|
|
| (32 intermediate revisions by 8 users not shown) |
| Line 1: |
Line 1: |
| − | <!--[if lt IE 8 ]><html class="no-js ie ie7" lang="en"> <![endif]-->
| |
| − | <!--[if IE 8 ]><html class="no-js ie ie8" lang="en"> <![endif]-->
| |
| − | <!--[if (gte IE 8)|!(IE)]><!-->
| |
| − | <html class="no-js" lang="en">
| |
| − | <!--<![endif]-->
| |
| − | <head>
| |
| − | <!--- Basic Page Needs========================================================================= -->
| |
| − | <meta charset="utf-8">
| |
| − | <title>Standard</title>
| |
| − | <meta name="viewport" content="width=device-width, initial-scale=1.0, maximum-scale=1.2, user-scalable=yes" />
| |
| − | <meta name="description" content="Wiki of Peking iGEM 2016" />
| |
| − | <meta name="author" content="Li Jiamian & Wang Yuqing">
| |
| − | <meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
| |
| − | <!-- Mobile Specific Metas===================================================================== -->
| |
| − | <meta name="viewport" content="width=device-width, initial-scale=1, maximum-scale=1">
| |
| − | <!-- Fix Overwrite the original iGEM style=================================================== -->
| |
| − | <link href="https://2016.igem.org/Template:Peking/css/fix?action=raw&ctype=text/css" rel="stylesheet" />
| |
| − | <!-- CSS======================================================================================= -->
| |
| − | <link href="https://2016.igem.org/Template:Peking/css/bootstrap_min?action=raw&ctype=text/css" rel="stylesheet" />
| |
| − | <link href="https://2016.igem.org/Template:Peking/css/style?action=raw&ctype=text/css" rel="stylesheet" />
| |
| − | <!-- flexslider================================================================================ -->
| |
| − | <link rel="stylesheet" type="text/css" media="all" href="https://2016.igem.org/Template:Peking/css/fstyle?action=raw&ctype=text/css" />
| |
| − | <link rel='stylesheet' id='responsive-css' href='https://2016.igem.org/Template:Peking/css/responsive?action=raw&ctype=text/css' type='text/css' media='all' />
| |
| − | <link rel='stylesheet' id='polaroid-slider-css' href='https://2016.igem.org/Template:Peking/css/fpolaroid?action=raw&ctype=text/css' type='text/css' media='all' />
| |
| − | <script type='text/javascript' src='https://2016.igem.org/Template:Peking/Javascript/fjquery?action=raw&ctype=text/javascript'></script>
| |
| − | <!-- CSS======================================================================================= -->
| |
| − | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/default?action=raw&ctype=text/css">
| |
| − | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/layout?action=raw&ctype=text/css">
| |
| − | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/media-queries?action=raw&ctype=text/css">
| |
| − | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/priorstyle?action=raw&ctype=text/css">
| |
| | | | |
| − | </head> | + | <!--[if lt IE 8 ]><html class="no-js ie ie7" lang="en"> <![endif]--> |
| − | | + | <!--[if IE 8 ]><html class="no-js ie ie8" lang="en"> <![endif]--> |
| − | <body>
| + | <!--[if (gte IE 8)|!(IE)]><!--> |
| − | <!-- Navigation -->
| + | <html class="no-js" lang="en"> |
| − | <div id="navigation" class="navbar navbar-fixed-top"> | + | <!--<![endif]--> |
| − | <div class="navbar-inner "> | + | <head> |
| − | <div class="container no-padding"> | + | <!--- Basic Page Needs========================================================================= --> |
| − | <a class="show-menu" data-toggle="collapse" data-target=".nav-collapse"><span class="show-menu-bar"></span> | + | <meta charset="utf-8"/> |
| − | </a>
| + | <title>Proof</title> |
| − | <div id="logo" style="max-width:170px"><a class="" href="https://2016.igem.org/Team:Peking"></a></div> | + | <meta name="viewport" content="width=device-width, initial-scale=1.0, maximum-scale=1.2, user-scalable=yes" /> |
| − |
| + | <meta name="description" content="Wiki of Peking iGEM 2016" /> |
| − | <div class="nav-collapse collapse"> | + | <meta name="author" content="Li Jiamian & Wang Yuqing"/> |
| − | | + | <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> |
| − | <li class="menu-1"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking" >Home</a></li> | + | <!-- Mobile Specific Metas===================================================================== --> |
| − | <li class="dropdown menu-2"><a class="dropdown-toggle" data-toggle="dropdown" href="#">Project</a> | + | <meta name="viewport" content="width=device-width, initial-scale=1, maximum-scale=1"/> |
