{{{titre}}}

Experiments

Describe the experiments, research and protocols you used in your iGEM project.

What should this page contain?

• Protocols
• Experiments
• Documentation of the development of your project

Protocols

Antibiotics concentrations

The following concentrations of antibiotic were used to grow bacteria (on Petri dishes or liquid cultures):

Antibiotic	Concentration (µg/mL)
Ampicillin	50
Chloramphenicol	30
Kanamycin	50
Spectinomycin	50
Streptomycin	50

Heat shock competent cells

Preparation

Day 1 Inoculate cells in 3.5mL LB medium. Incubate at 37°C overnight.

Day 2 Measure culture OD at 600nm. Dilute cells in 250mL of LB medium so OD equals to 0.12. Incubate overnight at 20°C and 180rpm.

Day 3 Measure culture OD at 600nm and dilute to obtain OD_600nm=0.6. Cells must be kept at 4°C during all following steps. Put on ice for 10min and centrifuge for 10min at 3000rpm and 4°C. Discard supernatant and resuspend cells in 80mL of fresh TB buffer. Keep on ice for 10min and centrifuge for 10min at 3000rpm and 4°C. Discard supernatant again and resuspend cells in 20mL of fresh TB buffer with 7% of DMSO. Keep on ice for 10min. Aliquot cells and freeze with liquid nitrogen. Keep at -80°C.

TB buffer recipe

HEPES	10mM
MnCl2	55mM
CaCl2	15mM
KCl	250mM
KOH	up to pH6.7

Dissolve HEPES, CaCl₂ and KCl in water. Adjust pH to 6.7 with KOH. Add MnCl₂. Filter to sterilize and keep at 4°C.

Tranformation

Add 1µL of plasmids to 50µL of competent cells (make a control tube without plasmid). Keep tubes on ice for 30min and heat shock at 42°C for 1min. Add 500µL of LB medium into each tube and incubate at 37°C for 1h. Spread cells on Petri dishes in duplicate and incubate at 37°C overnight.

Electro-competent cells

Preparation

Inoculate 15mL of LB with 200µL of an overnight cell culture. Incubate at 37°C and 180rpm until OD_600nm reaches 0.6. Centrifuge cells for 10 minutes at 4000rpm. Wash twice with 10mL of 10% glycerol. Put cells in 200µL of 10% glycerol and use for electroporation.

Transformation

Use an Eppendorf Electroporator 2510 (tune to 2500V). Add 1µL of plasmids to 50µL of competent cells (make a control tube without plasmid). Place cells in a 1mm-cuvette, electroporate (the time constant should be close to 6ms) and recover cells with 1mL of cold LB medium. Incubate cells for 1h at 37°C. Spread cells on Petri dishes in two different concentrations and incubate at 37°C overnight.

Plasmid DNA extraction

Transfer 1.5mL of an overnight culture into an eppendorf tube. Centrifuge at 13000rpm for 1min to pellet the cells. Discard supernatant and resuspend cells in 100µL of TE buffer. Add 200µL of solution II and mix gently by inverting the tubes until lysate appears clear. Add 150µL of solution III and mixed gently. Keep the solution on ice for 10min. Centrifuge for 10min at 13000rpm and recover the supernatant. Add 100µL of phenol in each tubes to denature the proteins and vortex for 30s. Centrifuge the tubes for 7min at 13000rpm. Recover the aqueous phase. Add 2 volumes (900µL) of 100% ethanol and put at -20°C for 10min. Centrifuge the tubes again for 10min at 13000rpm. Discard supernatant and wash with 800µL of 70% ethanol to remove the remaining ions. Make sure that the pellet containing DNA remains at the bottom of the tubes. Centrifuge the tubes for 4min at 13000rpm and remove supernatants. Dry tubes in speedvac. Resuspend the pellet in 50µL of TE/RNAse. Keep the extracted plasmids at -20°C.

TE buffer recipe

Tris	10mM
EDTA	55mM

Solution II recipe (lysis solution) Keep for maximum 3 weeks.

SDS	1%
NaOH	0.1M

Solution III recipe (neutralization solution) CH₃COOK 3M at pH4.8.

CH3COOK 5M	60mL
CH3COOH	11.5mL
water	28.5mL

TE/RNase Use only fresh solution.

