Difference between revisions of "Team:Wageningen UR/Notebook/Cas9"

(Created page with "{{Wageningen_UR}} {{Wageningen_UR/header}} <html> <div class="menu-head"> <h4><a href="#intro">Introduction</a></h4> </div> <li class="menu-item"> <a href="#july">July</a> <l...")
 
Line 3: Line 3:
 
<html>
 
<html>
 
<div class="menu-head">
 
<div class="menu-head">
−
<h4><a href="#intro">Introduction</a></h4>
+
<h4><a href="#1">May 15 - May 25</a></h4>
 
</div>
 
</div>
 
<li class="menu-item">
 
<li class="menu-item">
Line 15: Line 15:
 
{{Wageningen_UR/menu}}
 
{{Wageningen_UR/menu}}
 
<html>
 
<html>
−
<section id="intro">
+
 
−
<h1><b>Introduction to Chitinases</b></h1>
+
 
−
<p> Both honeybees and <i>Varroa destructor</i> mites have a chitin exoskeleton. As chitin is one of the most ubiquitous biopolymers found in nature, plenty of organisms possess the ability to degrade it. A well-described example of such an organism is <i>Serratia marcescens</i>, which is considered a model organism for chitinolytic activity<sup><a href="#ch1" id="refch1">1</a></sup>.  Chitinases isolated from <i>Serratia marcescens</i> GEI strain have been shown to have miticidal activity, while honeybee workers appear to be insensitive to them<sup><a href="#ch2" id="refch2">2</a></sup>. Additionally, chitinases are not harmful to humans, so they are a safer alternative to organic acids. Therefore, we made BioBricks out of these chitinases as a back-up strategy. </p>
+
<p>Unless indicated otherwise, all experiments were performed by Belwina</p>
−
</section>
+
 
