Difference between revisions of "Team:Wageningen UR/Notebook/InVitroAssay"
| Line 59: | Line 59: | ||
<p>More BBMVs out of <i>varroa</i> mites were made. These were analyzed with DLS. A glycerol stock of <i>E. coli</i>DH5alpha with the Cry Gene was made. The plasmid was miniprepped. More solution buffer was made. Negative controls for fluorophore leaking experiments were made. Experiments with Cry3Aa (obtained by dissolving the protein extract under alkaline conditions) were performed and showed positive results. However, graphs start looking weird after a certain time. Bacteria from Delft were inoculated. Later from these bacteria, samples were prepared for fluorescence measurement and this measurement was performed.</p> | <p>More BBMVs out of <i>varroa</i> mites were made. These were analyzed with DLS. A glycerol stock of <i>E. coli</i>DH5alpha with the Cry Gene was made. The plasmid was miniprepped. More solution buffer was made. Negative controls for fluorophore leaking experiments were made. Experiments with Cry3Aa (obtained by dissolving the protein extract under alkaline conditions) were performed and showed positive results. However, graphs start looking weird after a certain time. Bacteria from Delft were inoculated. Later from these bacteria, samples were prepared for fluorescence measurement and this measurement was performed.</p> | ||
<h3><b>Week 12. (19/09-25/09)<b></h3> | <h3><b>Week 12. (19/09-25/09)<b></h3> | ||
| + | <p>Sequencing of pSB1A3_Cry3Aa_TEV_HIS was performed with VR, VF2, and CRY-F primer. Leaking experiment from last week was repeated, however, mixing the samples this time better beforehand. This resulted in better graphs. Results were still positive. More LB medium was made. <i>E.coli</i> DH5aplha with pSB1A3_Cry3Aa_TEV_HIS was induced with arabinose and proteins were extracted. The protein extraction was run on a gel, but the negative controls were forgotten. Therefore, no conclusions could be made. The Cry3Aa protein was concentrated with the help of an amplicon. However, the concentration increases are doubtful. Leaking experiments with this protein sample did not give better results than obtained earlier. pSB1A3_Cry3Aa_TEV_HIS was sent for sequencing with the primers:<br> | ||
| + | 5’_gtctacactttatgtgtc_3’<br> | ||
| + | 5’_tcggcaaacaaattctcgt_3’ | ||
| + | </p> | ||
<h3><b>Week 13. (26/09-02/10)<b></h3> | <h3><b>Week 13. (26/09-02/10)<b></h3> | ||
</section> | </section> | ||
Revision as of 11:31, 15 October 2016
Notebook In Vitro Assay
July
Week 1. (04/07-10/07)
An experimental plan was written. Lb medium, LB Agar medium, SOC medium, ampicillin stocks, plate stocks were prepared.
Week 2. (11/07-17/07)
A Q5-PCR on pSB1A3 was performed with the prefix reverse and suffix forward primers to obtain linearized plasmid. The expected size of linearized pSB1A3 is 2155 kB. The DNA was cleaned-up afterwards. Solution Buffer, Homogenization Buffer, Dissection Buffer, 24 mM MgCl2 and DTT stocks were prepared. Mealworms were dissected. The first BBMVs from the midgut of mealworms were made. TEM pictures of the first samples were made. From this could be concluded that all fat on the outside of the mealworm gut should be removed before making BBMVs.
Week 3. (18/07-24/07)
More mealworms were dissected. 12 different samples of BBMVs with variations in the protocols were made. An emission spectra, excitation spectra, and calibration curve of fluorescein were made. Varroa mites were dissected. Obtaining the guts of varroa mites did fail, because the varroa mites were too small. 12 mites were stored at -80⁰C until further use. DLS measurements were performed on the 12 BBMVs samples from T. molitor.
Week 4. (25/07-31/07)
B. thuringiensis genomic DNA was isolated and a Q5 colony PCR on B. thuringiensis was performed to get the Cry3Aa gene (with RBS, HIS-tag, TEV sequence to remove the HIS-tag, right restriction sites, and overhangs) with the following primers:
5’_CGGGGCCCGCGGCCGCTCTAGAGAAAGATAGGAGACACTAGATGATAAGAAAGGGAGGAAGA_3’ 5’_CGGGCCACTAGTTTATTAGTGATGATGGTGGTGATGGTGATGCCCCTGGAAGTACAAGTTCTCATTCACTGGAATAAATTCAAT_3’
Restriction digestion was performed with the linearized pSB1A3 plasmid, the Cry gene and the promoter BBa-I0500. The first time wrong restriction enzymes were used. Repeated with right restriction enzymes. Ligation and transformation in E. coli DH5a. Only three recombinants were created, while the positive control had 52 colonies. Colony PCR on the recombinants was done and shows only empty pSB1A3 without insert is present.
