Line 83: | Line 83: | ||
<br><br>The recipes of the buffers used may be seen in the tables below: | <br><br>The recipes of the buffers used may be seen in the tables below: | ||
− | + | <br> | |
− | <br><br>Figure 1 below shows the resulting product of the first extraction (1) and the second extraction using the modified protocol (2). | + | </p> |
+ | |||
+ | <p style="text-align:center;"> | ||
+ | <img style="max-width:40%" src="https://static.igem.org/mediawiki/2016/4/48/T--Pretoria_UP--Results_3.png"> | ||
+ | <img style="max-width:40%" src="https://static.igem.org/mediawiki/2016/e/e5/T--Pretoria_UP--Results_4.png"> | ||
+ | <img style="max-width:40%" src="https://static.igem.org/mediawiki/2016/7/75/T--Pretoria_UP--Results_5.png"> | ||
+ | <img style="max-width:40%" src="https://static.igem.org/mediawiki/2016/e/e5/T--Pretoria_UP--Results_4.png"> | ||
+ | <br> | ||
+ | </p> | ||
+ | |||
+ | <p> | ||
+ | <br>Figure 1 below shows the resulting product of the first extraction (1) and the second extraction using the modified protocol (2). | ||
<br> | <br> | ||
</p> | </p> |
Revision as of 08:24, 19 October 2016
Project Results We divided our synthetic biology work into three sub-projects:
Aptamer design and laccase expression
Design and testing of a DNA aptamer for Photosystem II (PSII)
Sequencing result of cloned SP6 promoter parts. Four of six clones sequenced produced chromatograms agreeing with the reference sequence.
Thylakoid extraction
The thylakoid extraction was carried out on store-bought spinach, using a protocol described below designed to extract and isolate intact chloroplasts from leaves. During the first extraction we extracted extremely pure, intact chloroplasts, in small yield. Because we only required thylakoid membranes, not intact chloroplasts, separation using a Percoll gradient was not necessary. Furthermore, the protocol used small volumes of material and therefore resulted in a small amount of product, the modification of the previous protocol cut down the time taken to carry out the protocol by about half, and increased the resulting product from about 5ml to 14ml of thylakoid solution. To ensure that the thylakoid membranes were exposed, and not contained inside intact chloroplasts, the thylakoid solution was sonicated to disrupt the chloroplast membranes allowing the release of the thylakoids.
Figure 1. Showing the thylakoid solution extracted from spinach leaves. Photograph 1 shows the result of the first extraction, the top green layer contains a mixture of thylakoid membranes and broken chloroplasts, while the bottom layer contains pure intact chloroplasts. Photograph 2 shows the resulting product of the second extraction.
The protocol used was derived from the following articles:
1. Development of a graphene-binding DNA aptamer (using SELEX)
2. Development of a PSII-binding DNA aptamer (based on in silico prediction)
3. Characterisation of novel laccase enzymes that might be used to reduce oxygen and hydrogen back to water on the cathode electrode of our PBEC.Here, we chose a rapid cell-free expression system that makes use of the SP6 phage promoter and does not require a transcriptional terminator.
We decided to use the __ protein of PS II to which the one side of the aptamers can bind. This protein is suitable as it is exposed and on the stromal side of the thylakoid membranes (which is important because electron flow occurs mostly on the stromal side. iGEM team Heidelberg (2015) used their designed MAWS (Making Aptamers Without SELEX) software to design an aptamer sequence which has specifically bind to PS II`s __ protein.
We tested the efficiency of the aptamer binding to graphene.
Development of a graphene-binding DNA aptamer
DNA naturally binds to graphene with pi-pi bonds if the DNA are 20.2A from the graphene.
Synthesis, cloning and expression of Eucalyptus grandis laccases
We searched for Eucalyptus grandis homologs of LAC4 and LAC17, two Arabidopsis thaliana laccase proteins known to reduce phenolic compounds much like the laccases from Trametes versicolor traditionally used in PBECs (Berthet et al. 2011).
Using BLASTP, we identified a number of laccase homologs in the E. grandis genome hosted on Phytozome (phytozome.jgi.doe.gov/pz/portal.html). We used gene expression data from EucGenIE (www.eucgenie.org; Hefer et al. 2011) to prioritise four laccase candidates based on high expression, especially in developing wood where these proteins are required for the polymerisation of monolignol substrates into lignin.
Four Laccase proteins from Eucalyptus grandis were synthesized.