−
<section id="july">
+
<section id="1">
−
<h1><b>July</b></h1>
+
<h1><b>May 15 - may 25</b></h1>
−
<h2><b>Week 1</b></h2>
+
<p>
−
<p>This week, we received our IDT order; this contained chitinase A and B from <i>Serratia marcescens</i> GEI strain. The chitinases were optimized for BioBrick use, as is described in their respective BioBrick pages: <a href="http://parts.igem.org/Part:BBa_K1913000"><i>chiA</i></a> and <a href="http://parts.igem.org/Part:BBa_K1913001"><i>chiB</i></a>. Initially, I tried to do a PCR to amplify the synthetic genes, but this resulted in a too small product for <i>chiB</i> (Figure 1). The PCR was done with Q5 polymerase and the program from Table 1 was used.
+
<b>General</b>
−
<figure>
+
−
<figcaption>Table 1: PCR program for chitinase amplification with BioBrick-f and BioBrick-r primers and Q5 polymerase.</figcaption>
+
−
<table>
+
−
  <tr>
+
−
      <th>Step</th>
+
−
      <th>Temperature in °C</th>
+
−
      <th>Time</th>
+
−
  </tr>
+
−
  <tr>
+
−
      <td>Predenaturation</td>
+
−
      <td>98</td>
+
−
      <td>30 seconds</td>
+
−
  </tr>
+
−
  <tr>
+
−
      <td>Denaturation</td>
+
−
      <td>98</td>
+
−
      <td>7 seconds</td>
+
−
  </tr>
+
−
  <tr>
+
−
      <td>Annealing</td>
+
−
      <td>60</td>
+
−
      <td>20 seconds</td>
+
−
  </tr>
+
−
  <tr>
+
−
      <td>Extension</td>
+
−
      <td>72</td>
+
−
      <td>60 seconds</td>
+
−
  </tr>
+
−
  <tr>
+
−
      <td>Final Extension</td>
+
−
      <td>72</td>
+
−
      <td>5 minutes</td>
+
−
    </tr>
+
−
</table>
+
−
</figure></p>
+
−
<p><figure>
+
−
<img src="https://static.igem.org/mediawiki/2016/e/ea/T--Wageningen_UR--chipcr1.jpg">
+
−
<figcaption>Figure 1. Photo of a 1% TAE gel loaded with <i>chiA</i> and <i>chiB</i> PCR products, BBa_J04450 as a positive control and water as a negative control. The expected size for <i>chiA</i> is approximately 1750 basepairs, for <i>chiB</i> approximately 1560 basepairs. The gel was run for 30 minutes at 100V.</figcaption>
+
−
</figure><br/></p>
+
−
<p>This did not work, so I also tried raising the annealing temperature to 70 degrees Celsius, diluting the templates to 1 ng/μL. That failed as well, so a gradient PCR was performed with OneTaq and 2% DMSO(see Figure 2). </p>
+
−
<figure>
+
−
<figcaption>Table 2: PCR program for chitinase gradient PCR with BioBrick-f and BioBrick-r primers and OneTaq polymerase.</figcaption>
+
−
<table>
+
−
  <tr>
+
−
      <th>Step</th>
+
−
      <th>Temperature in °C</th>
+
−
      <th>Time</th>
+
−
  </tr>
+
−
  <tr>
+
−
      <td>Predenaturation</td>
+
−
      <td>94</td>
+
−
      <td>30 seconds</td>
+
−
  </tr>
+
−
  <tr>
+
−
      <td>Denaturation</td>
+
−
      <td>94</td>
+
−
      <td>30 seconds</td>
+
−
  </tr>
+
−
  <tr>
+
−
      <td>Annealing</td>
+
−
      <td>Gradient of 60+-5</td>
+
−
      <td>60 seconds</td>
+
−
  </tr>
+
−
  <tr>
+
−
      <td>Extension</td>
+
−
      <td>68</td>
+
−
      <td>120 seconds</td>
+
−
  </tr>
+
−
  <tr>
+
−
      <td>Final Extension</td>
+
−
      <td>68</td>
+
−
      <td>5 minutes</td>
+
−
    </tr>
+
−
</table>
+
−
<figcaption>Table 2: PCR program for chitinase gradient PCR with BioBrick-f and BioBrick-r primers and OneTaq polymerase.</figcaption></figure></p>
+
−
<p><figure>
+
−
<img src="https://static.igem.org/mediawiki/2016/e/ee/T--Wageningen_UR--chiagrad.jpg" width="800">
+
−
<figcaption>Figure 2. Photo of a 1% TAE gel loaded with <i>chiA</i> gradient PCR products, BBa_I0500 as a positive control and water as a negative control. The expected size for <i>chiA</i> is approximately 1750 basepairs. The gel was run for 30 minutes at 100V.</figcaption>
+
−
</figure><br/></p>
+
−
<p><figure>
+
−
<img src="https://static.igem.org/mediawiki/2016/6/68/T--Wageningen_UR--chibgrad.jpg" width="800">
+
−
<figcaption>Figure 3. Photo of a 1% TAE gel loaded with <i>chiB</i> gradient PCR products, BBa_I0500 as a positive control and water as a negative control. The expected size for <i>chiB</i> is approximately 1560 basepairs. The gel was run for 30 minutes at 100V.</figcaption>
+
−
</figure><br/></p>
+
−
<p>As Q5 PCR seemed to fail, both chitinases were digested with EcoRI and PstI and cloned into pSB1C3 with heat shock transformation. Both the PCR products were used as well as the synthetic genes as supplied by IDT. The transformation worked well. Colony PCR to confirm insert size failed, so a miniprep was done for 5 colonies from each transformation. These were analysed with a OneTaq PCR with VF2 and VR primers. The same program was used as in Table 2, except the annealing temperature was 51 degrees Celsius and the extension time was 210 seconds. </p>
+
−
<p><figure>
+
−
<img src="https://static.igem.org/mediawiki/2016/9/91/T--Wageningen_UR--week1chicolony.jpg" width="800"><figcaption>Figure 4. Photo of a 1% TAE gel loaded with <i>chiA</i> and <i>chiB</i> PCR products, BBa_J04450 as a positive control and water as a negative control. The expected size for <i>chiA</i> is 2007 basepairs, for <i>chiB</i> 1816 basepairs. The gel was run for 30 minutes at 100V.</figcaption>
+
−
</figure><br/></p>
+
−
<p>I picked the first colonies for both transformants which had been transformed with digested IDT oligo's. They were verified through sequencing. I also worked with the fifth chiB colony for some time, which turned out to have a 500 bp deletion.</>
+
−
<h2><b>Week 2</b></h2>
+
−
<p>I tried to add RBS BBa_B0032 to the chitinases with reverse primer VR in combination with the following forward primers and Q5 polymerase:
+
 
<br>
 
<br>
−
chiA: 5' CCGATGAATTCGCGGCCGCTTCTAGtcacacaggaaagtaCTAGATGCGCAAGTTCAATAAACC
+
Heat-shock competent cells were made according to the Openwetware protocol (hyperlink). When I tested them by transforming with PUC19, efficiency was very low.
 
