Team:Chalmers Gothenburg/Project/Constructs

Chalmers Gothenburg iGEM 2016

PROJECT
Constructs

All the constructs used in our project are summarized on this page. The DNA fragments of each construct were assembled with Gibson assembly after addition of overlapping sequences through PCR with primers containing overhangs to the adjacent DNA fragment (20-25 base pairs). Design of constructs and primers were performed in Snapgene with the aid of the web tools NEBuilder and Tm calculator. DNA sequences were obtained using Genbank, KEGG and Addgene.

Synechocystis sp. PCC 6803

The constructs for Synechocystis are based on three different knock-outs: argininosuccinate lyase (ArgH), glutamine synthetase (GlnA) and acetyl-CoA synthetase (Acs). ArgH is knocked out when Synechocystis is going to be used in a consortia with E. coli or B. subtilis, while GlnA is knocked out when Y. lipolytica or S. cerevisiae is the producing organisms. Furthermore, AckA and pta are overexpressed in Synechocystis, along with knock-out of Acs, to increase the metabolic flux towards acetate through the pta-AckA pathway [1]. As a starting point, the mutant JA06 received by the Paul Hudson group at KTH was used as it already excreted some amounts of acetate [2]

Figure 1. pNF_dphaA_KmR

The homology regions for the knock-out constructs are designed to be around 1000 base pairs each. All Synechocystis constructs are modified versions of the pNF plasmid, shown in Figure 1, which contains the E. coli origin of replication pBR322, an ampicillin resistance marker and a kanamycin resistance marker (KmR). This plasmid was linearized with the primers in Table 1, which only amplified the origin of replication and amp marker, before Gibson assembly.

One important thing to keep in mind when knocking out genes in Synechocystis is the fact that it has several copies of its genome [3]. To make sure that all of the copies of the specific amino acid synthesising gene is knocked out, transformants should be restreaked several times and checked through colony PCR [4].

Table 1. Primers used for linearizing pNF
Primers Sequence (5’ → 3’)
pNF FW GTTCACTGGCCGTCGTTTTAC
pNF RV CATGCAAGCTTGGCGTAATC

Constructs for simultaneous knock-out and insertion

1. Knock-out ArgH + insert AckA

This construct consists of five parts: upstream homology region of ArgH, KmR cassette, pTrc promoter, AckA and the downstream homology region, Figure 2. This construct knocks out the ArgH gene when transformed into Synechocystis, making it an arginine auxotroph which is needed to make the cyanobacteria dependent on the producing organism. Furthermore, the endogenous AckA is inserted under the control of the strong consecutive promoter pTrc, for increased acetate production. By combining these two modifications into one construct, the number of constructs were reduced and thus the number of different markers needed.

Figure 2. Construct for simultaneous knock-out of ArgH and insertion of AckA

All the primers used for this construct are shown in Table 2. AckA and the flanking sequences of ArgH are amplified from genomic DNA of Synechocystis. The KmR cassette is amplified from the pNF plasmid and the pTrc promoter is amplified from the pCyJ2 plasmid.

Table 2. Primers used for generating the fragments for the ArgH knock-out and AckA insertion. Uppercase characters hybridize to the template, while the lowercase characters contain the overlapping overhang to the fragment within the parenthesis in the primer name. The numbering of the primers indicates which constructs it can be used for.
Primers Sequence (5’ → 3’)
1,5 ArgH Up FW (pNF) accatgattacgccaagcttgcatgCGCCTGTTATAACACCCC
1,5 ArgH Up RV (KmR) gctctagagtgatagaattcGGGATTTCGTTGTGATAGTTAG
1 Kmr FW (argH) ttgctaactatcacaacgaaatcccGAATTCTATCACTCTAGAGCCAGG
1 Kmr RV (pTrc) attctgcctcgtgatacgcctaggtCGCTACTAGTACAACAAAGCCA
1,2, pTrc FW (KmR) gctttgttgtactagtagcgACCTAGGCGTATCACGAGG
1,2, pTrc RV (AckA) ttgagaatcaggaatttcatTCTAGATTTCTCCTCTTTTGTGTG
1 AckA FW (pTrc) tcacacaaaagaggagaaatctagaATGAAATTCCTGATTCTCAATGC
1 AckA RV (argH) aacctgggcatatctccacaccaatAGCCTAATTCAACATTTATCTTCAC
1 ArgH Dw FW (AckA) gataaatgttgaattaggctATTGGTGTGGAGATATGCC
1,5 ArgH Dw RV (pNF) cgttgtaaaacgacggccagtgaacCACCTTTTAAAAGAATGGCG

2. Knock-out GlnA + insert AckA

The purpose of this five-piece construct (Figure 3) is to make synechocystis glutamine auxotroph, while also overexpressing AckA for increased acetate production.