Eucgr.A01282
Eucgr.F02641
Eucgr.B02797
Eucgr.G03098
Two of the laccases were cloned into pSB1C3 and submitted as new parts.
For expression, an SP6 promoter was added for Phage SP6 RNA Polymerase to transcribe and translate the genes in vitro by making use of an SP6 in vitro expression kit (Promega TNT SP6 Coupled Wheat Germ Extract System). The advantage of this is that expression is fast, easy and does not require a T7 transcription termination sequence.
Development of SP6 promoter as standard part
Two self-annealing oligos were synthesized to form a double-stranded SP6 promoter flanked by the RFC10 prefix and suffix sequences.
Oligo 1: 5’ CGCGAATTCGCGGCCGCTTCTAGAGATTTAGGTGACAC 3’
Oligo 2: 5’ CGCCTGCAGCGGCCGCTACTAGTACTATAGTGTCACCTAAA 3’
These oligos were allowed to annual at room temperature and then extended with Bsu DNA polymerase, large fragment (NEB) at 37C for 30 min. The resulting fragment was digested with EcoRI and PstI, cloned into pSB1C3, sequenced and submitted as part BBa_K2037000.
To test the functionality of this promoter as a standard part with RFC10 prefix and suffix sequence, we appended it to the mRFP fragment (BBa_J04450) for in vitro expression
The first protocol used involved grinding frozen tissue (in this case spinach) in a homogenizer until it was a fine powder, and transferred to falcon tubes (2-5g per tube). A volume of 30ml of a “homogenization buffer” was then added to each tube, each tube was then vortexed for 30 seconds. The suspension was filtered through two layers of 100 µm, followed by two layers of 60 µm meshes. The filtrate collected was centrifuged at 200xg for 4 minutes at 4°C, and the supernatant transferred to a new falcon tube. The supernatant was then centrifuged for 10 minutes at 1500xg at 4°C, the resulting pellet contained the chloroplasts. The pellet was gently resuspended in 3ml of “resuspension buffer”. Next the plastid suspension was slowly layered onto a discontinuous Percoll density gradient solution, containing equal volumes (9ml) of 85%, 40% and 10% Percoll solutions. The Percoll density gradient solution was then centrifuged at 5000xg for 45min at 4°C, after this centrifugation, intact chloroplasts were located on the interface of the 40/85 Percoll and the 10/40 interface contained broken chloroplasts and thylakoid membranes. Both fractions were collected gently with a 1ml pipette, and transferred to separate falcon tubes, to which, 3 volumes of “wash buffer” was added and then gently washed by centrifugation at 1500xg for 10 min at 4°C. The supernatant was discarded carefully and the wash step was repeated. The pellet was then resuspended in washy buffer and 50% glycerol solution for storage.
In the modified protocol, similar steps were followed, the only changes being the following:
- A larger amount of material (5-10g) was used
- Separation via the percoll density gradient was not carried out (separation was not necessary)
- The pellet containing the chloroplasts and thylakoids was resuspended in the “wash buffer”, washed, and then sonicated, as to disrupt the chloroplast membrane and therefore increase the amount of free thylakoids in the solution.
The recipes of the buffers used may be seen in the tables below:
Figure 1 below shows the resulting product of the first extraction (1) and the second extraction using the modified protocol (2).
Shiraya, T., Kaneko, K., Mitsui, T. (2014). "Quantitative Proteomic Analysis of Intact Plastids." Plant Proteomics: Methods and Protocols 469-480.
Rödiger, A., Baudisch, B., Klösgen, R.B. (2010). "Simultaneous isolation of intact mitochondria and chloroplasts from a single pulping of plant tissue." Journal of plant physiology 167: 620-624.Lang, E.G., Mueller, S.J., Hoernstein, S.N., Porankiewicz-Asplund, J., Vervliet-Scheebaum, M., Reski, R. (2011). "Simultaneous isolation of pure and intact chloroplasts and mitochondria from moss as the basis for sub-cellular proteomics." Plant cell reports 30: 205-215.
Lang, E.G., Mueller, S.J., Hoernstein, S.N., Porankiewicz-Asplund, J., Vervliet-Scheebaum, M., Reski, R. (2011). "Simultaneous isolation of pure and intact chloroplasts and mitochondria from moss as the basis for sub-cellular proteomics." Plant cell reports 30: 205-215.
Nagahashi, G., 1985. The marker concept in cell fractionation, In: Cell Components. Springer, pp. 66-84.