<br>
 
<br>
−
chiB: 5'CCGgTGAATTCGCGGCCGCTTCTagAtcacacaggaaagtaCTAGATGTCCACACGTAAAGCCGTTATTG
 
 
<br>
 
<br>
−
An annealing temperature of 62 degrees Celsius was used. The PCR failed, only the positive control showed bands. </p>
+
<b>Moving iGEM Cas9 to another backbone</b>
−
<p>To figure out why the PCR was not working, I did another gradient PCR with OneTaq polymerase. The same program as in Table 2 was used, except the extension time was set to 4 minutes and the annealing temperate was 47 +- 5 degrees Celsius. Figure 5 also shows the wrong size of <i>chiB</i>, but at this point I did not quite realize it.</p>
+
<br>
−
<p><figure>
+
Belwina, Marijn and Thomas transformed biobrick parts and backbones from the registry to home-made chemically competent DH5alpha cells. Transformations were plated on LB agar plates with antibiotics corresponding to the resistance in the backbone of each plasmid.
−
<img src="https://static.igem.org/mediawiki/2016/5/52/T--Wageningen_UR--week2grad.jpg" width="800">
+
<br>
−
<figcaption>Figure 5. Photo of a 1% TAE gel loaded with <i>chiA</i> and <i>chiB</i> PCR products, BBa_J04450 as a positive control and water as a negative control. The expected size for <i>chiA</i> is 1913 basepairs, for <i>chiB</i> 1722 basepairs. The gel was run for 30 minutes at 100V.</figcaption>
+
<br>
−
</figure><br/></p>
+
Transformed parts:</p>
−
<p>Though the OneTaq gradient PCR clearly worked, I had to make a PCR work with a polymerase that has proofreading activity. I did one PCR with Pfu polymerase, but that failed as even my positive control showed no band.  
+
 
−
I repeated the Q5 PCR to add BBa_B0032 one more time, but now with an annealing temperature at 52 degrees Celsius, 10 degrees below the NEB recommended temperature. The results are shown in Figure 6. </p>
+
(figure)
−
<p><figure>
+
 
−
<img src="https://static.igem.org/mediawiki/2016/d/d2/T--Wageningen_UR--week2q5.jpg" width="800">
+
<p>
−
<figcaption>Figure 5. Photo of a 1% TAE gel loaded with <i>chiA</i> and <i>chiB</i> PCR products, BBa_J04450 as a positive control and water as a negative control. The expected size for <i>chiA</i> is 1913 basepairs, for <i>chiB</i> 1722 basepairs. The gel was run for 30 minutes at 100V.</figcaption>
+
<br>
−
</figure><br/></p>
+
The plasmids were isolated (Machery-Nagel nucleospin kit) from liquid cultures inoculated from colonies of transformation plates. Also, glycerol stocks were made.  
−
<h2><b>Week 3</b></h2>
+
The length of the dCas9 part (5080 bp) was verified using PCR with the VF2 and VR primer.  
−
<p>This week, the PCR products with added RBS were cloned into pSB1C3 with BBa_B0015. Miniprepped plasmids digested with XbaI and PstI were checked for the correct lengths (Figure 6). While <i>chiA</i> had the correct length, it was not digested correctly; I figured out that my RBS primers were wrong and did not include the AG nucleotides for the XbaI site in the prefix. Additionally, I realized that <i>chiA</i> was too short. The plasmids were sequenced and my suspicions were confirmed.</p>
+
</p>
−
<p><figure>
+
 
−
<img src="https://static.igem.org/mediawiki/2016/a/ac/T--Wageningen_UR--week3mp.jpg" width="800">
+
(picture)
−
<figcaption>Figure 6. Photo of a 1% TAE gel loaded with digested plasmids containing <i>chiA</i> and <i>chiB</i> with RBS and terminator. The gel was run for 30 minutes at 100V.</figcaption>
+
 
