Team:INSA-Lyon/Proof

iGEM : Proof of Concept

 
PROOF OF CONCEPT
Read More

Proof of Concept

Building a multi-detection device of STIs based on aptamers

Detecting STIs with aptamers requires to assemble numerous components together. So let’s identify the cornerstones and how to make them fit together!

Detection System

The detection system relies on 3 major functional blocks.

Detection using a hook/target system
Revelation, either fluorescence or latex beads
Anchoring the system on paper

Detection using a hook/target system


Learn more about aptamers...



Introduction to aptamers...

4 different couples of targets/aptamers were used:

Adenosine aptamer: This aptamer is able to catch adenosine derivatives (ATP, ADP, AMP and Adenosine). It has the ability to bind cooperatively two molecules.
Its sequence is TCACTGACCTGGGGGAGTATTGCGGAGGAAGGT


Thrombin aptamers: as thrombin is the uppermost studied target of aptamers, we used it to make the proof of concept of the feasibility of protein detection. This is the first step to develop STIs detection thanks to the interaction biomarker/aptamers. The three known aptamers against thrombin were tested. They are identified by their length as shown below:
Aptamer 15b: GGTTGGTGTGGTTGG
Aptamer 29b: AGTCCGTGGTAGGGCAGGTTGGGGTGACT
Aptamer 31b: AAAAGTGACGTAGGTTGGTGTGGTTGGGGCGTCAC


HIV-1 Reverse Transcriptase (RT) aptamer is aimed at detecting circulating HIV-1 RT. There are plenty or variants of the same aptamer. We have chosen the most well described one. Here is its sequence:
TAATACCCCCCCTTCGGTGCTTTGCACCGAAGGGGGGG


HBsAg aptamer: HBsAg is a surface protein of the hepatitis B virus. Three differents aptamers were tested, here are their sequences:
Aptamer A: GGGAATTCGAGCTCGGTACCCACAGCGAACAGCGGCGGACATAATAGTGCTTACTACGACCTGCAGGCATGCAAGCTTGGGAG
2. Aptamer B: GGGAATTCGAGCTCGGTACCCACATGGCATGAAGTATTATTACCCAATTCCATACACAAGCTGCAGGCATGCAAGCTTGG
3. Aptamer C: GGGAATTCGAGCTCGGTACCGGCACAAGCATATGGACTCCTCTGAACCTACGATGTAGTACCTGCAGGCATGCAAGCTTGG

To both demonstrate the ability of our aptamers to fix their target, and the affinity constants, Electrophoretic Migration Shift Assay (EMSA) were set. A proof of concept was realized with a well described aptamer and its target protein: the human thrombin.
This experiment allows to measure the affinity of an aptamer with its target. The aptamer/protein complexes formed in presence of increasing amount of proteins were separated and quantified on native PAGE.

Fig 1. Aptamer-Thrombin complex analysis on native PAGE stained with SYBR Green.
The aptamer linked to its heavy target protein migrates at a slower rate than the free aptamer (not linked). Concentrations of thrombin are going from 10-4mol.L-1 (lane A) to 10-11 mol.L-1 (lane H), with a factor 10 between each lane. Lane I is the control with no thrombin. The DNA was at a constant concentration of 10 nM. The DNA linked to thrombin migrates slower than free DNA.
Fig 2. Comparison of the 3 thrombin aptamers affinities to the target.
This figure was obtained via integration of intensities of the lanes on several EMSAs (data not shown), with Bio-Rad ImageLab software. The curves were modeled to fit the points. This allowed to calculate the Kds.

All three aptamers are able to fix thrombin. The Kd are the concentration values corresponding to the inflexion points. Our most sensitive aptamer detects thrombin down to 350 nmol.L-1, corresponding to the aptamer of 31b.

Conclusion: Aptamers can be used as hooks to detect a protein biomarker.
Based on this encouraging results, EMSAs with two STIs couples biomarkers/aptamers were performed (RT biomarker for HIV-1 and HBsAg biomarker for Hepatitis B virus), see below.

The fluorescent revelation system

The first system we worked on was the fluorescence detection system.

Principle

The aptamer is bounded to a fluorescent group (FITC). To temporarily switch off the fluorescence, we fixed on its reverse-complement a quencher molecule, that quenches the fluorescence by Fluorescent Resonnance Energetic Transfert.
When the ATP comes, as its affinity for the aptamer is higher, he removes the quencher to link the aptamer, that becomes fluorescent.

To detect the fluorescence, we use the smartphone-with-filters technique: put a blue filter on your flash, a green one on your camera, and take a picture of your test. The FITC fluorescence should appear (see our Results page).

Linking aptamers to the fluorescein

The aptamer is decorated with fluorescein thanks to crosslinking in presence of FITC. This labelling allows further detection of the aptamer/target complex. The aptamer used here is known as ATP aptamer (DOI: 10.1021/la060961c) The mix was analyzed on a PAGE gel stained with ethidium bromide (red color). The gel was then analyzed thanks to a fluorescence imager (purple color). The figure below overlay the 2 images.

Fig 3. Observation of ATP Aptamer crosslinked with fluorescein on PAGE stained with ethidium bromide.
Two bands are visible under a UV lamp after ethidium bromide staining. Only the heaviest band was fluorescent.

Conclusion: we successfully labelled half of the aptamers with fluorescein.