RNase (10mg/mL)	5µL
TE	1mL

DNA extraction using the Invitrogen ChargeSwitch®-Pro Plasmid Miniprep Kit

Follow the steps below to purify plasmid DNA from 1-5ml of fresh overnight cultures using a microcentrifuge. All steps are performed at room temperature.

Before Starting

• For a new kit, add Rnase A (provided in the kit) to the Resuspension Buffer and mix.
• If necessary, warm the Lysis Buffer to 37°C to dissolve any precipitate.

Preparing the Sample

1. Pellet cells from 1-5 ml of overnight culture.
2. Resuspend in 250 µL of Resuspension Buffer premixed with Rnase A. No cell clumps should remain.
3. Add 250 µL of Lysis Buffer. Mix well by gentle inversion. Do not vortex.
4. Incubate at room temperature for 2-5 minutes. Do not incubate more than 5 minutes.
5. Add 250µL of Precipation Buffer, and mix well until a white precipitate is formed.
6. Centrifuge for 10 minutes at maximum speed to pellet the debris.

Binding the DNA

1. Carefully transfer the supernatant from Step 2.6 above onto the ChargeSwitch®-Pro MiniPrep Colum inserted in a Collection Tube.
2. Centrifuge the column/tube at maximun speed for 30-60 seconds.
3. Remove the column from the tube and discard the flow-through. Re-insert the column in the same tube.

Washing the Column

1. Add 750µL of Wash Buffer 1 to the column.
2. Centrifuge the column/tube at the maximun speed for 30-60 seconds.
3. Remove the column from the tube and discart the flow-through. Re-insert the column in the tube;
4. Add 250µL of Wash Buffer 2 to the column.
5. Centrifuge the column/tube at maximun speed for 30-60 seconds.
6. remove the column from the tube. Discard the flow-through and the Collection Tube.

Eluting the DNA

1. Insert the column into an Elution Tube (provided in the kit).
2. Add 50-100µL of Elution Buffer onto the column.
3. Centrifuge the column/tube at maximun speed for 30-60 seconds.
4. Optional:Remove the Elution Tube and transfer the eluate back onto the same column. Re-insert the column in the tube and centrifugate at maximun speed for 30-60 seconds. This step is recommended for maximun recovery.
5. The eluate contains your purified plasmid DNA. Store DNA at 4°C or -20°C.

Plasmid digestion

Mix 10µL of extracted plasmid with 2µL of digestion buffer and 7µL of water. Add 1µL of restriction enzyme. Incubate for 1 hour at 37°C (except for fast digest enzymes which need only 5 min of incubation at 37°C). Then digestion products are migrated on an agarose gel.

gBlock plasmid insertion

The following ratio should be over 7: \[ \frac{vector\ size}{insert\ size}\times\frac{insert\ concentration}{vector\ concentration} \]

Gently centrifuge gBlocks. Add 100µL of TE buffer (final concentration should be around 10ng/µL). Vortex and incubate at 50°C for 20min. Mix 7µL of gBlocks with 1µL of extracted and linearized plasmid, 1µL of ligase and 1µL of ligase buffer. Incubate for 1h at RT.

List of plasmids constructed

Plasmid name	Backbone	Insert	Insert size (bp)
pPS16_001	pUC19	gBlock 1.1	960
pPS16_002	pUC19	gBlock 1.2	960
pPS16_003	pUC19	gBlock 2.1	1023
pPS16_004	pUC19	gBlock 2.2	808
pPS16_005	pUC19	gBlock 3.1	960
pPS16_006	pUC19	gBlock 3.2	960
pPS16_007	pUC19	gBlock 4.1	706
pPS16_008	pUC19	gBlock 4.2	1288
pPS16_009	pUC19	gBlock GFP 1-9	862
pPS16_010	pUC19	gBlock ATG linker RFB	374
pPS16_011	pUC19	gBlock detection	1020
pPS16_012	pUC19	gBlock St sgRNA	310
pPS16_013	pUC19	gBlock ATG linker FKBP	419
pPS16_014	pUC19	gBlock Nm sgRNA	362
pPS16_015	pUC19	gBlock spacer1	900

DNA electrophoresis on agarose gel

Gel preparation

Mix agarose and TAE buffer to get a final concentration of 0.8%(w/v). Microwave for 1-2min in order to melt the agarose. Let cool down for 10min and add BET up to 5µg/mL. This solution can be kept at 61°C. Pour the solution into the casting tray. Place the comb and let cool down for about 30min. Place the gel in an electrophoresis unit full of TAE and load the samples plus a ladder. Migrate at 100V for 20min. Visualize DNA fragments with UV light.