Figure 3.Construct for simultaneous knock-out of GlnA and insertion of AckA

All the primers used for this construct are shown in Table 3. AckA and the flanking sequences of GlnA are amplified from genomic DNA of synechocystis. The KmR cassette is amplified from the pNF plasmid and the pTrc promoter is amplified from the pCyJ2 plasmid

Table 3. Primers used for generating the fragments for the GlnA knock-out and AckA insertion. Uppercase characters hybridize to the template, while the lowercase characters contain the overlapping overhang to the fragment within the parenthesis in the primer name. The numbering of the primers indicates which constructs it can be used for.
Primers Sequence (5’ → 3’)
2,6 glnA Up FW (pNF) accatgattacgccaagcttgcatgAAAACGTCATGGCGATC
2,6 glnA Up RV (KmR) gctctagagtgatagaattcTTTTTCTCCTTAGTGCAGTCAG
2 KmR FW (glnA) tatctgactgcactaaggagaaaaaGAATTCTATCACTCTAGAGCCAGG
2 KmR RV (pTrc) attctgcctcgtgatacgcctaggtCGCTACTAGTACAACAAAGCCA
1,2 pTrc FW (KmR) gctttgttgtactagtagcgACCTAGGCGTATCACGAGG
1,2 pTrc RV (AckA) ttgagaatcaggaatttcatTCTAGATTTCTCCTCTTTTGTGTG
2 AckA FW (pTrc) tcacacaaaagaggagaaatctagaATGAAATTCCTGATTCTCAATGC
2 AckA RV (glnA) ctaaaactgggtgagatggactggtAGCCTAATTCAACATTTATCTTCAC
2 glnA Dw FW (AckA) gataaatgttgaattaggctACCAGTCCATCTCACCCA
2,6 glnA Dw RV (pNF) cgttgtaaaacgacggccagtgaacGAGTGGATTTTAAAAACTCTTCGAC

3. Knock-out Acs + insert RFP

This construct (Figure 4) knocks out Acs to increase the acetate production [1], while also expressing mRFP1 to be able to quantify the levels of Synechocystis compared to the producing organism in the microbial consortia.

Figure 4. Construct for simultaneous knock-out of Acs and insertion of mRFP1

All the primers used for this construct are shown in Table 4. The flanking sequences of Acs are amplified from genomic DNA of Synechocystis and mRFP1 is amplified from a plasmid supplied by the last year iGEM team of Chalmers Gothenburg. The SpR cassette and the pTrc promoter are amplified from the pCyJ2 plasmid. The terminator tB0015 is amplified from the pNF plasmid.

Table 4. Primers used for generating the fragments for the Acs knock-out and mRFP1 insertion. Uppercase characters hybridize to the template, while the lowercase characters contain the overlapping overhang to the fragment within the parenthesis in the primer name. The numbering of the primers indicates which constructs it can be used for.
Primers Sequence (5’ → 3’)
3,4,7 acs Up FW (pNF) accatgattacgccaagcttgcatgCAAATTAGCCAAACCCACG
3,4,7 acs Up RV (SpR) ccaccaattttctcttcagcTAGCGTGTTGGACAAATTACG
3,4 SpR FW (acs) ctcccgtaatttgtccaacacgctaGCTGAAGAGAAAATTGGTGG
3,4 SpR RV (pTrc) attctgcctcgtgatacgcctaggtTAAGAGGTTCCAACTTTCACC
3,4 pTrc FW (SpR) gtgaaagttggaacctcttaACCTAGGCGTATCACGAGGC
3 pTrc RV (RFP1) acgtcctcggaggaggCCATTCTAGATTTCTCCTCTTTTGTGTG
3 RFP FW (pTrc) tcacacaaaagaggagaaatctagaATGGCCTCCTCCGAGG
3 RFP RV (tB0015) tcgggtgggcctttctgcgtttataTTAGGCGCCGGTGGA
3 B0015 FW (RFP1) gccactccaccggcgcctaaTATAAACGCAGAAAGGCCC
3 B0015 RV (acs Dw) aaagactttgacggagaaccCCAGGCATCAAATAAAACG
3 acs Dw FW (tB0015) gcctttcgttttatttgatgcctggGGTTCTCCGTCAAAGTCTTT
3,4,7 acs Dw RV (pNF) cgttgtaaaacgacggccagtgaacTTTCCACTTCACTTGGTTTGT

4. Knock-out Acs + insert Pta

The purpose of the final knock-out and insertion construct (Figure 5) is to increase the acetate production in Synechocystis by knocking out Acs and overexpressing Pta [1].

Figure 5. Construct for simultaneous knock-out of Acs and insertion of Pta.