−
</figure><br/></p>
+
<p><br>
−
<h2><b>Week 4</b></h2>
+
<b>Moving dCas9 to pET26B</b>
−
<p>Worked on isolates from <i>Varroa destructor</i>.</p>
+
<br>
 +
E. coli glycerol stocks containing pdCas9 (Addgene plasmid # 46569) and pET26B were streaked on LB plates with the appropriate antibiotic, liquid cultures were inoculated and the plasmids were isolated (Machery-Nagel nucleospin kit).
 +
<br>
 +
<br>
 +
Q5 PCR was performed on these plasmids, to make fragments with cleaving sides for PacI and SpeI:<br>
 +
pdCas9:<br>
 +
Fwd primer: Bel-cas9 Cas9 fwd (acacacTTAATTAATGACAGCTTATCATCGATAAGCT)<br>
 +
Rev primer: Bel-cas9 Cas9 rev (acacacACTAGTTCAGTCACCTCCTAGCTGAC)<br>
 +
Annealing T: 60ºC, elongation time 1.5 minutes.<br>  
 +
Expected band size: 5340 bp
 +
<br>
 +
<br>
 +
pET26B:<br>
 +
Fwd primer: Bel-cas9 pET fwd (acacacactagtgcgcaacgcaattaatgtaag)<br>
 +
Rev primer: Bel-cas9 pET rev (acacacttaattaaatggatatcggaattaattcggatc)<br>
 +
Annealing T: 60ºC, elongation time 1.5 minutes. <br>
 +
Expected band size: 3737 bp<br>
 +
<br>
 +
<br>
 +
Fragments were checked on 1% agarose TAE gels, 100V, 30 minutes. The PCR for pET26B worked, whereas the one for pdCas9 did not. </p>
 +
 
 +
(figure)
 +
 
 +
<p>
 +
<br>
 +
<b>Collection and construction of pEVOL plasmids</b><br>
 +
The following plasmids were received from Peter Schultz:<br>
 +
pEVOL-pAzF (Addgene plasmid # 31186)<br>
 +
pEVOL-pBpF (Addgene plasmid # 31190)<br>
 +
As well as the recoded strain C321dA-exp, from George Church (Bacterial strain #49018)
 +
All were delivered as agar stabs, that were streaked on LB plates with the appropriate antibiotic.
 
</section>
 
</section>
−
<section id="august">
 
−
<h1><b>August</b></h1>
 
−
<h2><b>Week 5</b></h2>
 
−
<p>I got a new primer and used this with reverse primer VR to correct the RBS. <br>
 
−
5' atctaGAATTCGCGGCCGCTTCTAGAGtcacacaggaaagtaCTAG <br>
 
−
Figure 7 shows the results of the Q5 PCR with this primer set. The PCR was done according to Table 1, but with an annealing temperature of 52 degrees Celsius and an extension time of 90 seconds. It went wrong once; afterwards, I repeated it with and without DMSO and incubated the PCR mix without polymerase but with template and primers at 10 minutes for 42 degrees Celsius.</p>
 
−
<p><figure>
 
−
<img src="https://static.igem.org/mediawiki/2016/9/9a/T--Wageningen_UR--week5rbs.jpg" width="800">
 
−
<figcaption>Figure 7. Photo of a 1% TAE gel loaded with PCR products containing <i>chiA</i> and <i>chiB</i> with old RBS. The <i>chiB</i> with old RBS was necessary to correct for the 500 basepair deletion, while <i>chiA</i> was included as a positive control. For <i>chiA</i>, the 3A assembly with terminator was also used as a template to test the new primer. The gel was run for 30 minutes at 100V.</figcaption>
 
−
</figure><br/></p>
 
−
<p>I needed one extra PCR to correct the <i>chiB</i> RBS; this worked, but not for <i>chiA</i> with only the coding sequence. Therefore, I purified <i>chiA</i> with terminator as this had the fixed RBS. The chitinases were ligated into pSB1K3 and transformed.</p>
 
−
<h2><b>Week 6</b></h2>
 
−
<p>Did 3A assembly of the chitinases; <i>chiB</i> + BBa_B0032 was ligated to BBa_I0500, <i>chiA</i> + BBa_B0032 + BBa_B0015 to BBa_I0500.</p>
 
−
<h2><b>Week 7</b></h2>
 
−
<p>Week 6 transformants were miniprepped, sequenced and another 3A assembly was done: <i>chiB</i> with RBS and promoter was ligated to <i>chiA</i> with terminator and to terminator only (BBa_B0015). They were cloned into pSB4K5. I also tried to clone them into pSB1C3 right away, but the vector had not been linearized correctly. The transformants were checked with colony PCR, but that was not too conclusive; minipreps were digested with EcoRI and PstI and loaded on gel to confirm size (Figure 8).
 
