Line 170: | Line 170: | ||
<h2>Contents</h2> | <h2>Contents</h2> | ||
<h5><a href="#Parts">1 Parts</a></h5> | <h5><a href="#Parts">1 Parts</a></h5> | ||
− | <h5><a href="# | + | <h5><a href="#Materials">2 Materials</a></h5> |
− | <h5><a href="# | + | <h5><a href="#Methods">3 Methods</a></h5> |
− | <h5><a href="# | + | <h5><a href="#Primer_list">4 Primer list</a></h5> |
− | <h1 id="# | + | <h1 id="#Materials">Materials</h1> |
<table> | <table> | ||
Line 455: | Line 455: | ||
− | <h1>Methods</h1> | + | <h1 id="#Methods">Methods</h1> |
<h2>Westernblot (Against His tag)</h2> | <h2>Westernblot (Against His tag)</h2> |
Revision as of 14:54, 17 October 2016
![](https://static.igem.org/mediawiki/2016/e/ef/T--Kyoto--pagephoto-02.png)
Contents
1 Parts
2 Materials
3 Methods
4 Primer list
Materials
Kit | Supplier |
---|---|
Wizard® SV Gel and PCR | Promega |
Ligation high Ver.2 | TOYOBO |
FastGene™Plasmid Mini Kit | NIPPON Genetics Co.,Ltd |
Enzyme | Supplier |
---|---|
EcoRI | TaKaRa, Promega |
PstI | TaKaRa, Promega |
SpeI | TaKaRa, Promega |
XbaI | TaKaRa, Promega |
DraII | TaKaRa |
Marker | Supplier |
---|---|
1kb DNA Ladder | TaKaRa |
Organism | Supplier |
---|---|
E.coli DH5α Genotype | TaKaRa |
E.coli JM109 Competent Cells | TaKaRa |
Antibiotics | Supplier |
---|---|
Chloramphericol | nacalai tesque |
Ampicillin Sodium Salt | nacalai tesque |
Equipment | Suppliert |
---|---|
BEMLISE SR601 | AsahiKASEI |
BioPhotometer | eppendorf |
LABO SHAKER | BIO CRAFT |
CO2 INCUBATOR | SANYO |
Pipette Controller | Biohit Midi Plus |
MiniCentrifuge Model GMC-060 | LMS CO.,LTD. |
HIGH-SPEED REFRIGERATED CENTRIFUGE | TOMY |
HIGH-PRESSURE STEAM STERILIZER | TOMY |
VOTEX-GENE2 | Scientific Industryes |
Backbones | Supplier |
---|---|
pSB1C3 | iGEM registry |
pSB1A2 | iGEM registry |
pSB3C5 | iGEM registry |
BBa_ J61002 | iGEM registry |
Buffer | Supplier |
---|---|
Sodium Carbonate | Wako |
Sodium Bicarbonate | Wako |
Methanol(99.5%) | Wako |
Sodium Chloride | Wako |
SDS | nacalai tesque |
Trisaminomethane | nacalai tesque |
Potassium dihydrogenphosphste | SIGAMA-ALDRICH |
Potassium Chloride | Wako |
Glycine | Wako |
Agar, Powder | Wako |
Agarose XP | Wako |
10% Hydrochloric Acid | Wako |
Tween-20 | SANTA CRUZ |
Other Enzyme | Supplier |
---|---|
KAPA™HiFi HotStart ReadyMix (2x) | KAPABIOSYSTEMS |
KAPA2G™ Fast HotStart ReadyMix with dye (2x) | KAPABIOSYSTEMS |
KAPATaq™EXtra HotStart ReadyMix with dye | KAPABIOSYSTEMS |
Quick Taq® HS DyeMix | TOYOBO |
SDSPAGE/WB | Supplier |
---|---|
IMMOBILON - P Blotting Sandwiches | Immobilon |
REAL GEL PLATE (10%) | BIO CRAFT |
BE-210(SDSPAGE) | BIO CRAFT |
BE-330 | BIO CRAFT |
Amersham ECL Anti-Mouse IgG | GE healthcare |
Amersham ECL Anti-rabbit IgG | GE healthcare |
G2-4 rabbit anti-serum | Sano |
Amersham ECL Prime Blocking Reagent | GE healthcare |
Amersham ECL Prime WB Detection Reagent | GE healthcare |
Methods
Westernblot (Against His tag)
- Apply sample to SDS-PAGE minigel (BIOCLAFT 10%).
- Soak the gel in transfer buffer
- Soak PVDF membrane in 100% methanol for 30 sec
- Soak PVDF membrane and filter paper in transfer buffer, leave for 5 min
- Set filter paper, membrane, gels, filter paper to semidry transferor in this order from anode to cathode
- Transfer the proteins from the gels to the membrane with 100mA for 1 h
- Soak membrane in blocking buffer (ECL Blocking reagent 5 g TBST 100ml) for 1 h
- Wash for 5 min 3 times with TBST
- Apply 1' antibody (anti-His tag or anti-NoVLP 10μl TBST 10 ml) and shake for 1 h
- Wash for 5 min 3 times with TBST
- Apply 2' antibody (anti-rabbit HRP 4μl:TBST 10ml) and shake for 1 h
- Wash for 5 min 3 times
- Drain excess wash buffer from the washed membrane and place it protein side up on flat surface
- Add detection reagent onto the membrane, covering all of the membrane
- Incubate for 5 minutes at room temperature
- Drain off excess detection reagent by dabbing with Kimwipe
- Place the sample in the CCD camera compartment and record the images
Western Blot (against NoVLP)
*Sample Preparation*
- Mix milliQ 12.5ul, SDSlysisbuffer 4.5ul, and VLP.
