Difference between revisions of "Team:Pretoria UP/Results"

Line 39: Line 39:
 
 
 
<br><br><b>Synthesis, cloning and expression of Eucalyptus grandis laccases</b>
 
<br><br><b>Synthesis, cloning and expression of Eucalyptus grandis laccases</b>
<br>We searched for Eucalyptus grandis homologs of LAC4 and LAC17, two Arabidopsis thaliana laccase proteins known to reduce phenolic compounds much like the laccases from Trametes versicolor traditionally used in PBECs (Berthet et al. 2011).
+
<br>We searched for Eucalyptus grandis homologs of LAC4 and LAC17, two <i>Arabidopsis thaliana</i> laccase proteins known to reduce phenolic compounds much like the laccases from Trametes versicolor traditionally used in PBECs (Berthet et al. 2011).
<br><br>Using BLASTP, we identified a number of laccase homologs in the E. grandis genome hosted on Phytozome (phytozome.jgi.doe.gov/pz/portal.html). We used gene expression data from EucGenIE (www.eucgenie.org; Hefer et al. 2011) to prioritise four laccase candidates based on high expression, especially in developing wood where these proteins are required for the polymerisation of monolignol substrates into lignin.
+
<br><br>Using BLASTP, we identified a number of laccase homologs in the <i>E. grandis</i> genome hosted on Phytozome (phytozome.jgi.doe.gov/pz/portal.html). We used gene expression data from EucGenIE (www.eucgenie.org; Hefer et al. 2011) to prioritise four laccase candidates based on high expression, especially in developing wood where these proteins are required for the polymerisation of monolignol substrates into lignin.
<br><br>Four Laccase proteins from Eucalyptus grandis were synthesized.  
+
<br><br>Four Laccase proteins from <i>Eucalyptus grandis</i> were synthesized.  
 
<br><br>Eucgr.A01282<br>Eucgr.F02641<br>Eucgr.B02797<br>Eucgr.G03098
 
<br><br>Eucgr.A01282<br>Eucgr.F02641<br>Eucgr.B02797<br>Eucgr.G03098
 
<br><br>Two of the laccases were cloned into pSB1C3 and submitted as new parts.
 
<br><br>Two of the laccases were cloned into pSB1C3 and submitted as new parts.
Line 91: Line 91:
 
<img style="max-width:40%" src="https://static.igem.org/mediawiki/2016/e/e5/T--Pretoria_UP--Results_4.png">
 
<img style="max-width:40%" src="https://static.igem.org/mediawiki/2016/e/e5/T--Pretoria_UP--Results_4.png">
 
<img style="max-width:40%" src="https://static.igem.org/mediawiki/2016/7/75/T--Pretoria_UP--Results_5.png">
 
<img style="max-width:40%" src="https://static.igem.org/mediawiki/2016/7/75/T--Pretoria_UP--Results_5.png">
<img style="max-width:40%" src="https://static.igem.org/mediawiki/2016/e/e5/T--Pretoria_UP--Results_4.png">
+
<br>
<br>
+
 
</p>
 
</p>
 
 
Line 100: Line 99:
 
<img height="500px" src="https://static.igem.org/mediawiki/2016/c/c5/T--Pretoria_UP--Results_2.png">
 
<img height="500px" src="https://static.igem.org/mediawiki/2016/c/c5/T--Pretoria_UP--Results_2.png">
 
<p style="font-size:14px !important;text-align: center">Thylakoid extractions from spinach leaves. (Left) Percoll gradient-mediated purification. The top green layer contains a mixture of thylakoid membranes and broken chloroplasts, while the bottom layer contains pure intact chloroplasts. (Right) The resulting product of the simplified extraction.
 
<p style="font-size:14px !important;text-align: center">Thylakoid extractions from spinach leaves. (Left) Percoll gradient-mediated purification. The top green layer contains a mixture of thylakoid membranes and broken chloroplasts, while the bottom layer contains pure intact chloroplasts. (Right) The resulting product of the simplified extraction.
</p>
+
 
<br>
 
<br>
 +
 
<p class = "h2WM">REFERENCES</p>
 
<p class = "h2WM">REFERENCES</p>
 
</div>
 
</div>
Line 107: Line 107:
 
<div class="col-sm-12">
 
<div class="col-sm-12">
 
<p style="text-align:left;">
 
<p style="text-align:left;">
 +
                                                                                </p>
 
<br>Lang, E.G., Mueller, S.J., Hoernstein, S.N., Porankiewicz-Asplund, J., Vervliet-Scheebaum, M., Reski, R. (2011). Simultaneous isolation of pure and intact chloroplasts and mitochondria from moss as the basis for sub-cellular proteomics. <i>Plant cell reports</i> 30: 205-215.
 
