Team:Wageningen UR/Notebook/InVitroAssay
Notebook In Vitro Assay
July
Week 1. (04/07-10/07)
An experimental plan was written. Lb medium, LB Agar medium, SOC medium, ampicillin stocks, plate stocks were prepared.
Week 2. (11/07-17/07)
A Q5-PCR on pSB1A3 was performed with the prefix reverse and suffix forward primers to obtain linearized plasmid. The expected size of linearized pSB1A3 is 2155 kB. The DNA was cleaned-up afterwards. Solution Buffer, Homogenization Buffer, Dissection Buffer, 24 mM MgCl2 and DTT stocks were prepared. Mealworms were dissected. The first BBMVs from the midgut of mealworms were made. TEM pictures of the first samples were made. From this could be concluded that all fat on the outside of the mealworm gut should be removed before making BBMVs.
Week 3. (18/07-24/07)
More mealworms were dissected. 12 different samples of BBMVs with variations in the protocols were made. An emission spectra, excitation spectra, and calibration curve of fluorescein were made. Varroa mites were dissected. Obtaining the guts of varroa mites did fail, because the varroa mites were too small. 12 mites were stored at -80⁰C until further use. DLS measurements were performed on the 12 BBMVs samples from T. molitor.
Week 4. (25/07-31/07)
B. thuringiensis genomic DNA was isolated and a Q5 colony PCR on B. thuringiensis was performed to get the Cry3Aa gene (with RBS, HIS-tag, TEV sequence to remove the HIS-tag, right restriction sites, and overhangs) with the following primers:
5’_CGGGGCCCGCGGCCGCTCTAGAGAAAGATAGGAGACACTAGATGATAAGAAAGGGAGGAAGA_3’ 5’_CGGGCCACTAGTTTATTAGTGATGATGGTGGTGATGGTGATGCCCCTGGAAGTACAAGTTCTCATTCACTGGAATAAATTCAAT_3’
Restriction digestion was performed with the linearized pSB1A3 plasmid, the Cry gene and the promoter BBa-I0500. The first time wrong restriction enzymes were used. Repeated with right restriction enzymes. Ligation and transformation in E. coli DH5a. Only three recombinants were created, while the positive control had 52 colonies. Colony PCR on the recombinants was done and shows only empty pSB1A3 without insert is present.
August
Week 5. (01/08-07/08)
Week 6. (08/08-14/08)
Week 7. (15/08-21/08)
Week 8. (22/08-28/08)
September
Week 9. (29/08-04/09)
Week 10. (05/09-11/09)
Week 11. (12/09-18/09)
Week 12. (19/09-25/09)
Week 13. (26/09-02/10)
Oktober
Week 14. (03/10-09/10)
Week 15. (10/10-16/10)
