Team:Chalmers Gothenburg/Project/Constructs
All the constructs used in our project are summarized on this page. The DNA fragments of each construct were assembled with Gibson assembly after addition of overlapping sequences through PCR with primers containing overhangs to the adjacent DNA fragment (20-25 base pairs). Design of constructs and primers were performed in Snapgene with the aid of the web tools NEBuilder and Tm calculator. DNA sequences were obtained using Genbank, KEGG, and Addgene.
Synechocystis sp. PCC 6803
The constructs for Synechocystis are based on three different knock-outs: argininosuccinate lyase (ArgH), glutamine synthetase (GlnA) and acetyl-CoA synthetase (Acs). ArgH is knocked out when Synechocystis is going to be used in a consortia with E. coli or B. subtilis, while GlnA is knocked out when Y. lipolytica or S. cerevisiae is the producing organisms. Furthermore, AckA and pta are overexpressed in Synechocystis, along with knock-out of Acs, to increase the metabolic flux towards acetate through the pta-AckA pathway [1]. As a starting point, the mutant JA06 received by the Paul Hudson group at KTH was used as it already excreted some amounts of acetate [2].
The homology regions for the knock-out constructs are designed to be around 1000 base pairs each. All Synechocystis constructs are modified versions of the pNF plasmid, shown in Figure 1, which contains the E. coli origin of replication pBR322, an ampicillin resistance marker and a kanamycin resistance marker (KmR). This plasmid was linearized with the primers in Table 1, which only amplified the origin of replication and amp marker, before Gibson assembly.
One important thing to keep in mind when knocking out genes in Synechocystis is the fact that it has several copies of its genome [3]. To make sure that all of the copies of the specific amino acid synthesising gene is knocked out, transformants should be restreaked several times and checked through colony PCR [4].
| Primers | Sequence (5’ → 3’) |
|---|---|
| pNF FW | GTTCACTGGCCGTCGTTTTAC |
| pNF RV | CATGCAAGCTTGGCGTAATC |
Constructs for simultaneous knock-out and insertion
1. Knock-out ArgH + insert AckA
This construct consists of five parts: upstream homology region of ArgH, KmR cassette, pTrc promoter, AckA and the downstream homology region, Figure 2. This construct knocks out the ArgH gene when transformed into Synechocystis, making it an arginine auxotroph which is needed to make the cyanobacteria dependent on the producing organism. Furthermore, the endogenous AckA is inserted under the control of the strong consecutive promoter pTrc, for increased acetate production. By combining these two modifications into one construct, the number of constructs were reduced and thus the number of different markers needed.
All the primers used for this construct are shown in Table 2. AckA and the flanking sequences of ArgH are amplified from genomic DNA of Synechocystis. The KmR cassette is amplified from the pNF plasmid and the pTrc promoter is amplified from the pCyJ2 plasmid.
| Primers | Sequence (5’ → 3’) |
|---|---|
| 1,5 ArgH Up FW (pNF) | accatgattacgccaagcttgcatgCGCCTGTTATAACACCCC |
| 1,5 ArgH Up RV (KmR) | gctctagagtgatagaattcGGGATTTCGTTGTGATAGTTAG |
| 1 Kmr FW (argH) | ttgctaactatcacaacgaaatcccGAATTCTATCACTCTAGAGCCAGG |
| 1 Kmr RV (pTrc) | attctgcctcgtgatacgcctaggtCGCTACTAGTACAACAAAGCCA |
| 1,2, pTrc FW (KmR) | gctttgttgtactagtagcgACCTAGGCGTATCACGAGG |
| 1,2, pTrc RV (AckA) | ttgagaatcaggaatttcatTCTAGATTTCTCCTCTTTTGTGTG |
| 1 AckA FW (pTrc) | tcacacaaaagaggagaaatctagaATGAAATTCCTGATTCTCAATGC |
| 1 AckA RV (argH) | aacctgggcatatctccacaccaatAGCCTAATTCAACATTTATCTTCAC |
| 1 ArgH Dw FW (AckA) | gataaatgttgaattaggctATTGGTGTGGAGATATGCC |
| 1,5 ArgH Dw RV (pNF) | cgttgtaaaacgacggccagtgaacCACCTTTTAAAAGAATGGCG |
2. Knock-out GlnA + insert AckA
The purpose of this five-piece construct (Figure 3) is to make synechocystis glutamine auxotroph, while also overexpressing AckA for increased acetate production.