August
Week 5. (01/08-07/08)
Measurement buffer was prepared and with this the first CF leakage experiment was performed with tritonX-100. Only two points in time were measured: nothing could be concluded from this. Restriction digestion of pSB1A3 with an insert was performed in order to use this for the pSB1A_Cry3Aa_TEV_HIS construct. An attempt to create this construct was made by ligation and transformation into E.coli DH5alpha. this yielded many colonies. A colony PCR was done with 90 colonies, however none appeared to have the right insert. All plasmids ligated back with the original insert or without any insert at all. More mealworms were dissected. From this BBMVs were made and incorporated with fluorophores. More CF leakage experiments were performed with TritonX-100. This compound did not give a large and always inconsequent change in fluorescence when added to BBMVs. Furthermore, it changed the fluorescence of carboxyfluorescein itself. Chloramphenicol and Ampicillin plates were poured.
Week 6. (08/08-14/08)
E. coli with the plasmid pSB1A3_RFP, kindly provided by Carina, were grown. The plasmid was miniprepped and restriction digested. This failed, because the yield of DNA was too low with the miniprep. Leakage of fluorophore from vesicles was tried with different detergents. Tween-80 and dish soap influenced the fluorescence of CF itself negatively. Buttermilk handsoap had a very small effect on the fluorescence of carboxyfluorescein itself and could induce a fluorophore release.
Week 7. (15/08-21/08)
No lab work was done this week
Week 8. (22/08-28/08)
B. thuringiensis was grown on sporulation salts and incubated with normal BBMVs from T. molitor. Addition of this sample to BBMVs incorporated with fluorophores had no effect. pSB1A3_RFP was miniprepped again, then digested and treated with alkaline phosphatase. All fragments to create pSB1A3_Cry3Aa_TEV-HIS were ligated and transformed. No colonies were present. The cells were probably not competent, since the positive control did not give a single colony. SDS-PAGE with BBMVs from T.molitor was performed and showed the presence of different proteins. Fluorophore leaking of triton X-100 again showed to not work.
September
Week 9. (29/08-04/09)
More mealworms were dissected. BBMVs from both mealworms and varroa mites were made. Vesicles were tested whether they would break in the presence of SDS. They did. An SDS-PAGE of all vesicles and protein extracts from different strains Bacillus, kindly provided by Lisa, was performed. Transformation was performed with new competent cells and ligation mix made a week earlier. This resulted in colonies.
Week 10. (05/09-11/09)
A colony PCR with verification primers was performed on seven colonies. 6 colonies did not have an insert. One colony had two bands: one with the length that correspondents for no insert and one that correspondents for the right insert. The bacteria used for this PCR were streaked out on a plate and again a colony PCR was performed with verification primers on 6 colonies. 4 Colonies had an insert with the right length and 2 contained an empty plasmid. An overnight measurement of vesicles breaking of BMMVs from mealworms and varroa mites was performed in the presence and absence of SDS. Kinetic values were calculated for standard breaking. Addition the protein extracts from different Bacillus strains (including the Cry3Aa strain) did not change the values. Cry3Aa was dissolved under alkaline conditions out of the protein extract. This was analyzed with SDS-PAGE.
Week 11. (12/09-18/09)
More BBMVs out of varroa mites were made. These were analyzed with DLS. A glycerol stock of E. coliDH5alpha with the Cry Gene was made. The plasmid was miniprepped. More solution buffer was made. Negative controls for fluorophore leaking experiments were made. Experiments with Cry3Aa (obtained by dissolving the protein extract under alkaline conditions) were performed and showed positive results. However, graphs start looking weird after a certain time. Bacteria from Delft were inoculated. Later from these bacteria, samples were prepared for fluorescence measurement and this measurement was performed.
Week 12. (19/09-25/09)
Sequencing of pSB1A3_Cry3Aa_TEV_HIS was performed with VR, VF2, and CRY-F primer. Leaking experiment from last week was repeated, however, mixing the samples this time better beforehand. This resulted in better graphs. Results were still positive. More LB medium was made. E.coli DH5aplha with pSB1A3_Cry3Aa_TEV_HIS was induced with arabinose and proteins were extracted. The protein extraction was run on a gel, but the negative controls were forgotten. Therefore, no conclusions could be made. The Cry3Aa protein was concentrated with the help of an amplicon. However, the concentration increases are doubtful. Leaking experiments with this protein sample did not give better results than obtained earlier. pSB1A3_Cry3Aa_TEV_HIS was sent for sequencing with the primers:
5’_gtctacactttatgtgtc_3’
5’_tcggcaaacaaattctcgt_3’
Week 13. (26/09-02/10)
Oktober
Week 14. (03/10-09/10)
Week 15. (10/10-16/10)