<br>Lang, E.G., Mueller, S.J., Hoernstein, S.N., Porankiewicz-Asplund, J., Vervliet-Scheebaum, M., Reski, R. (2011). Simultaneous isolation of pure and intact chloroplasts and mitochondria from moss as the basis for sub-cellular proteomics. <i>Plant cell reports</i> 30: 205-215.
 
<br><br>Nagahashi, G., 1985. The marker concept in cell fractionation, In: <i>Cell Components</i>. Springer, pp. 66-84.
 
<br><br>Nagahashi, G., 1985. The marker concept in cell fractionation, In: <i>Cell Components</i>. Springer, pp. 66-84.

Revision as of 13:22, 19 October 2016

WATTS-APTAMER - PRETORIA_UP iGEM

WATTS-APTAMER - PRETORIA_UP iGEM



Project Results

We divided our synthetic biology work into three sub-projects:

1. Development of a graphene-binding DNA aptamer (using SELEX)

2. Development of a PSII-binding DNA aptamer (based on in silico prediction)

3. Characterisation of novel laccase enzymes that might be used to reduce oxygen and hydrogen back to water on the cathode electrode of our PBEC.Here, we chose a rapid cell-free expression system that makes use of the SP6 phage promoter and does not require a transcriptional terminator.

Aptamer design and laccase expression

Design and testing of a DNA aptamer for Photosystem II (PSII)
We decided to use the CP43 and CP47 subunits of PS II to which the one side of the aptamers can bind. This protein is suitable as it is exposed and on the stromal side of the thylakoid membranes (which is important because electrons can more easily be abstracted on the stromal side). These proteins form the core subunits of the PSII complex and we determined them to be the most stable. We used PDF files from a recent crystal structure of the PSII complex (Wei et al., 2016) as the basis for aptamer design. iGEM team Heidelberg (2015) used their designed MAWS (Making Aptamers Without SELEX) software to design an aptamer sequence which has specifically bind to PS II`s CP43 and CP47 proteins.

We tested the efficiency of the aptamer binding to graphene.

Development of a graphene-binding DNA aptamer
DNA naturally binds to graphene with pi-pi bonds if the DNA are 20.2A from the graphene.

Synthesis, cloning and expression of Eucalyptus grandis laccases
We searched for Eucalyptus grandis homologs of LAC4 and LAC17, two Arabidopsis thaliana laccase proteins known to reduce phenolic compounds much like the laccases from Trametes versicolor traditionally used in PBECs (Berthet et al. 2011).

Using BLASTP, we identified a number of laccase homologs in the E. grandis genome hosted on Phytozome (phytozome.jgi.doe.gov/pz/portal.html). We used gene expression data from EucGenIE (www.eucgenie.org; Hefer et al. 2011) to prioritise four laccase candidates based on high expression, especially in developing wood where these proteins are required for the polymerisation of monolignol substrates into lignin.

Four Laccase proteins from Eucalyptus grandis were synthesized.

Eucgr.A01282
Eucgr.F02641
Eucgr.B02797
Eucgr.G03098

Two of the laccases were cloned into pSB1C3 and submitted as new parts.

For expression, an SP6 promoter was added for Phage SP6 RNA Polymerase to transcribe and translate the genes in vitro by making use of an SP6 in vitro expression kit (Promega TNT SP6 Coupled Wheat Germ Extract System). The advantage of this is that expression is fast, easy and does not require a T7 transcription termination sequence.

Development of SP6 promoter as standard part
Two self-annealing oligos were synthesized to form a double-stranded SP6 promoter flanked by the RFC10 prefix and suffix sequences.
Oligo 1: 5’ CGCGAATTCGCGGCCGCTTCTAGAGATTTAGGTGACAC 3’
Oligo 2: 5’ CGCCTGCAGCGGCCGCTACTAGTACTATAGTGTCACCTAAA 3’

These oligos were allowed to annual at room temperature and then extended with Bsu DNA polymerase, large fragment (NEB) at 37C for 30 min. The resulting fragment was digested with EcoRI and PstI, cloned into pSB1C3, sequenced and submitted as part BBa_K2037000.