Polymerase chain reaction

List of PCR primers

Name	Description	Sequence 5'→3'
iPS120	Reverse primer amplification gBlock 1-1	TCCAGGATGCGCAGGTTGTTCAGCTTG
iPS121	Forward primer amplification gBlock 1-2	GCAAGGCAGCGAGAGACCCCTGAC
iPS122	Reverse primer amplification gBlock 1-2	TCGCTGCCCAGCACCAGCACCTTG
iPS123	Forward primer amplification gBlock 2-1	GCTGCCCTTCAGCCGCACCTGGGAC
iPS124	Reverse primer amplification gBlock 2-1	TTCTGCACCTGCTCCACGCGCACGG
iPS125	Forward primer amplification gBlock 2-2	GACCGGCGTGTGGGTGCGCAACC
iPS126	Reverse primer amplification gBlock 3-1	GGCACGGTCAGGTTGTTCAGGTCGTTC
iPS127	Forward primer amplification gBlock 3-2	CACCGAGACCAAGAAGCTGAGCAAGG
iPS128	Reverse primer amplification gBlock 3-2	CTGTCGTCGAAGGTGATGCTCAGG
iPS129	Forward primer amplification gBlock 4-1	GCTGCCTGTACACCGGCAAGACCATC
iPS130	Reverse primer amplification gBlock 4-1	AACAGGATGCTGTCCTCGAACTCC
iPS131	Forward primer amplification gBlock 4-2	CAGCTACCAGGTGGACAGCAAGTTC
iPS132	Forward primer amplification St guide	TTGACAGCTAGCTCAGTCCTAGGTATAATG
iPS133	Reverse primer amplification Nm guide	CTAGCACTATCAGCGTTATTTAGCG
iPS134	Forward primer sequencing Cas plasmids from Addgene	TTTACGGGCATGCATAAGGCTCG
iPS135	Reverse primer sequencing Cas plasmids from Addgene	GTACCTAGGACTGAGCTAGCCG
iPS136	Reverse primer sequencing DS-SPCasN- from Addgene	CTGCATGAAGTTCCGGTTGGC
iPS137	Forward primer sequencing DS-SPCasN- from Addgene	GAAACAGCTCAAGAGGCGCCG
iPS138	Prefix	GAATTCGCGGCCGCTTCTAGAG
iPS139	Suffix	CTGCAGCGGCCGCTACTAGTA
iPS83	4bases_Prefix	ATTCGAATTCGCGGCCGCTTCTAGAG
iPS84	4bases_suffix	AGTACTGCAGCGGCCGCTACTAGTA
Ptet_R	Primer for Gibson assembly plasmid	TTCTGCTGATGTGCTCAGTATC
Link-TDdcas_F	Primer for Gibson assembly link-TDdcas	TGAAAACCTGTACTTCCAGGGTGGTTCTG GTGGTGGTGGTTCTAAGAAGGAGATCAA
Ter_TDdcas_R	Primer for Gibson assembly TDdcas-Ter	CTTTAATGAATTCGGTCAGTGCGAGGAAT GGTCAAGGTCCCAG
Tet-SPdcas_F	Primer for Gibson assembly Tet-SPdcas	GATACTGAGCACATCAGCAGGAACTTTTA CTAGAGGAGGAGGCA
Link-SPdcas_R	Primer for Gibson assembly SPdcas-link	CACCCTGGAAGTACAGGTTTTCACCACCA GAACCACCACCACCGTCTCCACCGAGCT
Ptet_F	Primer for Gibson assembly plasmid	CGCACTGACCGAATTCATTAAAG
1152_pheoF	Forward primer amplification pUC19 insert	GAATTCGAGCTCGGTACCC
1151_pheoR	Reverse primer amplification pUC19 insert	AAGCTTGCATGCCTGCAG

PCR with Taq PCRx DNA Polymerase (recombinant) or DreamTaq DNA Polymerase from ThermoFisher Scientific