| − | <ul class="dropdown-menu"> | + | <!-- Fix Overwrite the original iGEM style=================================================== --> |
| − | <li><a href="https://2016.igem.org/Team:Peking/Description" > Decription</a></li> | + | <link href="https://2016.igem.org/Template:Peking/css/fix?action=raw&ctype=text/css" rel="stylesheet" /> |
| − | <li><a href="https://2016.igem.org/Team:Peking/Design" >Design</a></li> | + | <!-- CSS======================================================================================= --> |
| − | <li><a href="https://2016.igem.org/Team:Peking/ Proof" > Proof of Concept</a></li> | + | <link href="https://2016.igem.org/Template:Peking/css/bootstrap_min?action=raw&ctype=text/css" rel="stylesheet" /> |
| − | <li><a href="https://2016.igem.org/Team:Peking/ Demonstrate" >Demonstrate</a></li> | + | <link href="https://2016.igem.org/Template:Peking/css/style?action=raw&ctype=text/css" rel="stylesheet" /> |
| − | </ul>
| + | <!-- CSS======================================================================================= --> |
| − | </li>
| + | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/default?action=raw&ctype=text/css"/> |
| − | <li class="dropdown menu- 3"><a class="dropdown-toggle" data-toggle="dropdown" href="#" > Parts</a> | + | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/layout?action=raw&ctype=text/css"/> |
| − | <ul class="dropdown-menu"> | + | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/media-queries?action=raw&ctype=text/css"/> |
| − | <li><a href="https://2016.igem.org/Team:Peking/ Basic_Part" > Basic parts</a></li> | + | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/priorstyle?action=raw&ctype=text/css"/> |
| − | <li><a href="https://2016.igem.org/Team:Peking/ Composite_Part" > Composite parts</a></li> | + | <link rel="stylesheet" href="https://2016.igem.org/Template:Peking/css/notebook_panel?action=raw&ctype=text/css"/> |
| − | <li><a href="https://2016.igem.org/Team:Peking/ Part_Collection" > Parts collection</a></li> | + | <style> |
| − | </ul>
| + | .texttitle{ |
| − | </li>
| + | color: #11abb0; |
| − | <li class="menu- 4"><a class=" colapse- menu1" href="https://2016.igem.org/Team:Peking/ Human_Practices" > Practices</a></li> | + | font-size: 38px; |
| − | <li class=" menu-5"><a class=" colapse-menu1" href="https://2016.igem.org/Team:Peking/ Collaborations" > Collaboration</a></li> | + | line-height: 48px; |
| − | <li class="menu-6"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking/ Model" > Modeling</a ></li> | + | margin-bottom: 12px; |
| − | <li class="dropdown menu-7"><a class="dropdown-toggle" data-toggle="dropdown" href="#" >Lab</a> | + | font-family: raleway-bold, sans-serif !important; |
| − | <ul class="dropdown-menu"> | + | background: transparent; |
| − | <li><a class="" href="https://2016.igem.org/Team:Peking/Team" >Team</a></li> | + | letter-spacing: 3px; |
| − | <li><a class="" href="https://2016.igem.org/Team:Peking/Attributions" >Attribution</a></li> | + | text-transform: uppercase; |
| − | <li><a class="" href="https://2016.igem.org/Team:Peking/Notebook" >Notebook</a></li> | + | font-weight: 350; |
| − | </ul>
| + | text-align: center; |
| − | </li>
| + | } |
| − | <li class=" dropdown menu-8"><a class="colapse-menu1 " data-toggle="dropdown" href="https://2016.igem.org/Team:Peking/Interlab" >Interlab</a> | + | sup{font-size:11px;} |
| − | </li>
| + | .references{margin-top:150px;margin-bottom:40px;} |
| − | </div>
| + | .references p{font-size:14px !important; color:#666161 !important;} |
| − | </div>
| + | .classic-title {font-weight: 300;} |
| − | </div>
| + | .classic-title span { |
| − | </div>
| + | padding-bottom: 8px; |
| − | <!--/Navigation -->
| + | border-bottom: 1px solid #383232; |
| | + | font-weight: 400; |
| | + | } |
| | + | figure{margin-top:40px;margin-bottom:40px;height:auto;} |
| | + | .anchor{padding-top:100px;margin-top:-100px;} |
| | + | </style> |
| | + | |
| | + | </head> |
| | + | |
| | + | |
| | + | |
| | + | <body> |
| | + | |
| | + | <!-- Navigation --> |
| | + | <div id="navigation" class="navbar navbar-fixed-top"> |
| | + | <div class="navbar-inner "> |
| | + | <div class="container no-padding"> |
| | + | <a class="show-menu" data-toggle="collapse" data-target=".nav-collapse"><span class="show-menu-bar"></span> |
| | + | </a> |
| | + | <div id="logo" style="max-width:170px"><a class="" href="https://2016.igem.org/Team:Peking"></a></div> |
| | + | |