All the primers used for this construct are shown in Table 3. AckA and the flanking sequences of GlnA are amplified from genomic DNA of synechocystis. The KmR cassette is amplified from the pNF plasmid and the pTrc promoter is amplified from the pCyJ2 plasmid.
| Primers | Sequence (5’ → 3’) |
|---|---|
| 2,6 glnA Up FW (pNF) | accatgattacgccaagcttgcatgAAAACGTCATGGCGATC |
| 2,6 glnA Up RV (KmR) | gctctagagtgatagaattcTTTTTCTCCTTAGTGCAGTCAG |
| 2 KmR FW (glnA) | tatctgactgcactaaggagaaaaaGAATTCTATCACTCTAGAGCCAGG |
| 2 KmR RV (pTrc) | attctgcctcgtgatacgcctaggtCGCTACTAGTACAACAAAGCCA |
| 1,2 pTrc FW (KmR) | gctttgttgtactagtagcgACCTAGGCGTATCACGAGG |
| 1,2 pTrc RV (AckA) | ttgagaatcaggaatttcatTCTAGATTTCTCCTCTTTTGTGTG |
| 2 AckA FW (pTrc) | tcacacaaaagaggagaaatctagaATGAAATTCCTGATTCTCAATGC |
| 2 AckA RV (glnA) | ctaaaactgggtgagatggactggtAGCCTAATTCAACATTTATCTTCAC |
| 2 glnA Dw FW (AckA) | gataaatgttgaattaggctACCAGTCCATCTCACCCA |
| 2,6 glnA Dw RV (pNF) | cgttgtaaaacgacggccagtgaacGAGTGGATTTTAAAAACTCTTCGAC |
3. Knock-out Acs + insert RFP
This construct (Figure 4) knocks out Acs to increase the acetate production [1], while also expressing mRFP1 to be able to quantify the levels of Synechocystis compared to the producing organism in the microbial consortia.
All the primers used for this construct are shown in Table 4. The flanking sequences of Acs are amplified from genomic DNA of Synechocystis and mRFP1 is amplified from a plasmid supplied by the last year iGEM team of Chalmers Gothenburg. The SpR cassette and the pTrc promoter are amplified from the pCyJ2 plasmid. The terminator tB0015 is amplified from the pNF plasmid.
| Primers | Sequence (5’ → 3’) |
|---|---|
| 3,4,7 acs Up FW (pNF) | accatgattacgccaagcttgcatgCAAATTAGCCAAACCCACG |
| 3,4,7 acs Up RV (SpR) | ccaccaattttctcttcagcTAGCGTGTTGGACAAATTACG |
| 3,4 SpR FW (acs) | ctcccgtaatttgtccaacacgctaGCTGAAGAGAAAATTGGTGG |
| 3,4 SpR RV (pTrc) | attctgcctcgtgatacgcctaggtTAAGAGGTTCCAACTTTCACC |
| 3,4 pTrc FW (SpR) | gtgaaagttggaacctcttaACCTAGGCGTATCACGAGGC |
| 3 pTrc RV (RFP1) | acgtcctcggaggaggCCATTCTAGATTTCTCCTCTTTTGTGTG |
| 3 RFP FW (pTrc) | tcacacaaaagaggagaaatctagaATGGCCTCCTCCGAGG |
| 3 RFP RV (tB0015) | tcgggtgggcctttctgcgtttataTTAGGCGCCGGTGGA |
| 3 B0015 FW (RFP1) | gccactccaccggcgcctaaTATAAACGCAGAAAGGCCC |
| 3 B0015 RV (acs Dw) | aaagactttgacggagaaccCCAGGCATCAAATAAAACG |
| 3 acs Dw FW (tB0015) | gcctttcgttttatttgatgcctggGGTTCTCCGTCAAAGTCTTT |
| 3,4,7 acs Dw RV (pNF) | cgttgtaaaacgacggccagtgaacTTTCCACTTCACTTGGTTTGT |
4. Knock-out Acs + insert Pta
The purpose of the final knock-out and insertion construct (Figure 5) is to increase the acetate production in Synechocystis by knocking out Acs and overexpressing Pta [1].