• Prepare enough PCR master mix for the number of colonies analyzed plus one extra. Mix the following reagents :

Components	Volume
10x Taq buffer with KCl	2µL
MgCl2 (25mM)	1.2µL
dNTP (10mM)	2µL
Primers mix (10µM each)	1.2µL
Taq DNA polymerase	0.1µL
Nuclease-free water	up to 20µL
Total volume	20µL

or

Components	Volume
10X DreamTaq Green Buffer	2.5µL
dNTP (10mM)	2.5µL
Primers mix (10µM each)	1µL
DreamTaq DNA polymerase	0.13µL
Nuclease-free water	up to 25µL
Total volume	25µL

• Mix gently and aliquot 20μL or 25μL of the mix into the PCR tubes on ice.
• Pick up an individual colony with a sterile pipette tip and resuspend it in 20μL or 25μL of the PCR master mix (or take 1μL of liquid preculture). Make a short strike with the same tip over culture plate to save the clone for repropagation.
• Perform PCR as follow (annealing temperature can be calculated here):

Step	Temperature	Time
Initial denaturation	95°C	3min
30 cycles	94°C	30sec
	Tannealing	30sec
	72°C	1min/kb
Final Extension	72°C	7min
Hold	4°C	$\infty$

• Analyze on a gel for the presence of the PCR product of the expected length.

PCR with Q5^® High-Fidelity 2X Master Mix from NEB

• Prepare enough PCR master mix for the number of colonies analyzed plus one extra. For each 25μl of reaction, mix the following reagents :

Components	Volume
Q5 High-Fidelity 2X Master Mix	12.5µL
Primers mix (10µM each)	2.5µL
Template DNA (from extractions)	1µL
Nuclease-free water	up to 25µL
Total volume	25µL

• Mix gently and aliquot 25μl of the mix into the PCR tubes on ice.
• Perform PCR as follow (annealing temperature can be calculated [http://tmcalculator.neb.com/#!/ here]):

Step	Temperature	Time
Initial denaturation	98°C	3min
30 cycles	98°C	10sec
	Tannealing	20sec
	72°C	30sec/kb
Final Extension	72°C	2min
Hold	4°C	$\infty$

• Analyze on a gel for the presence of the PCR product of the expected length.

PCR with Phusion High-Fidelity DNA Polymerase from ThermoFisher Scientific

• Prepare enough PCR master mix for the number of colonies analyzed plus one extra. For each 50μl of reaction, mix the following reagents :

Components	Volume
Buffer 5x HF	10µL
dNTP (10mM)	1µL
Primers mix (10µM each)	5µL
Template DNA (from extractions)	1µL
Phusion DNA polymerase	1µL
Nuclease-free water	up to 50µL
Total volume	50µL

• Mix gently and aliquot 50μl of the mix into the PCR tubes on ice.
• Perform PCR as follow (annealing temperature can be calculated here):

Step	Temperature	Time
Initial denaturation	98°C	30sec
30 cycles	98°C	10sec
	Tannealing	30sec
	72°C	30sec/kb
Final Extension	72°C	7min
Hold	4°C	$\infty$

• Analyze on a gel for the presence of the PCR product of the expected length.

Purification : PCR clean-up with NucleoSpin Gel and PCR Clean-up

Adjuste DNA binding condition

PCR sample must have 50-100µL and if not, water is added. 1 volume of sample was mixed with 2 volumes of Buffer NT1.

Bind DNA

NucleoSpin gel and PCR Clean-up column were placed into collection tube (2mL). The sample are centrifuged at 11,000rpm for 30s. The flow-through is discarded and the column put back into the collection tube.

Wash silica membrane

700µL of Buffer NT3 is added in each column. The tubes were centrifuged at 11,000 rpm for 30s. The flow-through is discarded and the column put back into the collection tube. This step is repeated another time.

Dry silica membrane

The tubes were centrifuged 1min at 11,000 rpm to removed completely.

Elute DNA

The NuleoSpin gel and PCR clean-up column were put into new tube (1.5mL) and 30*L of Buffer NE was added. The tube were left incubated for 1 at RT and then centrifuged 1min at 11,000 rpm.

• Analyze on a gel for the presence of the PCR product of the expected length.