| | + | <div class="nav-collapse collapse"> |
| | + | |
| | + | <li class="menu-1"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking" >Home</a></li> |
| | + | <li class="dropdown menu-2"><a class="dropdown-toggle" data-toggle="dropdown" href="#" > Achievements</a> |
| | + | <ul class="dropdown-menu"> |
| | + | <li><a href="https://2016.igem.org/Team:Peking/Results" >Results</a></li> |
| | + | <li><a href="https://2016.igem.org/Team:Peking/Basic_Part" >Parts</a></li> |
| | + | <li><a href="https://2016.igem.org/Team:Peking/Collaborations" >Collaborations</a></li> |
| | + | </ul> |
| | + | </li> |
| | + | <li class="dropdown menu-3"><a class="dropdown-toggle" data-toggle="dropdown" href="#">Project</a> |
| | + | <ul class="dropdown-menu"> |
| | + | <li><a href="https://2016.igem.org/Team:Peking/Description" > Overview</a></li> |
| | + | <li><a href="https://2016.igem.org/Team:Peking/Design" >Design</a></li> |
| | + | <li><a href="https://2016.igem.org/Team:Peking/ Crosslinking" > Crosslinking</a></li> |
| | + | <li><a href="https://2016.igem.org/Team:Peking/ Uranyl-adsorption" > Uranyl adsorption</a></li> |
| | + | <li><a href="https://2016.igem.org/Team:Peking/Clearance" >Clearance</a></li> |
| | + | <li><a href="https://2016.igem.org/Team:Peking/Secretion" >Secretion</a></li> |
| | + | <li><a href="https://2016.igem.org/Team:Peking/Demonstrate" >Final Performance</a></li> |
| | + | </ul> |
| | + | </li> |
| | + | <li class="dropdown menu- 4"><a class="dropdown-toggle" data-toggle="dropdown" href="#" > Modeling</a> |
| | + | <ul class="dropdown-menu"> |
| | + | <li><a href="https://2016.igem.org/Team:Peking/ Model/GelPoint" > Model of Gel Point </a></li> |
| | + | <li><a href="https://2016.igem.org/Team:Peking/ Model/MassDistribution" > Model of Mass Distribution</a></li> |
| | + | <li><a href="https://2016.igem.org/Team:Peking/ Software" > Software</a></li> |
| | + | </ul> |
| | + | </li> |
| | + | <li class=" dropdown menu- 5"><a class=" dropdown- toggle" data-toggle="dropdown" href="#" >Practices</a> |
| | + | <ul class="dropdown-menu"> |
| | + | <li><a href="https://2016.igem.org/Team:Peking/HP/Gold" >Overview</a></li> |
| | + | <li><a href="https://2016.igem.org/Team:Peking/HP/311" >Field research</a></li> |
| | + | <li><a href="https://2016.igem.org/Team:Peking/HP/questionnaire" >Questionnaire</a></li> |
| | + | <li><a href="https://2016.igem.org/Team:Peking/HP/consulting" >Consulting</a></li> |
| | + | <li><a href="https://2016.igem.org/Team:Peking/HP/otherHP" >Education & Other</a></li> |
| | + | </ul> |
| | + | </li> |
| | + | <li class="menu-6"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking/ Safety" > Safety</a> |
| | + | <li class="dropdown menu-7"><a class="dropdown-toggle" data-toggle="dropdown" href="#" >Lab</a> |
| | + | <ul class="dropdown-menu"> |
| | + | <li><a class="" href="https://2016.igem.org/Team:Peking/Team" >Team</a></li> |
| | + | <li><a class="" href="https://2016.igem.org/Team:Peking/Attributions" >Attribution</a></li> |
| | + | <li><a class="" href="https://2016.igem.org/Team:Peking/Notebook" >Notebook</a></li> |
| | + | </ul> |
| | + | </li> |
| | + | <li class="menu-8"><a class="colapse-menu1" href="https://2016.igem.org/Team:Peking/Interlab" >Interlab</a> |
| | + | </li> |
| | + | </div> |
| | + | </div> |
| | + | </div> |
| | + | </div> |
| | + | <!--/Navigation --> |
| | | | |
| | | | |
| Line 84: |
Line 126: |
| | <div class="row"> | | <div class="row"> |
| | <div class="twelve columns centered text-center"> | | <div class="twelve columns centered text-center"> |
| − | <h1>Attributions<span>.</span></h1> | + | <h1>Interlab</h1> |
| − | <p class="title1" style="text-align:center">The idea of this project was conceived by the team; advisors and instructors gave advices and suggestions on the implementation of this idea.</p> | + | <p class="title1" style="text-align:center">The Peking iGEM 2016 team is participating in the third year of the iGEM Interlab study along with about 100 teams. We focused on quantifying expression of GFP in common, comparable or absolute units. </p> |
| | </div> | | </div> |
| | </div> | | </div> |
| | </div> | | </div> |
| | <!-- Page Title End--> | | <!-- Page Title End--> |
| − |
| |
| | | | |
| | | | |
| | | | |
| | <style type="text/css"> | | <style type="text/css"> |
| − | | + | .texttitle{ |
| | + | color: #11abb0; |
| | + | font-size: 38px; |
| | + | line-height: 48px; |
| | + | margin-bottom: 12px; |
| | + | font-family: raleway-bold, sans-serif; |