Testing the system on paper


Fluorescent labelled ATP aptamers were loaded and separated on a PAGE gel. A constant amount was loaded in each well.
The DNA was blotted on nitrocellulose using capillary transfer. To quench the fluorescence we used quencher oligos. They are reverse complement fragments of 6 nucleotides of the aptamer labelled with a DABCYL molecule at their 3’ end. These quencher oligos were hybridized in situ by incubating the membrane in hybridization buffer, we used the same buffer as for Southern blots. After washing the quencher excess, increasing amount of ATP gradient was applied on each lane of the nitrocellulose membrane. The figure below shows the fluorescence on the membrane observed with the ChemiDoc after extensive washing.

Fig 4. Blot of the ATP-aptamers on nitrocellulose.
The ATP aptamer successfully detects ATP up to 10 µmol.L-1. This sensibility is good enough to detect circulating ATP in blood. However, the signal is not detectable with naked eyes or with a cell phone equipped with a blue and green filters (data not shown).

Conclusion: This revelation system works, but the signal is too weak to satisfy our selt-test specifications.

The latex-beads revelation system

Principle

The latex bead is taken in sandwich between two aptamers: the first one is fixed on a big, dark and visible latex beads.The second one is fixed on the support.

Fig 5. The biomarker, or target, is taken in sandwich between two aptamers.
Fig 6. The biomarker, or target, is taken in sandwich between two aptamers.

Fixation of the aptamer on the beads: Proof

This detection system was implemented on streptavidin coated plates. The beads fixation to the streptavidin-coated well bottom results in darkening the well. This phenomenon can be quantified by OD600 measurement.

Fig 7 : Thrombin specifically forms complex with the latex beads coated with aptamers.
In absence of DNA, the beads do not stick (bar 1 in black). Beads with complementary strands aptamers allow a good fixation, and constitute our positive control (bar 2 in red). The full detection system in absence of thrombin, our negative control, does not allow fixation of the beads (bar 3 in grey). Decreasing amount of thrombin allows to determine the sensibility of the test, i.e. 100 nmol/L in these conditions (yellow bars).

Conclusion: We have proved that beads coated with aptamers are able to recognize their target in a sandwich assay. A fixation of the beads on the support occurs. This detection system works.

Full system, proof on paper under construction…

We prepared the nitrocellulose strips, functionalized with the aptamers. This experiment was done very late in the project (October 10th, 2016). Unfortunately the latex beads could not migrate easily enough on the nitrocellulose tested. We concluded that larger pore size were required. Although we ordered a more appropriate support, it did not arrive in time to complete our experiments… So close to our goal !

Conclusion: We have proven that beads coated with aptamers are able to recognize their target in a sandwich assay. A fixation of the beads on the support occurs. This detection system works.

Anchoring the system on a paper

Part 1 Streptavidin-CBDs purification on cellulose

Two modified proteins to bind cellulose were used. A streptavidin-CBD (cellulose-binding domain) from the 2014 iGEM Stanford-Brown-Spelman team (BBa_K1934020) and a streptavidin-CiPA (a different kind of cellulose binding domain) produced thanks to our BBa_K1934010 part. To visually follow the process, a RFP-CBD generator was build (BBa_1934000).

Crude cell lysates were loaded on a cellulose column for affinity purification. Unbound proteins were washed with water before elution of purified streptavidin-CBDs proteins. Proteins with Cellulose Binding Domains (CBDs) stick to the cellulose until elution. Streptavidin-CipA sticks better than Stanford’s existing part (compare green and blue curves). See figure 8 below.

Fig.8 CBDs confer ability to bind cellulose: demonstration on chromatography affinity column.
The protein purification process was followed by measuring OD280 of the collected fractions. Fraction 8 containing the majority of purified proteins was collected for further testing. The control was made with NM522 crude lysate.

Part 2 Streptavidin-CBDs both links cellulose and functionalized aptamer

The affinity to cellulose of streptavidin-CBDs encoded by BBa_K1934020 and streptavidin-CiPA BBa_K1934030 were compared to the one of commercial streptavidin. A molecule of fluorescein was grafted at the 5’ end of a DNA oligo carrying a molecule of biotin at its 3’ end. This DNA oligo constitutes the reporter system. Such a modified oligo was mixed either with the engineered streptavidin-CBDs or with commercial streptavidin. The resulting mix was incubated with microcrystalline cellulose in presence of PBS for 1 hour. The cellulose was then washed twice with fresh PBS. Complexes cellulose/streptavidin-CBDs/reporter system were harvested by centrifugation and fluorescence was measured. Every experiment was done in triplicate.

Fig.9 Streptavidin-CBDs allows binding fluorescent-biotinylated DNA to cellulose.
Cellulose shows no auto-fluorescence (bar 1). A small fraction of streptavidin can link the cellulose spontaneously (bar 2). Both engineered streptavidin-CBDs allow the formation of complexes with the fluorescent reporter system and cellulose that can be detected by measuring the green fluorescence, as shown in figure 9 (bars 3 and 4).

Conclusion: We were able to create a valid method to fix our functionalized aptamer to paper.

A device for the users!

In parallel to this biology work a casing was created to host our smart paper. The goal was to design something clear and intuitive. We printed this device in 3D and made fluidic tests. After a few attempts we achieved a good bead diffusion on the paper strips inserted inside the device. If you want to know more, you’re invited to see the design page.



Designed by Team iGEM INSA-LYON