Background
“All of the 2016 iGEM teams are invited and encouraged to participate in the Third International InterLaboratory Measurement Study in synthetic biology.” Our team took part in this study which aimed to standardize the measurements of fluorescence in different labs. The main task was to quantify expression of GFP in common, comparable or absolute units. In our case, we measured fluorescence using plate reader.
Design
Fluorescence is widely used as a proxy for promoter activity by expressing fluorescent proteins such as green fluorescent protein (GFP). While this is an indirect measurement, it provides a useful insight into expression levels and has the significant advantage that it can be monitored continuously without disrupting cells.
Fluorescence/OD600 is routinely used to give an adjustment of the relative expression per cell.
We aim to do this using the supplied FITC as a standard reference material. You will measure the fluorescence of your instrument using a dilution series of this reference material to construct a standard curve. We have previously performed this standard curve on our own instrument alongside a standard curve for purified GFP. Using these standard curves alongside your own standard curve for FITC it is thus possible to transform your relative measurements of fluorescence into absolute measurements of GFP molecules.
However, we aim to control for instrument variability, at least to some degree, by measuring a standard scattering solution of a mono-dispersed silica suspension (LUDOX). The objective is to see if a simple, single fixed-point measurement can be used as a ratiometric adjustment to provide greater uniformity in fluorescence/OD600 measurements across sites.
Materials and methods
Used plasmids
• Plasmid DNA (100 pg/uL in 10uL of Buffer EB)
o Test Device 1: J23101.B0034.E0040.B0015 in pSB1C3
o Test Device 2: J23106.B0034.E0040.B0015 in pSB1C3
o Test Device 3: J23117.B0034.E0040.B0015 in pSB1C3
o Positive Control Device: I20270 in pSB1C3 Also located in Kit Plate 3, well 8P
o Negative Control Device: R0040 in pSB1C3 Also located in Kit Plate 2, well 6F
Used strain
• Escherichia coli TOP10
Used material
• FITC Standard: one tube with dried down FITC for creating a FITC standard
• LUDOX: one tube with 30% colloidal silica suspended in 1mL of water
• 1xPBS (phosphate buffered saline)
• Terrific broth (at half strength: 0.5x TB) or can use LB (Luria Bertani) media as an alternative
• Chloramphenicol (stock concentration 25 mg/mL dissolved in EtOH)
• 50 ml Falcon tube (or equivalent) or 250 ml shake flask for cell growth
• 1.5 ml eppendorf tubes for sample storage
• Ice bucket with ice
• Pipettes
• 96 well plate
Used machines
• Thermo VARIOSKAN FLASH
• MAPADA UV-3100PC SPECTROPHOTOMETER
• YKKY（FM40）
• AISITE electro-heating standing-temperature cultivator
• HONOUR INCURATOR SHAKER
Used software
• Microsoft Excel
Used methods
• Calibration
o OD600 Reference point
o FITC fluorescence standard curve
o Test Device 3: J23117.B0034.E0040.B0015 in pSB1C3
• Cell measurement
o Transformation
o Measurements
Protocols
Figure 1. From left to right：D1, D2, D3, Negative, Positive.
Plasmids containing promoters and GFP were taken from The 2016 DNA Distribution Kit and all devices were transformed into E.coli. Fluorescence of colonies was checked up under UV light.
5 ml of liquid LB-M medium with chloramphenicol were inoculated with two chosen colonies of each device. Liquid cultures were incubated for 16~18 hours in HONOUR INCURATOR SHAKER placed in incubator. OD of these cultures was measured by MAPADA UV-3100PC SPECTROPHOTOMETER and diluted to 0.02. Fluorescence of biological and also technical replicates was measured using Thermo VARIOSKAN FLASH following our protocol.
Sequencing
• Device 1: J23101+I13504
• Device 2: J23106+I13504
• Device 3: J23117+I13504
• Positive Control Device: I20270 in pSB1C3
• Negative Control Device: R0040 in pSB1C3
>BBa_J23101 Part-only sequence (35 bp)
Tttacagctagctcagtcctaggtattatgctagc
>BBa_J23106 Part-only sequence (35 bp)
Tttacggctagctcagtcctaggtatagtgctagc
>BBa_J23117 Part-only sequence (35 bp)
Ttgacagctagctcagtcctagggattgtgctagc
>BBa_I13504 Part-only sequence (875 bp)
Aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata
>BBa_I20270 Part-only sequence (919 bp)
Ttgatggctagctcagtcctaggtacaatgctagctactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata
>BBa_R0040 Part-only sequence (54 bp)
tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac
Data
OD600 Reference Point
Table 1. OD600 Reference Point.
FITC Standard Curve
Table 2. Data of FITC standard curve.
Figure 2. FITC standard curve.
Normalisation
Table 3. Normalisation.
Cell Measurement
Table 4. Raw data of Abs600 measurement.
Table 5. Blank substraction and correction of Abs600 measurement.
Figure 3. Blank substraction and correction of Abs600 measurement.
Table 6. Raw data of fluorescence measurement.
Table 7. Blank substraction and correction of fluorescence measurement.
Figure 4. Blank substraction and correction of flurescence measurement.
Table 8.Raw data of Fl/Abs600.
Table 9. Raw data of average and SD.
Figure 4. Average level of devices.
It is noticeable that the promoter of the Device 1 is strongest followed by the promoter of the Device 2 and Device 3.
Appendix
Individuals responsible for conducting InterLab study • Dong Yiming measured the devices. • Li Cheng processed the data.