All the primers used for this construct are shown in Table 5. The fragments are almost the same as in construct 3, expect the overhangs of the fragments and the Pta gene (amplified from genomic DNA of synechocystis) which replaced the mRFP1

Table 5. Primers used for generating the fragments for the Acs knock-out and pta insertion. Uppercase characters hybridize to the template, while the lowercase characters contain the overlapping overhang to the fragment within the parenthesis in the primer name. The numbering of the primers indicates which constructs it can be used for.
Primers Sequence (5’ → 3’)
3,4,7 acs Up FW (pNF) accatgattacgccaagcttgcatgCAAATTAGCCAAACCCACG
3,4,7 acs Up RV (SpR) ccaccaattttctcttcagcTAGCGTGTTGGACAAATTACG
3,4 SpR FW (acs) ctcccgtaatttgtccaacacgctaGCTGAAGAGAAAATTGGTGG
3,4 SpR RV (pTrc) attctgcctcgtgatacgcctaggtTAAGAGGTTCCAACTTTCACC
3,4 pTrc FW (SpR) gtgaaagttggaacctcttaACCTAGGCGTATCACGAGGC
4 pTrc RV (pta) aaataaagggaactcgtcatTCTAGATTTCTCCTCTTTTGTGTG
4 pta FW (pTrc) tcacacaaaagaggagaaatctagaATGACGAGTTCCCTTTATTTAAGC
4 pta RV (acs Dw) aaagactttgacggagaaccTTTGGAGGGCAAAATCAAG
4 acs Dw FW (pta) aattaccttgattttgccctccaaaGGTTCTCCGTCAAAGTCTTT
3,4,7 acs Dw RV (pNF) cgttgtaaaacgacggccagtgaacTTTCCACTTCACTTGGTTTGT

Constructs for knock-out only

The following constructs are simplified variants of the previous ones by limiting the modification to a knock-out, without inserting additional genes except the marker.

5. Knock-out Argh

In this construct (Figure 6), ArgH is knocked out in Synechocystis by selection with kanamycin

Figure 6. Construct for knock-out of ArgH.

All the primers used for this construct are shown in Table 6. The only difference in the fragments of this construct compared to construct 1 is the overlapping overhangs.

Table 6. Primers used for generating the fragments for the ArgH knock-out. Uppercase characters hybridize to the template, while the lowercase characters contain the overlapping overhang to the fragment within the parenthesis in the primer name. The numbering of the primers indicates which constructs it can be used for.
Primers Sequence (5’ → 3’)
1,5 ArgH Up FW (pNF) accatgattacgccaagcttgcatgCGCCTGTTATAACACCCC
1,5 ArgH Up RV (KmR) gctctagagtgatagaattcGGGATTTCGTTGTGATAGTTAG
5,6 KmR FW GAATTCTATCACTCTAGAGCCAGG
5,6 KmR RV CGCTACTAGTACAACAAAGCCA
5 ArgH Dw FW (KmR) acgtggctttgttgtactagtagcgATTGGTGTGGAGATATGC
1,5 ArgH Dw RV (pNF) cgttgtaaaacgacggccagtgaacCACCTTTTAAAAGAATGGCG

6. Knock-out GlnA

In this construct (Figure 7), ArgH is knocked out in Synechocystis by selection with kanamycin

Figure 7. Construct for knock-out of GlnA.

All the primers used for this construct are shown in Table 7. The only difference in the fragments of this construct compared to construct 2 is the overlapping overhangs.

Table 7. Primers used for generating the fragments for the GlnA knock-out. Uppercase characters hybridize to the template, while the lowercase characters contain the overlapping overhang to the fragment within the parenthesis in the primer name. The numbering of the primers indicates which constructs it can be used for.
Primers Sequence (5’ → 3’)
2,6 glnA Up FW (pNF) accatgattacgccaagcttgcatgAAAACGTCATGGCGATC
2,6 glnA Up RV (KmR) gctctagagtgatagaattcTTTTTCTCCTTAGTGCAGTCAG
5,6 KmR FW GAATTCTATCACTCTAGAGCCAGG
5,6 KmR RV CGCTACTAGTACAACAAAGCCA
6 glnA Dw FW (KmR) gctttgttgtactagtagcgACCAGTCCATCTCACCCA
2,6 glnA Dw RV (pNF) cgttgtaaaacgacggccagtgaacGAGTGGATTTTAAAAACTCTTCGAC

7. Knock-out of Acs

In this construct (Figure 8), Acs is knocked out in Synechocystis by selection with spectinomycin.

Figure 8. Construct for knock-out of Acs

All the primers used for this construct are shown in Table 8. The only difference in the fragments of this construct compared to construct 3 and 4 is the overlapping overhangs.

Table 8. Primers used for generating the fragments for the Acs knock-out. Uppercase characters hybridize to the template, while the lowercase characters contain the overlapping overhang to the fragment within the parenthesis in the primer name. The numbering of the primers indicates which constructs it can be used for.
Primers Sequence (5’ → 3’)
3,4,7 acs Up FW (pNF) accatgattacgccaagcttgcatgCAAATTAGCCAAACCCACG
3,4,7 acs Up RV (SpR) ccaccaattttctcttcagcTAGCGTGTTGGACAAATTACG
7 SpR FW GCTGAAGAGAAAATTGGTGG
7 SpR RV TAAGAGGTTCCAACTTTCACC
7 acs Dw F (SpR) gtgaaagttggaacctcttaGGTTCTCCGTCAAAGTCTTT
3,4,7 acs Dw RV (pNF) cgttgtaaaacgacggccagtgaacTTTCCACTTCACTTGGTTTGT