All the primers used for this construct are shown in Table 5. The fragments are almost the same as in construct 3, expect the overhangs of the fragments and the Pta gene (amplified from genomic DNA of synechocystis) which replaced the mRFP1.
| Primers | Sequence (5’ → 3’) |
|---|---|
| 3,4,7 acs Up FW (pNF) | accatgattacgccaagcttgcatgCAAATTAGCCAAACCCACG |
| 3,4,7 acs Up RV (SpR) | ccaccaattttctcttcagcTAGCGTGTTGGACAAATTACG |
| 3,4 SpR FW (acs) | ctcccgtaatttgtccaacacgctaGCTGAAGAGAAAATTGGTGG |
| 3,4 SpR RV (pTrc) | attctgcctcgtgatacgcctaggtTAAGAGGTTCCAACTTTCACC |
| 3,4 pTrc FW (SpR) | gtgaaagttggaacctcttaACCTAGGCGTATCACGAGGC |
| 4 pTrc RV (pta) | aaataaagggaactcgtcatTCTAGATTTCTCCTCTTTTGTGTG |
| 4 pta FW (pTrc) | tcacacaaaagaggagaaatctagaATGACGAGTTCCCTTTATTTAAGC |
| 4 pta RV (acs Dw) | aaagactttgacggagaaccTTTGGAGGGCAAAATCAAG |
| 4 acs Dw FW (pta) | aattaccttgattttgccctccaaaGGTTCTCCGTCAAAGTCTTT |
| 3,4,7 acs Dw RV (pNF) | cgttgtaaaacgacggccagtgaacTTTCCACTTCACTTGGTTTGT |
Constructs for knock-out only
The following constructs are simplified variants of the previous ones by limiting the modification to a knock-out, without inserting additional genes except the marker.
5. Knock-out Argh
In this construct (Figure 6), ArgH is knocked out in Synechocystis by selection with kanamycin.
All the primers used for this construct are shown in Table 6. The only difference in the fragments of this construct compared to construct 1 is the overlapping overhangs.
| Primers | Sequence (5’ → 3’) |
|---|---|
| 1,5 ArgH Up FW (pNF) | accatgattacgccaagcttgcatgCGCCTGTTATAACACCCC |
| 1,5 ArgH Up RV (KmR) | gctctagagtgatagaattcGGGATTTCGTTGTGATAGTTAG |
| 5,6 KmR FW | GAATTCTATCACTCTAGAGCCAGG |
| 5,6 KmR RV | CGCTACTAGTACAACAAAGCCA |
| 5 ArgH Dw FW (KmR) | acgtggctttgttgtactagtagcgATTGGTGTGGAGATATGC |
| 1,5 ArgH Dw RV (pNF) | cgttgtaaaacgacggccagtgaacCACCTTTTAAAAGAATGGCG |
6. Knock-out GlnA
In this construct (Figure 7), ArgH is knocked out in Synechocystis by selection with kanamycin.
All the primers used for this construct are shown in Table 7. The only difference in the fragments of this construct compared to construct 2 is the overlapping overhangs.
| Primers | Sequence (5’ → 3’) |
|---|---|
| 2,6 glnA Up FW (pNF) | accatgattacgccaagcttgcatgAAAACGTCATGGCGATC |
| 2,6 glnA Up RV (KmR) | gctctagagtgatagaattcTTTTTCTCCTTAGTGCAGTCAG |
| 5,6 KmR FW | GAATTCTATCACTCTAGAGCCAGG |
| 5,6 KmR RV | CGCTACTAGTACAACAAAGCCA |
| 6 glnA Dw FW (KmR) | gctttgttgtactagtagcgACCAGTCCATCTCACCCA |
| 2,6 glnA Dw RV (pNF) | cgttgtaaaacgacggccagtgaacGAGTGGATTTTAAAAACTCTTCGAC |
7. Knock-out of Acs
In this construct (Figure 8), Acs is knocked out in Synechocystis by selection with spectinomycin.