| | + | background: transparent; |
| | + | letter-spacing: 3px; |
| | + | text-transform: uppercase; |
| | + | font-weight: 350; |
| | + | text-align: center; |
| | + | } |
| | #primary span{ | | #primary span{ |
| | display:block; | | display:block; |
| Line 119: |
Line 171: |
| | } | | } |
| | | | |
| − |
| + | .classic-title { |
| − | .classic-title {
| + | margin-bottom: 16px; |
| − | margin-bottom: 16px;
| + | border-bottom: 1px solid #eee; |
| − | border-bottom: 1px solid #eee;
| + | font-weight: 300; |
| − | font-weight: 300;
| + | margin- |
| − | }
| + | } |
| | | | |
| | | | |
| − | .classic-title span {
| + | .classic-title span { |
| − | padding-bottom: 8px;
| + | padding-bottom: 8px; |
| − | border-bottom: 1px solid #383232;
| + | border-bottom: 1px solid #383232; |
| − | font-weight: 400;
| + | font-weight: 400; |
| − | }
| + | } |
| | | | |
| | + | .p > small{ |
| | + | margin-bottom:5px; |
| | + | } |
| | + | .texttext h4{ |
| | + | margin-top:50px; |
| | + | } |
| | </style> | | </style> |
| | | | |
| Line 168: |
Line 226: |
| | menuFixed('sidebar'); | | menuFixed('sidebar'); |
| | } | | } |
| − | </script>
| |
| − |
| |
| − |
| |
| | </script> | | </script> |
| | | | |
| Line 189: |
Line 244: |
| | <div id="sidebar" style="color:#000000"> | | <div id="sidebar" style="color:#000000"> |
| | | | |
| − | <h4>Attributions</h4> | + | <h4>Methods</h4> |
| | <ul> | | <ul> |
| − | <li><a href="#members">Members'</a></li> | + | <li><a href="#background">Background</a></li> |
| − | <li><a href="#acknowledgement">Acknowledgement</a></li> | + | <li><a href="#design">Design</a></li> |
| − | <li><a href="#sponsors">Sponsors</a></li> | + | <li><a href="#materials">Materials</a></li> |
| | + | <li><a href="#protocol">Protocol</a></li> |
| | </ul> | | </ul> |
| − | </ul>
| + | <h4>Description</h4> |
| | + | <h4>Results</h4> |
| | + | <ul> |
| | + | <li><a href="#sequencing">Sequencing</a></li> |
| | + | <li><a href="#data">Data</a></li> |
| | + | </ul> |
| | + | <h4>Discussion</h4> |
| | </div> | | </div> |
| | </div> | | </div> |
| Line 202: |
Line 264: |
| | </div> | | </div> |
| | | | |
| − |
| |
| | | | |
| − | <div class="nine columns"> | + | <div class="nine columns texttext"> |
| − | | + | <div class="texttitle">Methods</div> |
| | <div> | | <div> |
| − | <a id="members"></a> | + | <a id="background"></a> |
| − | <h3 class="classic-title";"><span>Member’s Attributions</span></h3> | + | <h3 class="classic-title";"><span>Background</span></h3> |
| − | <p>All the data presented on this wiki was measured, collected, and analyzed by the team members. All the plasmids directly involved in the data presented on this wiki were constructed by the team members. The idea conceiving, content planning, execution, and result analysis of human practice were all done by the team members. The following is the detailed attribution: | + | <p>“All of the 2016 iGEM teams are invited and encouraged to participate in the Third International InterLaboratory Measurement Study in synthetic biology.” Our team took part in this study which aimed to standardize the measurements of fluorescence in different labs. The main task was to quantify expression of GFP in common, comparable or absolute units. In our case, we measured fluorescence using plate reader. |
| | </p> | | </p> |
| − | <p>
| |
| − | <strong>LI Cheng</strong> is the team leader of Peking iGEM 2016. He participated in conceiving the project, took charge of troubleshooting, and managed the experiments, guaranteeing the normal operation of the lab.<br/>
| |
| − | <strong>YANG Xiaoyu</strong> was committed to ameliorate the paired dCas9 (PC) reporter system, namely, to enhance the sensitivity and robustness. Early in the project, he was also responsible for information gathering, experiment design, and lab management<br/>
| |
| − |
| |
| − | <strong>BAI Ke</strong> was in charge of Human Practice and also worked in the wet lab to construct and prepare plasmids for gRNA in vitro transcription.<br/>
| |
| − | <strong>DONG Yiming</strong>
| |
| − | was responsible for designing and manufacturing the portable electronic device that convert optical signal into analogue electrical signal.<br/>
| |
| − | <strong>LI Yuexuan</strong> worked as the financial manager of the team. She was also responsible for plasmid construction and submission.<br/>
| |
| − | <strong>YANG Changru</strong> was in charge of building <i>M.tuberculosis</i>-sensing system using Molecule Beacon. He was also engaged in the protein purification of dCas9 fusion proteins.<br/>
