Team:Wageningen UR/Notebook/InVitroAssay
Notebook In Vitro Assay
July
Week 1. (04/07-10/07)
An experimental plan was written. Lb medium, LB Agar medium, SOC medium, ampicillin stocks, plate stocks were prepared.
Week 2. (11/07-17/07)
A Q5-PCR on pSB1A3 was performed with the prefix reverse and suffix forward primers to obtain linearized plasmid. The expected size of linearized pSB1A3 is 2155 kB. The DNA was cleaned-up afterwards. Solution Buffer, Homogenization Buffer, Dissection Buffer, 24 mM MgCl2 and DTT stocks were prepared. Mealworms were dissected. The first BBMVs from the midgut of mealworms were made. TEM pictures of the first samples were made. From this could be concluded that all fat on the outside of the mealworm gut should be removed before making BBMVs.
Week 3. (18/07-24/07)
More mealworms were dissected. 12 different samples of BBMVs with variations in the protocols were made. An emission spectra, excitation spectra, and calibration curve of fluorescein were made. Varroa mites were dissected. Obtaining the guts of varroa mites did fail, because the varroa mites were too small. 12 mites were stored at -80⁰C until further use. DLS measurements were performed on the 12 BBMVs samples from T. molitor.
Week 4. (25/07-31/07)
B. thuringiensis genomic DNA was isolated and a Q5 colony PCR on B. thuringiensis was performed to get the Cry3Aa gene (with RBS, HIS-tag, TEV sequence to remove the HIS-tag, right restriction sites, and overhangs) with the following primers:
5’_CGGGGCCCGCGGCCGCTCTAGAGAAAGATAGGAGACACTAGATGATAAGAAAGGGAGGAAGA_3’ 5’_CGGGCCACTAGTTTATTAGTGATGATGGTGGTGATGGTGATGCCCCTGGAAGTACAAGTTCTCATTCACTGGAATAAATTCAAT_3’
Restriction digestion was performed with the linearized pSB1A3 plasmid, the Cry gene and the promoter BBa-I0500. The first time wrong restriction enzymes were used. Repeated with right restriction enzymes. Ligation and transformation in E. coli DH5a. Only three recombinants were created, while the positive control had 52 colonies. Colony PCR on the recombinants was done and shows only empty pSB1A3 without insert is present.
August
Week 5. (01/08-07/08)
Measurement buffer was prepared and with this the first CF leakage experiment was performed with tritonX-100. Only two points in time were measured: nothing could be concluded from this. Restriction digestion of pSB1A3 with an insert was performed in order to use this for the pSB1A_Cry3Aa_TEV_HIS construct. An attempt to create this construct was made by ligation and transformation into E.coli DH5alpha. this yielded many colonies. A colony PCR was done with 90 colonies, however none appeared to have the right insert. All plasmids ligated back with the original insert or without any insert at all. More mealworms were dissected. From this BBMVs were made and incorporated with fluorophores. More CF leakage experiments were performed with TritonX-100. This compound did not give a large and always inconsequent change in fluorescence when added to BBMVs. Furthermore, it changed the fluorescence of carboxyfluorescein itself. Chloramphenicol and Ampicillin plates were poured.
Week 6. (08/08-14/08)
E. coli with the plasmid pSB1A3_RFP were grown. The plasmid was miniprepped and restriction digested. This failed, because the yield of DNA was too low with the miniprep. Leakage of fluorophore from vesicles was tried with different detergents. Tween-80 and dish soap influenced the fluorescence of CF itself negatively. Buttermilk handsoap had a very small effect on the fluorescence of carboxyfluorescein itself and could induce a fluorophore release.
Week 7. (15/08-21/08)
No lab work was done this week
Week 8. (22/08-28/08)
B. thuringiensis was grown on sporulation salts and incubated with normal BBMVs from T. molitor. Addition of this sample to BBMVs incorporated with fluorophores had no effect. pSB1A3_RFP was miniprepped again, then digested and treated with alkaline phosphatase. All fragments to create pSB1A3_Cry3Aa_TEV-HIS were ligated and transformed. No colonies were present. The cells were probably not competent, since the positive control did not give a single colony. SDS-PAGE with BBMVs from T.molitor was performed and showed the presence of different proteins. Fluorophore leaking of triton X-100 again showed to not work.
September
Week 9. (29/08-04/09)
Week 10. (05/09-11/09)
Week 11. (12/09-18/09)
Week 12. (19/09-25/09)
Week 13. (26/09-02/10)
Oktober
Week 14. (03/10-09/10)
Week 15. (10/10-16/10)
