Team:BNDS China/Experiments
Experiments
I. Get cDNA of Orai1
Got pDEST501-Orai1 V102A from Prof. Wang Youjun’s Lab (Beijing Normal University)
Dissolved the filter carrying the plasmid into ddH2O
Took 3ul of the solution into Top 10 competent cell and transformed the plasmid into Top 10 cells.
II. Get Expression plasmid
Got pGEX-KG from Prof. Qi Xiaoqun’s Lab (Institute of Botany, The Chinese Academy of Sciences)
Took 3ul of the solution into Top 10 competent cell and transformed the plasmid into Top 10 cells.
III. Design primers
We designed two primers carrying restriction sites for Xba1 and Xho1.
| Orai Xba1-F | GGCCGTCTAGAATGAGCCTCAACGAGCAC |
| Orai Xho1-R | GTAGCCTCGAGCTAGGCATAGTGGCTGCC |
IV. PCR
Amplify Orai1 V102A using primers Orai Xba1-F and Orai Xho1-R in a 50ul PCR system containing PCR Buffer, dNTP, 1Unit of Taq DNA Polymerase and Mg2+.
V. PCR products purification
The digestion needs pure DNA fragments, so the PCR products were purified by using DNA purification kit. The purified products were detected by gel electrophoresis.
VI. Digestion
Cut both pGEX-KG and Orai1 V102A using Xba1 and Xho1 for 1 hour in 37℃.
VII. GEL extraction
Digestion products were applied into gel electrophoresis. The cut linear pGEX-KG showed a single clear band in the gel. And gel with the single band was cut and stored in -20 ℃. The DNA in gel was extracted by using GEL extraction kit.
VIII. Ligation
Linear pGEX-KG and Orai1 V102A PCR products were linked by using T4 ligase. The system contained 1Unit of Ligase and 1:3 pGEX-KG and Orai1 V102A in ligation buffer.
IX. Transformation
2ul of the ligation products pGEX-Orai1 V102A were transformed into Top10 competent cells. The cells are planted into Ampr LB Agar plates.
X. Colony PCR screening
We screened 20 colonies using colony PCR by the two primers and picked the ones with positive result into media growing.
XI. DNA extraction from Media
pGEX-Orai1 V102A was extracted from cell culture. And tested by gel electrophoresis and PCR.