All the primers used for this construct are shown in Table 8. The only difference in the fragments of this construct compared to construct 3 and 4 is the overlapping overhangs.
| Primers | Sequence (5’ → 3’) |
|---|---|
| 3,4,7 acs Up FW (pNF) | accatgattacgccaagcttgcatgCAAATTAGCCAAACCCACG |
| 3,4,7 acs Up RV (SpR) | ccaccaattttctcttcagcTAGCGTGTTGGACAAATTACG |
| 7 SpR FW | GCTGAAGAGAAAATTGGTGG |
| 7 SpR RV | TAAGAGGTTCCAACTTTCACC |
| 7 acs Dw F (SpR) | gtgaaagttggaacctcttaGGTTCTCCGTCAAAGTCTTT |
| 3,4,7 acs Dw RV (pNF) | cgttgtaaaacgacggccagtgaacTTTCCACTTCACTTGGTTTGT |
Bacillus subtilis
The purpose of the constructs in B. subtilis is to enable it to grow on acetate and overproduce arginine. Both constructs are based on the vectors from the bacillus box made by the 2012 LMU-Munich iGEM-team [6].
1. Glyoxylate shunt
B. subtilis cannot utilize acetate as a carbon source, which can be solved by inserting the glyoxylate shunt from Bacillus licheniformis into B. subtilis, see Figure X. The shunt consists of two enzymes in an operon, aceA and aceB, under the control of a native B. licheniformis promoter, which have been shown to be active in B. subtilis as well [7].
The glyoxylate shunt was amplified from extracted genomic DNA from with the primers in Table X. Both the product and the vector pBs4S were cut with Xba1 and Spe1 before ligation and transformation into E. coli. This was not optimal as there is a risk of vector-only clones due to overlaps of Xba1 and Spe1 sticky ends, but had to be done anyway because the shunt contained both EcoR1 and Pst1 sites. They could have been removed through mutagenic PCR, but this was not done due to time limitations.
| Primers | Sequence (5’ → 3’) |
|---|---|
| glyox op FW (prefix) | gaattcgcggccgcttctagaGAAAAATATGAACAAGCTATGAATAAAAAG |
| glyox op RV (suffix) | ctgcagcggccgctactagtaAACAAACAACAGGAATCATCAGAC |
2. ahrC knock-out
The second modification to B. subtilis was to make it overproduce arginine needed by the cyanobacteria in the co-culture. This was done by deleting the gene ahrC, which codes for a repressor of arginine biosynthesis [8]. Furthermore, the reporter gene GFP was inserted to be able to quantify the abundance of B. subtilis relative the cyanobacteria in the co-culture. The final construct can be seen in Figure X.
The fragments were amplified with the primers in Table X. The homology regions up- and downstream of ahrC was amplified from genomic DNA extracted from B. subtilis. The reporter gene was assembled by ligation of the BioBricks BBa_E0840 and BBa_K823003, which was then amplified with primers containing overhangs for Gibson assembly. The chloramphenicol and ampicillin resistance gene were amplified from the pBs1C plasmid.
| Primers | Sequence (5’ → 3’) |
|---|---|
| Dw ahrC FW (amp+Ori) | aaccattattatcCCGATTCGATTTCTTCGAG |
| Dw ahrC RV | CAGAAAATCTAACAAAGATAAGAGGTG |
| cat FW (Dw ahrC) | cctcttatctttgttagattttctgTGTCAATTCTCATGTTTGACAGC |
| cat RV (pVeg+GFP) | tcgggtgggcctttctgcgtttataCTCCTGCATTAGGAAGCAGC |
| pVeg+GFP FW | TATAAACGCAGAAAGGCCC |
| pVeg+GFP RV (Up ahrC) | ttggaaatagaggtgcttacGGAGTTCTGAGAATTGGTATGC |
| Up ahrC FW (pVeg+GFP) | aactccGTAAGCACCTCTATTTCCAAGC |
| Up ahrC RV (ori+ampR) | gagctggatacttCTCTGTCAAAGATAAAATTATGATTG |
| amp+Ori FW (Up ahrC) | atctttgacagagAAGTATCCAGCTCGAGGTCG |
| amp+Ori RV (Dw ahrC) | gaaatcgaatcggGATAATAATGGTTTCTTAGACGTCAGG |
Saccharomyces cerevisiae
The constructs for S. cerevisiae are divided into two subprojects: the promoters study and the promoter exchange. The results of the promoter study are meant to guide the choice of promoters in the promoter exchange for increased production of glutamine in S. cerevisiae, which needed by the cyanobacteria in the co-culture.
