Team:Wageningen UR/Notebook/Cas9

MENU ▤
Wageningen UR iGEM 2016

 

Unless indicated otherwise, all experiments were performed by Belwina

May 15 - may 25

General
Heat-shock competent cells were made according to the Openwetware protocol (hyperlink). When I tested them by transforming with PUC19, efficiency was very low.

Moving iGEM Cas9 to another backbone
Belwina, Marijn and Thomas transformed biobrick parts and backbones from the registry to home-made chemically competent DH5alpha cells. Transformations were plated on LB agar plates with antibiotics corresponding to the resistance in the backbone of each plasmid.

Transformed parts:

(figure)


The plasmids were isolated (Machery-Nagel nucleospin kit) from liquid cultures inoculated from colonies of transformation plates. Also, glycerol stocks were made. The length of the dCas9 part (5080 bp) was verified using PCR with the VF2 and VR primer.

(picture)


Moving dCas9 to pET26B
E. coli glycerol stocks containing pdCas9 (Addgene plasmid # 46569) and pET26B were streaked on LB plates with the appropriate antibiotic, liquid cultures were inoculated and the plasmids were isolated (Machery-Nagel nucleospin kit).

Q5 PCR was performed on these plasmids, to make fragments with cleaving sides for PacI and SpeI:
pdCas9:
Fwd primer: Bel-cas9 Cas9 fwd (acacacTTAATTAATGACAGCTTATCATCGATAAGCT)
Rev primer: Bel-cas9 Cas9 rev (acacacACTAGTTCAGTCACCTCCTAGCTGAC)
Annealing T: 60ºC, elongation time 1.5 minutes.
Expected band size: 5340 bp

pET26B:
Fwd primer: Bel-cas9 pET fwd (acacacactagtgcgcaacgcaattaatgtaag)
Rev primer: Bel-cas9 pET rev (acacacttaattaaatggatatcggaattaattcggatc)
Annealing T: 60ºC, elongation time 1.5 minutes.
Expected band size: 3737 bp


Fragments were checked on 1% agarose TAE gels, 100V, 30 minutes. The PCR for pET26B worked, whereas the one for pdCas9 did not.

(figure)


Collection and construction of pEVOL plasmids
The following plasmids were received from Peter Schultz:
pEVOL-pAzF (Addgene plasmid # 31186)
pEVOL-pBpF (Addgene plasmid # 31190)
As well as the recoded strain C321dA-exp, from George Church (Bacterial strain #49018) All were delivered as agar stabs, that were streaked on LB plates with the appropriate antibiotic.