−
<p><figure>
 
−
<img src="https://static.igem.org/mediawiki/2016/1/15/T--Wageningen_UR--week7mp.jpg" width="800">
 
−
<figcaption>Figure 8. Photo of a 1% TAE gel loaded with <i>chiA</i> and <i>chiB</i> devices inserted in pSB4K5. The plasmids were digested with EcoRI and PstI. The gel was run for 45 minutes at 100V.</figcaption>
 
−
</figure><br/></p>
 
−
<p>The <i>chiA</i> device should have fragments of 3110 and 3378 basepairs, the <i>chiB</i> device 2917 and 3378 basepairs and the <i>chiBA</i> device should have a 4639 basepair insert. While <i>chiA</i> looks fine, the other ones are the wrong sizes. I picked 16 more colonies for the <i>chiB</i> device; the very last one turned out to be correct. They were verified through sequencing. </p>
 
−
<h2><b>Week 8</b></h2>
 
−
<p> <i>chiA</i> and <i>chiB</i> devices were cloned into <i>E. coli</i> strain BL21 and I repeated the colony PCR for the <i>chiBA</i> device with Q5 polymerase as OneTaq may not be able to amplify such a short insert. The colony PCR showed transformants with the right insert size, so these were miniprepped, verified through sequencing and also cloned into BL21. </p>
 
−
<p>All devices were cloned into pSB1C3 and verified through sequencing. Additionally, they were digested with EcoRI and PstI and ran on gel to verify insert sizes (Figure 9). Only the <i>chiBA</i> device could not be sequenced for unknown reasons; it was miniprepped twice and sent for sequencing, but both times the sequencing failed.</p>
 
−
<p><figure>
 
−
<img src="https://static.igem.org/mediawiki/2016/1/19/T--Wageningen_UR--week8mp.jpg" width="800">
 
−
<figcaption>Figure 9. Photo of a 1% TAE gel loaded with <i>chiA</i> and <i>chiB</i> devices inserted in pSB4K5 or pSB1C3. The plasmids were digested with EcoRI and PstI. The gel was run for 45 minutes at 100V.</figcaption>
 
−
</figure><br/></p>
 
−
</section>
 
−
<section id="september">
 
−
<h1><b>September</b></h1>
 
−
<h2><b>Week 9</b></h2>
 
−
<p>Made an SDS-PAGE gel from extracts BL21 cultures with the chitinase devices, induced with 0%, 0.2% or 1% arabinose. The SDS-PAGE gel is shown in Figure 10. I could not clearly observe the chitinase bands.</p>
 
−
<p><figure>
 
−
<img src="https://static.igem.org/mediawiki/2016/4/4d/T--Wageningen_UR--week9sds.jpg" width="800">
 
−
<figcaption>Figure 10. Photo of a 10% BioRad MiniProtean gel loaded with protein extracts from BL21 constructs with chitinase devices. Device BBa_K1913002 is supposed to express a 81.5 kDa protein, while BBa_K1913003 should express a 76 kDa protein and BBa_K1913004 should express both. They were induced with 0%, 0.2% or 1% arabinose. The gel was run for 38 minutes at 50 mA together with a gel for the cellular debris (not shown).</figcaption>
 
−
</figure><br/></p>
 
−
<h2><b>Week 10-11</b></h2>
 
−
<p>I tried to adapt an <i>in vitro</i> assay to measure chitinase activity. This assay is based on a reaction with 3-methyl-2-benzothiazolinone hydrazine (MBTH) and was developed by Horn et al.<sup><a href="#ch3" id="refch3">3</a></sup> Colloidal chitin was prepared according to Murthy et al.<sup><a href="#ch4" id="refch4">4</a></sup> The MBTH method yielded no results, as even the calibration curve with N-acetylglucosamine showed no increase in absorbance at 620 nm. The experiment was repeated twice but no conclusion on chitinase activity was reached. </p>
 
−
<h2><b>Week 12</b></h2>
 
−
<p>I made colloidal chitin plates according to Murthy et al.<sup><a href="#ch3" id="refch3">3</a></sup> and pipetted BL21 cultures with the chitinase devices onto them, as well as <i>Bacillus thuringiensis</i> positive controls. The colloidal chitin density was not high enough and the chitin formed flakes. No halo could be observed that would confirm chitinase activity. </p>
 
−
<p><figure>
 
−
<img src="https://static.igem.org/mediawiki/2016/4/4d/T--Wageningen_UR--week9sds.jpg" width="800">
 
−
<figcaption>Figure 11. Photo of a colloidal chitin plate with cultures from BL21 with a <i>chiB</i> device induced with 0%, 0.2% or 1% arabinose. No halo could be observed.</figcaption>
 
−
</figure><br/></p>
 
−
</september>
 
−
<h1><b>References</b></h1>
 
−
<ol class="references">  
 
−
<a id="ch1" href=http://onlinelibrary.wiley.com/doi/10.1111/febs.12181/full>1.</a> Vaaje‐Kolstad, G., Horn, S. J., Sørlie, M., & Eijsink, V. G. (2013). The chitinolytic machinery of Serratia marcescens–a model system for enzymatic degradation of recalcitrant polysaccharides. FEBS Journal, 280(13), 3028-3049.
 