1. Promoter study
The constructs for the promoter study are based on the p416tef plasmid, Figure X [9]. The promoters used in this study are shown in Table X and were cloned into this plasmid together with GFP as the reporter gene. This was done using Gibson assembly with 20 bp overlaps after cutting the vector with SacI and XbaI.
By using a replicative plasmid instead of chromosomal integration, a higher copy number can be achieved which will make sure that even weak promoters give a detectable signal, which will be compared against the signal from the TEF1 promoter.
All promoters were amplified from the genome of S. cerevisiae CEN.PK113-5D and GFP was amplified from the plasmid p416tef gfp. The primers used to amplify all parts are shown in Table X.
| Primers | Sequence (5’ → 3’) |
|---|---|
| GFP FW (p416 TEF1) | gcccgggggatccactagttCTATTTGTATAGTTCATCCATGCCATG |
| GFP R | ATGCGAATCCCCGGGTTA |
| pAQR1 FW (p416) | attaacccggggattcgcatTGCTGATTCGACTTTCTGAA |
| pAQR1 RV (p416) | gggaacaaaagctggagctcGTTCTGTTGCCGTATGCTATC |
| pFBP1 FW (p416) | attaacccggggattcgcatATGTGTGGTAGTATGAGGGATG |
| pFBP1 RV (p416) | gggaacaaaagctggagctcATATAAAATGAAAATAATATCCAAAGAAAAA |
| pGLN1 FW (p416) | attaacccggggattcgcatTTTTGATTATATTATATTATATTATGTTTAATTTTTGTT |
| pGLN1 RV (p416) | gggaacaaaagctggagctcGTATAAATAGTTATATAGAGATGAACTCTAAGCTAGTG |
| pPCK1 FW (p416) | attaacccggggattcgcatGTTGTTATTTTATTATGGAATAATTAGTTGC |
| pPCK1 RV (p416) | gggaacaaaagctggagctcTCGTTCGTTGTACGTACATTTAC |
| pPYK2 FW (p416) | attaacccggggattcgcatCGATAGTGCTTTTGTTGTAATCTT |
| pPYK2 RV (p416) | gggaacaaaagctggagctcCGCTTTTATGAACATATTCCG |
2. promoter exchange
The purpose of the promoter exchange is to fine tune the expression of Glutamine synthetase (GLN1) and Acids Quinidine Resistance (AQR1), which is an amino acid transporter [10], with the aim to increase the production and excretion of glutamine.
This is done in the strain S.cerevisiae IMX581, which has CRISPR/Cas9 integrated in its genome [11]. The plasmid pMEL13 from the same paper is linearized with PCR with primers in Table X prior Gibson assembly with a gBlock (ordered from IDT) containing the gRNA targeting the promoter region of GLN1 or AQR1, along with flanking regions of 50 basepair overlapping to pMEL13. The gRNA was designed with an online tool at Benchling.
| Primers | Sequence (5’ → 3’) |
|---|---|
| pMEL13 F | GTTTTAGAGCTAGAAATAGCAAGTTAAA |
| pMEL13 R | GATCATTTATCTTTCACTGCGG |
To exchange the promoter, the assembled pMEL13 was co-transformed with a linear DNA fragment containing the new promoter and homology regions to knock out either the promoter of GLN1 or AQR1, which was generated through PCR with the primers in Table X. As overexpression of GLN1 might lead to glutamate auxotrophy [12], the results of the promoter study will help guide the choice of promoter for GLN1
| Primers | Sequence (5’ → 3’) |
|---|---|
| pFBP1 FW (pAQR1 up) | ggcctgcattgttttcttcagacgagaagccgttccaacgtttctttttctcgtcaccggATATAAAATGAAAATAATATCCAAAGAAA |
| pFBP1 RV (pAQR1 dw) | ctcattgtgagtaggatacatctcaatatcttctgtgtatatactgttacttcgtgacatATGTGTGGTAGTATGAGGGATG |
| pPCK1 FW (pGLN1 up) | agcggtcaggtgtaagtagtaggcttgataatgaattaaagatgactccgacgcatattgTCGTTCGTTGTACGTACATTTAC |
| pPCK1 RV (pGLN1 dw) | ttggtccagttctagatatttttgtaaaatttgagtcttttcgatgcttgcttcagccatGTTGTTATTTTATTATGGAATAATTAGTTG |
| pPYK1 FW (pGLN1 up) | agcggtcaggtgtaagtagtaggcttgataatgaattaaagatgactccgacgcatattgCGCTTTTATGAACATATTCCG |
| pPYK1 RV (pGLN1 dw) | ttggtccagttctagatatttttgtaaaatttgagtcttttcgatgcttgcttcagccatCGATAGTGCTTTTGTTGTAATCTT |
| pTEF1 FW (pAQR1 up) | gcctgcattgttttcttcagacgagaagccgttccaacgtttctttttctcgtcaccggACAATGCATACTTTGTACGTTCA |
| pTEF1 RV (pAQR1 dw) | ctcattgtgagtaggatacatctcaatatcttctgtgtatatactgttacttcgtgacatTTTGTAATTAAAACTTAGATTAGATTGCT |
Yarrowia lipolytica
The constructs of Y. lipolytica are based on the two plasmids JMP1047 and JMP2563 [13], Figure X. Before Gibson assembly, both plasmids were cut with BamHI and AvrII. The overlaps on the fragments for the Gibson assembly were designed to be 25 base pairs and were generated through PCR. On the first plasmid GFP and the native Glutamine synthetase (GLN1) are expressed and on the second the amino acid transporter AQR1 [14] from S. cerevisiae.