| |
| − | <strong>ZHAO Shijun</strong> was in charge of measuring the luminescence intensity of PC reporter system. She analyzed the entire experimental data.<br/>
| |
| − | <strong>LV Nayun</strong> helped to complete the plasmid construction of sgRNA and was in part responsible for human practice.<br/>
| |
| − | <strong>WANG Dingyu</strong> was in charge of the construction of CRISPR gRNA as well as RNA scaffold in the beginning. Later she was working on the purification of dCas9 fusion protein.<br/>
| |
| − | <strong>LI Jiamian</strong> took the task of cloning dCas9-luciferase. She was also responsible for the testing of PC reporter system.<br/>
| |
| − | <strong>WEI Jingyi</strong> participated in plasmid construction, protein purification, and wiki building. She was also the designer of our PowerPoint slides.<br/>
| |
| − | <strong>WANG Yuqing</strong> was in charge of Modeling. His main task was to computationally search for the suitable guide sequences. Also, he was the lab manager for the normal operation of our lab.<br/>
| |
| − | <strong>TENG Huaiyuan</strong>was in charge of Modeling. His main task was to computationally search for the suitable guide sequences. Also, he was the lab manager for the normal operation of our lab.<br/>
| |
| − | </p>
| |
| | </div> | | </div> |
| | | | |
| | <div> | | <div> |
| − | <a id="acknowledgement"></a> | + | <a id="design"></a> |
| − | <h3 class="classic-title";"><span>Acknowledgement</span></h3>
| + | <h3 class="classic-title";"><span>Design</span></h3> |
| − | <p> We'd like to thank all those who have helped us over the summer, without whose sincere support The Uranium Reaper Project goals would have not been achieved. | + | <p> Fluorescence is widely used as a proxy for promoter activity by expressing fluorescent proteins such as green fluorescent protein (GFP). Despite this is an indirect measurement, it provides a useful insight into expression levels and has significant advantage that it could be ontinuously monitored without disrupting cells. |
| | </p> | | </p> |
| − |
| + | <p>Fluorescence/OD600 is routinely used to give an adjustment of the relative expression per cell.</p> |
| − | <h4>General support</h4> | + | <p>We aim to do this using the supplied FITC as a standard reference material. The standard curve could be constructed via measuring the fluorescence of a dilution series. We have previously performed this standard curve on our own instrument alongside a standard curve for purified GFP. Using these standard curves alongside your own standard curve for FITC it is thus possible to transform your relative measurements of fluorescence into absolute measurements of GFP molecules.</p> |
| − | <p><strong>Prof. OUYANG Qi, Prof. LOU Chunbo, Dr. ZHANG Haoqian</strong> and other teachers helped us during our brainstorming and gave us useful suggestions.<br> | + | <p>However, we aim to contain instrument variability, at least to some degree, by measuring a standard scattering solution of a mono-dispersed silica suspension (LUDOX). The objective is to see if a simple, single fixed-point measurement can be used as a ratiometric adjustment to provide greater uniformity in fluorescence/OD600 measurements across sites.</p> |
| − | <strong>Prof. OUYANG Qi</strong> and<strong> Prof. LIU Chunli</strong> kindly provided the laboratory to us for experiments. | + | </div> |
| − | </p>
| + | |
| | | | |
| − | <h4>Materials support</h4>
| + | <div> |
| − | <p><strong>Dr. ZHANG Wenbing</strong> provided us with the plasmid of 3B(Tri-SpyCatcher within 15X linker).<br> | + | <a id="materials"></a> |
| − | <strong> Prof. ZHOU Lu</strong> provided us with Uranyl-binding Protein, also called SUP.<br>
| + | <h3 class="classic-title";"><span>Materials and methods</span></h3> |
| − | <strong>Prof. LIU Chunli</strong>allowed us to use his lab to do experiments on uranyl ion. The uranyl nitrate solution and Arsenazo III was provided by Prof. LIU.<br>
| + | <h5>Plasmids used</h5> |
| − | <strong>Prof. LOU Chunbo</strong> provided us with the strain B.Subtilis and mSA, heavy metal ions binding proteins: lead-binding protein, mercury-binding protein and cadmium-binding protein.<br>
| + | <p style="margin:0 0 0 0">• Plasmid DNA (100 pg/uL in 10uL of Buffer EB)</p> |
| − | <strong>Dr. DU Pei</strong> provided the beads to us and gave us experimental guidance.<br>
| + | <div style="padding-left:20px"> |
| − | <strong>BIT-China</strong> gave us the important Interlab kit.
