bbbb; |
| + | } |
| + | footer .copyright span:after { |
| + | content: "|"; |
| + | padding-left: 10px; |
| + | padding-right: 12px; |
| + | color: #b4bbbb; |
| + | } |
| + | </style> |
| + | <footer id="page-footer"> |
| + | <div class="row"> |
| + | <div class="twelve columns" > |
| + | <ul class="copyright"> |
| + | <!--<li>© 2014 Sparrow</li> --> |
| + | <li><a href="2016.igem.org/Team:Peking">Home</a> <a href="mailto:pkuigem2016@126.com">Contact</a></li> |
| + | <span> ©2016 PEKING IGEM. All Rights Reserved.</span> |
| + | <li><a href="http://getbootstrap.com/2.3.2/">Based on Bootstrap</a></li> |
| + | </ul> |
| + | </div> |
| + | <div id="go-top" style="display: block;"><a title="Back to Top" href="#">Go To Top</a></div> |
| + | </div> |
| + | </footer> <!-- Footer End--> |
| + | |
| + | |
| + | <!-- Java Script======================================================================= --> |
| + | <script>window.jQuery || document.write('<script src="https://2016.igem.org/Template:Peking/Javascript/jquery_1_10_2_min?action=raw&ctype=text/javascript"><\/script>')</script> |
| + | <script type="text/javascript" src="https://2016.igem.org/Template:Peking/Javascript/jquery_migrate_1_2_1_min?action=raw&ctype=text/javascript"></script> |
| + | |
| + | <script src="https://2016.igem.org/Template:Peking/Javascript/jquery_flexslider?action=raw&ctype=text/javascript"></script> |
| + | <script src="https://2016.igem.org/Template:Peking/Javascript/doubleaptogo?action=raw&ctype=text/javascript"></script> |
| + | <script src="https://2016.igem.org/Template:Peking/Javascript/init?action=raw&ctype=text/javascript"></script> |
| + | |
| + | <!--quotations from flexslider: start--> |
| + | <script src='https://2016.igem.org/Template:Peking/Javascript/modernizr_js?action=raw&ctype=text/javascript'></script> |
| + | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery_polaroid?action=raw&ctype=text/javascript'></script> |
| + | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery_easing?action=raw&ctype=text/javascript'></script> |
| + | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery_transform_0_8_0_min?action=raw&ctype=text/javascript'></script> |
| + | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery_preloader?action=raw&ctype=text/javascript'></script> |
| + | <!--quotations from flexslider: end--> |
| | | |
− | <!--quotations from black: start--> | + | <!--quotations from black: start--> |
− | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery?action=raw&ctype=text/javascript"></script> | + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery?action=raw&ctype=text/javascript"></script> |
− | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_sticky?action=raw&ctype=text/javascript"></script> | + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_sticky?action=raw&ctype=text/javascript"></script> |
− | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_easing_1_3_pack?action=raw&ctype=text/javascript"></script> | + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_easing_1_3_pack?action=raw&ctype=text/javascript"></script> |
− | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/bootstrap_min?action=raw&ctype=text/javascript"></script> | + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/bootstrap_min?action=raw&ctype=text/javascript"></script> |
− | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_patallax_1_1_3?action=raw&ctype=text/javascript"></script> | + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_patallax_1_1_3?action=raw&ctype=text/javascript"></script> |
− | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/appear?action=raw&ctype=text/javascript"></script> | + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/appear?action=raw&ctype=text/javascript"></script> |
− | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/modernizr?action=raw&ctype=text/javascript"></script> | + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/modernizr?action=raw&ctype=text/javascript"></script> |
− | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_prettyPhoto?action=raw&ctype=text/javascript"></script> | + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_prettyPhoto?action=raw&ctype=text/javascript"></script> |
− | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/isotope?action=raw&ctype=text/javascript"></script> | + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/isotope?action=raw&ctype=text/javascript"></script> |
− | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_bxslider_min?action=raw&ctype=text/javascript"></script> | + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_bxslider_min?action=raw&ctype=text/javascript"></script> |
− | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_cycle_all?action=raw&ctype=text/javascript" ></script> | + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_cycle_all?action=raw&ctype=text/javascript" ></script> |
− | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_maximage?action=raw&ctype=text/javascript"></script> | + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/jquery_maximage?action=raw&ctype=text/javascript"></script> |
− | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/scripts?action=raw&ctype=text/javascript "></script> | + | <script type='text/javascript' src="https://2016.igem.org/Template:Peking/Javascript/scripts?action=raw&ctype=text/javascript "></script> |
− | <!--quotations from black: end--> | + | <!--quotations from black: end--> |
| | | |
| | | |
− | </body> | + | </body> |