1. Overexpression of GLN1 and GFP
A similar strategy were used for yarrowia as in S. cerevisiae to increase the glutamine production. The native GLN1 was overexpressed under the control of the native pTEF1 promoter, and GFP was expressed under the same promoter to allow quantification of Y. lipolytica in the co-culture. For the full construct, see Figure X. This construct was integrated into the genome of Y. lipolytica JMY2101 by random ectopic integration through the NHEJ recombination pathway [15].
The fragments for the constructs was generated through PCR with the primers in Table X. The gene GLN1 and the terminators tXPR2 and tLIP2 were amplified from genomic DNA of Y. lipolytica JMY2900. The GFP gene was amplified from the S. cerevisiae plasmid p416tef gfp. The promoter driving the expression of GFP was amplified from the JMP1047 plasmid.
| Primers | Sequence (5’ → 3’) |
|---|---|
| Gln1 F (JMP1047) | tctccttgtcaactcacacccgaagATGAACTGGGAATCCGAAC |
| Gln1 R (tXPR2) | aattgcTTAGACCGTCTCAATGTACCG |
| tXPR2 F (Glu1) | ggtacattgagacggtctaaGCAATTAACAGATAGTTTGCCG |
| tXPR2 R (tLip2) | tgaagttcatctgcgttgaaAGATCTGAGCGTGAATTATACGG |
| tLIP2 F (tXPR2) | agatctTTCAACGCAGATGAACTTCA |
| tLip2 R (GFP) | tggatgaactatacaaatagTATTTATCACTCTTTACAACTTCTACCTCAAC |
| GFP F (tLIP2) | taaataCTATTTGTATAGTTCATCCATGCCATG |
| GFP R (pTef) | ctcacacccgaagATGCGAATCCCCGGGTTA |
| pTef F (GFP) | cggggattcgcatCTTCGGGTGTGAGTTGACAAG |
| pTef R (JMP1047) | aaatagcttagataccacagacaccCGATAGAGACCGGGTTGG |
Overexpression of AQR1
The gene coding for the amino acid transporter AQR1 from S. cerevisiae CEN.PK113-5D was added to Y. lipolytica as we could not find a homolog in the genome of Y. lipolytica. It was inserted to the genome of the strain JMY330, through the same mechanisms as the previous construct, after Gibson assembly with the vector JMP2563.
The fragments for this construct was generated through PCR with the primers in Table X. The gene AQR1 was amplified from genomic DNA of S. cerevisiae CEN.PK113-5D and the terminator tXPR2 was amplified from genomic DNA of Y. lipolytica JMY2900.
| Primers | Sequence (5’ → 3’) |
|---|---|
| AQR1 F (JMP2563) | caactcacacccgaaggatcATGTCACGAAGTAACAGTATATACACAG |
| AQR1 R (tXPR2) | gcaaactatctgttaattgcTTAATTATGATTATCGTTCTGGTCTC |
| tXPR2 F (AQR1) | agaacgataatcataattaaGCAATTAACAGATAGTTTGCCG |
| tXPR2 R (JMP2563) | agataccacagacaccctagAGATCTGAGCGTGAATTATACGG |