| + | <p> |
| | + | o Test Device 1: J23101.B0034.E0040.B0015 in pSB1C3<br> |
| | + | o Test Device 2: J23106.B0034.E0040.B0015 in pSB1C3<br> |
| | + | o Test Device 3: J23117.B0034.E0040.B0015 in pSB1C3<br> |
| | + | o Positive Control Device: I20270 in pSB1C3 (Also located in Kit Plate 3, well 8P)<br> |
| | + | o Negative Control Device: R0040 in pSB1C3 (Also located in Kit Plate 2, well 6F)<br> |
| | </p> | | </p> |
| | + | </div> |
| | + | |
| | | | |
| − | <h4>Experiment equipment support</h4> | + | <h5>Strain used</h5> |
| − | <p><strong>Prof. OUYANG Qi</strong> lent the Akta Pure to us for all proteins purification.<br> | + | <p>• <i>Escherichia coli</i> TOP10</p> |
| − | <strong>Prof. CHANG Zengyi</strong> and <strong>Dr. WANG Qingsong</strong> provided us with Scanner and helped with the setup and scan of gels.<br>
| + | |
| − | <strong>Prof. LIU Chunli</strong> provided us with Geiger counter to test the radiation level in and around our lab.<br>
| + | <h5>Materials</h5> |
| − | <strong>Core Facilities</strong>, School of Life Sciences, Peking University,assisted us with ITC.<br>
| + | <p> |
| − | <strong>the State Key Laboratory of environmental simulation and pollution control</strong> provided the Aurora M90 mass spectrograph.
| + | • FITC Standard: one tube with dried down FITC for creating a FITC standard<br> |
| | + | • LUDOX: one tube with 30% colloidal silica suspended in 1mL of water<br> |
| | + | • 1xPBS (phosphate buffered saline)<br> |
| | + | • LB (Luria Bertani) media<br> |
| | + | • Chloramphenicol (stock concentration 25 mg/mL dissolved in EtOH)<br> |
| | + | • 50 ml Falcon tube (or equivalent) or 250 ml shake flask for cell growth<br> |
| | + | • 1.5 ml eppendorf tubes for sample storage<br> |
| | + | • Ice bucket with ice<br> |
| | + | • Pipettes<br> |
| | + | • 96 well plate <br> |
| | + | </p> |
| | + | |
| | + | <h5>Machines</h5> |
| | + | <p> |
| | + | • Thermo VARIOSKAN FLASH<br> |
| | + | • MAPADA UV-3100PC SPECTROPHOTOMETER<br> |
| | + | • YKKY（FM40）<br> |
| | + | • AISITE electro-heating standing-temperature cultivator<br> |
| | + | • HONOUR INCURATOR SHAKER<br> |
| | + | |
| | + | </p> |
| | + | |
| | + | <h5>Software</h5> |
| | + | <p> |
| | + | • Microsoft Excel<br> |
| | + | |
| | + | </p> |
| | + | |
| | + | <h5>Methods</h5> |
| | + | <p style="margin:0 0 0 0">• Calibration</p> |
| | + | <div style="padding-left:45px"> |
| | + | <p> |
| | + | o OD600 Reference point<br> |
| | + | o FITC fluorescence standard curve<br> |
| | + | o Test Device 3: J23117.B0034.E0040.B0015 in pSB1C3<br> |
| | </p> | | </p> |
| | + | </div> |
| | + | <p style="margin:0 0 0 0">• Cell measurement</p> |
| | + | <div style="padding-left:45px"> |
| | + | <p> |
| | + | o Transformation<br> |
| | + | o Measurements <br> |
| | + | </p> |
| | + | </div> |
| | + | |
| | + | |
| | + | </div> |
| | + | |
| | + | |
| | + | <a id="protocol"></a> |
| | + | <h3 class="classic-title";"><span>Protocols</span></h3> |
| | + | <div style="padding-left:45px"> |
| | + | <p><a href="https://2016.igem.org/Team:Peking/Interlab/Protocol:Calibration">>>Calibration</a><br> |
| | + | <a href="https://2016.igem.org/Team:Peking/Interlab/Protocol:Cell_measurement">>>Cell measurement</a></p> |
| | + | </div> |
| | + | |
| | | | |
| − | <h4>Theoretical guidance</h4> | + | <div class="texttitle">Description</div> |
| − | <p> <strong>ZHANG Yihao</strong> and <strong>WANG Yu</strong>,The wiki designers of Peking iGEM 2015,gave us many suggestions about wiki building.<br> | + | <img src="https://static.igem.org/mediawiki/2016/9/97/T--Peking--image_interlab_1.jpg"> |
| − | <strong>Dr. YU Daqi</strong> of Prof. OUYANG Qi’s lab helped us a lot in experimental operating and data analysis.<br>
| + | <br> |
| − | <strong>Prof. ZHANG Wenbing, Prof. LOU Chunbo</strong> and <strong>Dr. YU Daqi</strong> kindly helped our team with modeling of the project.<br>
| + | <img src="https://static.igem.org/mediawiki/2016/a/ab/T--Peking--image_interlab_2.jpg"> |
| − | <strong>Prof. OUYANG Qi, Prof. LOU Chunbo, Dr. ZHANG Haoqian</strong> and <strong>ZHANG Yihao</strong>,the instructors, coached us for the presentation.<br>
| + | <p style="text-align:center;"><b>Figure 1. Above: from left to right: D1, D2, D3, Negative, Positive. Below: five mediums containing five different bacteria.</b></p> |
| − | <strong>Prof. LAI Luhua</strong> and <strong>Prof. RAO Yi</strong> participated in our presentation rehearsal and gave suggestions for revisions.