−
<a href="#refch1" title="Jump back to footnote 1 in the text.">↩</a>
 
−
<br><br>
 
−
<a id="ch2" href=http://www.sciencedirect.com/science/article/pii/S0022201110000522>2.</a> Tu, S., Qiu, X., Cao, L., Han, R., Zhang, Y., & Liu, X. (2010). Expression and characterization of the chitinases from Serratia marcescens GEI strain for the control of Varroa destructor, a honey bee parasite. Journal of invertebrate pathology, 104(2), 75-82.
 
−
<a href="#refch2" title="Jump back to footnote 2 in the text.">↩</a>
 
−
<br><br>
 
−
<a id="ch3" href=http://www.sciencedirect.com/science/article/pii/S0144861703003291>3.</a> Horn, S. J., & Eijsink, V. G. (2004). A reliable reducing end assay for chito-oligosaccharides. Carbohydrate Polymers, 56(1), 35-39.
 
−
<a href="#refch3" title="Jump back to footnote 3 in the text.">↩</a>
 
−
<br><br>
 
−
<a id="ch4" href=http://ispub.com/IJMB/10/2/14186>4.</a> Murthy, N. K. S., & Bleakley, B. H. (2012). Simplified method of preparing colloidal chitin used for screening of chitinase producing microorganisms. Internet J Microbiol, 10(2), e2bc3.
 
−
<a href="#refch4" title="Jump back to footnote 4 in the text.">↩</a>
 
−
<br><br>
 
−
</ol>
 
−
</html>
 
−
{{Wageningen_UR/footer}}
 

Revision as of 22:48, 11 October 2016

MENU ▤
Wageningen UR iGEM 2016

 

Unless indicated otherwise, all experiments were performed by Belwina

May 15 - may 25

General
Heat-shock competent cells were made according to the Openwetware protocol (hyperlink). When I tested them by transforming with PUC19, efficiency was very low.

Moving iGEM Cas9 to another backbone
Belwina, Marijn and Thomas transformed biobrick parts and backbones from the registry to home-made chemically competent DH5alpha cells. Transformations were plated on LB agar plates with antibiotics corresponding to the resistance in the backbone of each plasmid.

Transformed parts:

(figure)


The plasmids were isolated (Machery-Nagel nucleospin kit) from liquid cultures inoculated from colonies of transformation plates. Also, glycerol stocks were made. The length of the dCas9 part (5080 bp) was verified using PCR with the VF2 and VR primer.

(picture)


Moving dCas9 to pET26B
E. coli glycerol stocks containing pdCas9 (Addgene plasmid # 46569) and pET26B were streaked on LB plates with the appropriate antibiotic, liquid cultures were inoculated and the plasmids were isolated (Machery-Nagel nucleospin kit).

Q5 PCR was performed on these plasmids, to make fragments with cleaving sides for PacI and SpeI:
pdCas9:
Fwd primer: Bel-cas9 Cas9 fwd (acacacTTAATTAATGACAGCTTATCATCGATAAGCT)
Rev primer: Bel-cas9 Cas9 rev (acacacACTAGTTCAGTCACCTCCTAGCTGAC)
Annealing T: 60ºC, elongation time 1.5 minutes.
Expected band size: 5340 bp

pET26B:
Fwd primer: Bel-cas9 pET fwd (acacacactagtgcgcaacgcaattaatgtaag)
Rev primer: Bel-cas9 pET rev (acacacttaattaaatggatatcggaattaattcggatc)
Annealing T: 60ºC, elongation time 1.5 minutes.
Expected band size: 3737 bp


Fragments were checked on 1% agarose TAE gels, 100V, 30 minutes. The PCR for pET26B worked, whereas the one for pdCas9 did not.

(figure)


Collection and construction of pEVOL plasmids
The following plasmids were received from Peter Schultz:
pEVOL-pAzF (Addgene plasmid # 31186)
pEVOL-pBpF (Addgene plasmid # 31190)
As well as the recoded strain C321dA-exp, from George Church (Bacterial strain #49018) All were delivered as agar stabs, that were streaked on LB plates with the appropriate antibiotic.