To test the functionality of this promoter as a standard part with RFC10 prefix and suffix sequence, we appended it to the mRFP fragment (BBa_J04450) for in vitro expression

Sequencing result of cloned SP6 promoter parts. Four of six clones sequenced produced chromatograms agreeing with the reference sequence.

Thylakoid extraction

The thylakoid extraction was carried out on store-bought spinach, using a protocol designed to extract and isolate intact chloroplasts from leaves, which we derived from Lang et al. (2011), Nagahashi et al. (1985), Rödiger et al. (2010) and Shiraya et al. (2014) as described below . The first protocol used involved grinding frozen tissue with a homogenizer in liquid nitrogen. A volume of 30ml of a “homogenization buffer” was added to 2 - 5 g of tissue, vortexed for 30 seconds and filtered through two layers of 100 µm nylon mesh, followed by two layers of 60 µm mesh. The filtrate was centrifuged at 200 x g for 4 minutes at 4°C, and the supernatant was then centrifuged for 10 minutes at 1500 x g at 4°C. The resulting pellet contained the chloroplasts. The pellet was gently resuspended in 3ml of “resuspension buffer”. Next the plastid suspension was slowly layered onto a discontinuous Percoll density gradient solution, containing equal volumes (9ml) of 85%, 40% and 10% Percoll solutions. The Percoll density gradient solution was then centrifuged at 5000 x g for 45 min at 4°C, after this centrifugation, intact chloroplasts were located on the interface of the 40/85 Percoll and the 10/40 interface contained broken chloroplasts and thylakoid membranes. Both fractions were gently transferred to separate falcon tubes, to which 3 volumes of “wash buffer” was added and then gently washed by centrifugation at 1500 x g for 10 min at 4°C (repeated once). The pellet was then resuspended in wash buffer and 50% glycerol solution for storage.

This method extracted extremely pure, intact chloroplasts, but in small yields. Because we only required thylakoid membranes, not intact chloroplasts, separation using a Percoll gradient was not necessary. Furthermore, the protocol used small volumes of material and therefore resulted in a small amount of product. We therefore simplified and scaled up the protocol for crude thylakoid extractions:

- A larger amount of material (5 - 10 g) was used
- Separation via the percoll density gradient was omitted
- The first crude pellet containing the chloroplasts and thylakoids was resuspended in the “wash buffer” and then sonicated to disrupt the chloroplast membrane and therefore increase the amount of free thylakoids in the solution.

The recipes of the buffers used may be seen in the tables below:


Thylakoid extractions from spinach leaves. (Left) Percoll gradient-mediated purification. The top green layer contains a mixture of thylakoid membranes and broken chloroplasts, while the bottom layer contains pure intact chloroplasts. (Right) The resulting product of the simplified extraction.

REFERENCES


Lang, E.G., Mueller, S.J., Hoernstein, S.N., Porankiewicz-Asplund, J., Vervliet-Scheebaum, M., Reski, R. (2011). Simultaneous isolation of pure and intact chloroplasts and mitochondria from moss as the basis for sub-cellular proteomics. Plant cell reports 30: 205-215.

Nagahashi, G., 1985. The marker concept in cell fractionation, In: Cell Components. Springer, pp. 66-84.

Rödiger, A., Baudisch, B., Klösgen, R.B. (2010). Simultaneous isolation of intact mitochondria and chloroplasts from a single pulping of plant tissue. Journal of plant physiology 167: 620-624.

Shiraya, T., Kaneko, K., Mitsui, T. (2014). Quantitative Proteomic Analysis of Intact Plastids. Plant Proteomics: Methods and Protocols 469-480.

Wei, X., Su, X., Cao, P., Liu, X., Chang, W., Li, M., Zhang, X., Liu, Z. (2016). Structure of spinach photosystem II-LHCII supercomplex at 3.2 Å resolution. Nature 534:69–74.

WATTS-APTAMER - PRETORIA_UP iGEM