| + | <br> |
| | + | <p>Plasmids containing promoters and GFP were taken from The 2016 DNA Distribution Kit and all devices were transformed into <i>E. coli</i>. Fluorescence of colonies was checked up under UV light. </p> |
| | + | <p>5 ml of liquid LB-M medium with chloramphenicol were inoculated with two chosen colonies of each device. Liquid cultures were incubated for 16~18 hours in HONOUR INCURATOR SHAKER placed in incubator. OD of these cultures was measured by MAPADA UV-3100PC SPECTROPHOTOMETER and diluted to 0.02. Fluorescence of biological and also technical replicates was measured using Thermo VARIOSKAN FLASH following our protocol. |
| | </p> | | </p> |
| | + | <a id="sequencing"></a> |
| | + | <br> |
| | + | <div class="texttitle">Results</div> |
| | + | <h3 class="classic-title";"><span>Sequencing</span></h3> |
| | + | <p> • Device 1: J23101+I13504<br> |
| | + | • Device 2: J23106+I13504<br> |
| | + | • Device 3: J23117+I13504<br> |
| | + | • Positive Control Device: I20270 in pSB1C3<br> |
| | + | • Negative Control Device: R0040 in pSB1C3 </p> |
| | + | <p> |
| | + | >BBa_J23101 Part-only sequence (35 bp)<br> |
| | + | <span style="padding-left:45px">Tttacagctagctcagtcctaggtattatgctagc</span></p><p> |
| | + | >BBa_J23106 Part-only sequence (35 bp)<br> |
| | + | <span style="padding-left:45px">Tttacggctagctcagtcctaggtatagtgctagc</span></p><p> |
| | + | >BBa_J23117 Part-only sequence (35 bp)<br> |
| | + | <span style="padding-left:45px">Ttgacagctagctcagtcctagggattgtgctagc</span></p><p> |
| | + | >BBa_I13504 Part-only sequence (875 bp)<br> |
| | + | <span style="padding-left:45px">Aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata</span></p><p> |
| | + | >BBa_I20270 Part-only sequence (919 bp)<br> |
| | + | <span style="padding-left:45px">Ttgatggctagctcagtcctaggtacaatgctagctactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata</span></p><p> |
| | + | >BBa_R0040 Part-only sequence (54 bp)<br> |
| | + | <span style="padding-left:45px">tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac</span> |
| | + | </p></p> |
| | | | |
| − | <h4>Synthetic biology course</h4> | + | <a id="data"></a> |
| − | <p> From March to June, an introductory course of synthetic biology was hold by College of Life Sciences, Peking University. During the course, the teachers, also the instructors gave us kind guidance and judged our project design. In late June, we started in the lab to start our project. | + | <h3 class="classic-title";"><span>Data</span></h3> |
| − | </p>
| + | <h4>OD600 Reference Point</h4> |
| − | </div>
| + | <p> <b>Table 1. OD600 Reference Point.</b></p> |
| − |
| + | <img src="https://static.igem.org/mediawiki/2016/f/f4/T--Peking--image_interlab_3.png"> |
| | + | <br> |
| | + | <h4>FITC Standard Curve</h4> |
| | + | <p ><b>Table 2. Data of FITC standard curve.</b></p> |
| | + | <img src="https://static.igem.org/mediawiki/2016/1/1b/T--Peking--image_interlab_4.png"> |
| | + | <img src="https://static.igem.org/mediawiki/2016/0/03/T--Peking--image_interlab_5.png"> |
| | + | <p ><b>Figure 2. FITC standard curve.</b></p> |
| | + | <br> |
| | + | <h4>Normalization</h4> |
| | + | <p ><b>Table 3. Normalization.</b></p> |
| | + | <img src="https://static.igem.org/mediawiki/2016/d/db/T--Peking--image_interlab_6.png"> |
| | + | <br> |
| | + | <h4>Cell Measurement</h4> |
| | + | <p ><b>Table 4. Raw data of Abs600 measurement.</b></p> |
| | + | <img src="https://static.igem.org/mediawiki/2016/0/04/T--Peking--image_interlab_7.png"> |
| | + | <p ><b>Table 5. Blank subtraction and correction of Abs600 measurement.</b></p> |
| | + | |
| | | | |
| − | <div>
| + | |
| − | <a id="sponsors"></a>
| + | |
| − | <h3 class="classic-title";"><span>Sponsors</span></h3>
| + | |
| − | <div class="row,row1">
| + | <img src="https://static.igem.org/mediawiki/2016/e/ee/T--Peking--image_interlab_8.png"> |
| − | <ul class="footer-social">
| + | <img src="https://static.igem.org/mediawiki/2016/ 7/ 71/T--Peking-- image_interlab_9.png"> |
| − | <li class="col-md-6" id="PKU-administration" style="margin-bottom:25px;max-width:300px">
| + | <p ><b>Figure 3. Blank subtraction and correction of Abs600 measurement.</b></p> |
| − | <a href="http:// dean. pku. edu.cn/ pkudean/ index. html"><img src="https://static.igem.org/mediawiki/2016/ 2/ 2e/T--Peking-- images_sponsors_PKU_Administration.png"></ a> | + | <p ><b>Table 6. Raw data of fluorescence measurement.</b></p> |
| − | </li>
| + | <img src="https://static.igem.org/mediawiki/2016/ 5/ 52/T--Peking-- image_interlab_10.png"> |
| − | <li class="col-md-6" id="PKU-SLS" style="margin-bottom:25px;max-width:300px">
| + | <p ><b>Table 7. Blank substraction and correction of fluorescence measurement.</b></p> |
| − | < a href="http://www. bio. pku.edu.cn/ "><img src="https://static.igem.org/mediawiki/2016/ 7/ 74/T--Peking-- images_sponsors_PKU_SLS.png">< /a> | + | <img src="https://static.igem.org/mediawiki/2016/3/32/T--Peking--image_interlab_11.png"> |
| − | </li>
| + | <img src="https://static.igem.org/mediawiki/2016/ 6/ 67/T--Peking-- image_interlab_12.png"> |
| − | <li class="col-md-6" id="IMCAS" style="margin-bottom:25px;max-width:300px">
| + | <p ><b>Figure 4. Blank subtraction and correction of fluorescence measurement.</b></p> |
| − | < a href=" http:// english. im. cas.cn/"><img src="https://static.igem.org/mediawiki/2016/ 7/ 77/T--Peking-- images_sponsors_PKU_IMCAS.png"></ a> | + | <p ><b>Table 8.Raw data of Fl/Abs600.</b></p> |
| − | </li>
| + | <img src="https://static.igem.org/mediawiki/2016/ d/ d3/T--Peking-- image_interlab_13.png"> |
| − | <li class="col-md-6" id="PKU-CQB" style="margin-bottom:25px;max-width:300px">
| + | <p ><b>Table 9. Raw data of average and SD.</b></p> |
| − | < a href="http:/ /cqb. pku.edu.cn/ en/ "><img src="https://static.igem.org/mediawiki/2016/ 8/ 8e/T--Peking-- images_sponsors_PKU_CQB.png">< /a> | + | <img src="https://static.igem.org/mediawiki/2016/a/a1/T--Peking--image_interlab_14.png"> |
| − | </li>
| + | <img src="https://static.igem.org/mediawiki/2016/ 0/ 07/T--Peking-- image_interlab_15.png"> |
| − | <!--<li class="col-md-6" id="BluePha" style="margin-bottom:25px; max-width:300px">
| + | <p ><b>Figure 4. Average level of devices.</b></p> |
| − | <a href="http://www.bluepha.com/"><img src="images/PKU/Bluepha-logo.png"></a>
| + | |
| − | </li>-->
| + | |
| − | <li class="col-md-6" id="PKU-CCME" style="margin-bottom:25px;max-width:300px">
| + | |
| − | <a href="http://www.chem.pku.edu.cn/index.php?styleid=2"><img src="https://static.igem.org/mediawiki/2016/ b/ ba/T--Peking-- images_sponsors_PKU_CCME.png"></ a> | + | |
| − | </li>
| + | |
| − | </ul>
| + | |
| − | </div>
| + | <div class="texttitle">Discussion</div> |
| − | </div>
| + | <p>It is noticeable that the promoter of the Device 1 is strongest followed by the promoter of the Device 2 and Device 3.</p> |
| | + | |
| | + | <h3 class="classic-title";"><span>Appendix</span></h3> |
| | + | <p>Individuals responsible for conducting InterLab study |
| | + | • Dong Yiming measured the devices. |
| | + | • Li Cheng processed the data. |
| | + | </p> |
| | + | |
| | + | |
| | + | |
| | + | </div> |
| | </div> <!-- row End --> | | </div> <!-- row End --> |
| | | | |