- Mix MilliQ 2.5ul, SDSlysisbuffer 2.5ul, and GE dual protein marker 5ul.
- Vortex 1. and 2., then centrifuge them with a minicentrifuge.
- Heat the solutions at 95 °C for 5 min.
- Vortex the solutions, and centrifuge them again.
Cellulose Affinity Assay
- Prepare LB +CP medium that contains objective E.coli, incubate overnight at 37°C
- Centrifuge this solution at 200g for 10 min.
- Collect the pellet, and add Carbonate bicarbonate buffe so that OD600 values come to about 0.2
- Take 1ml out of the cell suspension, and measure OD600 values. This OD600 values are <before>.
- Incubate the cell suspension with 3cm by 2.5 cm cellulose sheet (BEMLIESE #606) for 1 h
- Measure OD600 values of the cell suspension. This OD600 values are <after>.
- Transfer the cellulose sheet to a new buffer of the same volume, incubate for 1 hour
- Measure OD600 values of the buffer This OD600 values are <wash>.
Growth Curve Drawing
- Measure OD600 of LB liquid medium (10μg/ml CP) and set blank.
- Prepare 10ml LB liquid medium (10μg/ml CP) with E.coli sample whose OD600 values are adjusted to 1.0, Cover the tube with a plastic sheet with airholes
- Start incubating at 160rpm, 37°C. Measure the absorbance promptly and set it 0 minute.
- Measure OD600 every 30 minutes (before 2hours)/every an hour (after 2hours).
RT-PCR
RT-PCR was performed using QuantiTect® Reverse Transcription Kit according to the manufacturer's protocol.
Scanning Electron Microscopy (2015 Summer Experiment)
Samples | Centrifugal Force |
---|---|
INPNC-His-scFv(pSB3C5) 25ul+VLP2.5ul | 200g |
BclA-His-scFv(pSB3C5)25ul+VLP2.5ul | 200g |
*Sample Preparation (E.coli+VLP)*
- Prepare 45ml of sample E.coli liquid culture whose OD600 values are around 1.0
- Take 25ul, and pour into sample tubes.
- Centrifuge VLP with MiniCentrifuge. After tapping it, pour 2.5ul into tubes.
- Incubate for 24 hours.
- Centrifuge at 200g for 10 minutes.
- Suspend the pellets in 1ml PBS.
- Centrifuge at 200g for 10 minutes.
- Remove half of the supernatant, then suspend it again.
Scanning Electron Microscopy (2016 Summer Experiment)
Samples | Centrifugal Force |
---|---|
INPNC-His-scFv(pSB3C5) 25ul+VLP2.5ul | 3000g |
BclA-His-scFv(pSB3C5)25ul+VLP2.5ul | 3000g |
INPNC-His-ctl 25ul+VLP2.5ul | 3000g |
BclA-His-ctl 25ul+VLP2.5ul | 3000g |
INPNC-His-scFv(pSB3C5) 25ul+VLP2.5ul | 200g |
BclA-His-scFv(pSB3C5)25ul+VLP2.5ul | 200g |
INPNC-His-ctl 25ul+VLP2.5ul | 200g |
BclA-His-ctl 25ul+VLP2.5ul | 200g |
*Sample Preparation (E.coli+VLP)*
- Prepare 45ml of sample E.coli liquid culture whose OD600 values are adjusted to 1.0
- Take 25ul, and pour into sample tubes.
- Centrifuge VLP with MiniCentrifuge. After tapping it, pour 2.5ul into tubes.
- Incubate for 24 hours.
- Centrifuge at 200g/3000g for 10 minutes.
- Suspend the pellets in 1ml PBS.
- Centrifuge at 200g/3000g for 10 minutes.
- Remove half of the supernatant, then suspend it again.
*Sample Preparation (PBS+VLP)*
- After tapping VLP, pour 2ul into 200ml PBS.
- Mark where pellets should have aggregated if E. coli were in the tube.
- Centrifuge at 200g for 10 minutes.
- Take 100ul of the supernatant, then pour into 1. tube.
Miniprep
Miniprep was performed using FastGene™Plasmid Mini Kit according to the manufacturer's protocols.
Gel Extraction
Gel Extraction was performed using FastGene™Plasmid Mini Kit(GP3→MilliQ), and Wizard® SV Gel and PCR according to the manufacturer's protocols.
Restriction Enzyme Digestion
Restriction enzyme treatment was performed using Takara Bio's or Promega's restriction enzymes according to the respective manufacturer's protocols.
Ligation
Ligation was performed using Takara Bio's Ligation High Ver.2 according to the manufacturer's protocols.
Transformation
- Thaw competent cells on ice.
- Add DNA sample (1~20ul) to competent cells. leave them on ice for 30 minutes
- Keep them in heating block for 45 seconds, then cool on ice for 2 minutes.
- Add 40~200ul SOC liquid culture medium, then incubate under shaking culture for 1hour 37°C.
- Seed it onto LB+antibiotics agar culture. Incubate for 24 hours at 37°C.
PCR
PCR was performed using Wizard® SV Gel and PCR, KAPA™HiFi HotStart ReadyMix (2x) according to the manufacturer's protocols
Westernblotting (Membrane fraction)
Sample Preparation
- Cultivate 100ml of E. coli culture whose OD600 values are 0.5
- Divide the 100ml cell culture in to 50ml tube, centrifuge 5000 rpm for 10 min
- Wash with PBS 30ml, centrifuge 5000 rpm for 10 min
- Resuspend with 50mM Tris(pH8.0) 100mM NaCl 10% glycerol 10ml
- Sonicate both tubes
- Centrifuge 4000 rpm for 10 min at room temperature
- Ultracentrifuge the supernatant at 45000 rpm (around 190000g) at room temperature, then remove the resulting supernatant
- Resuspend in guanidine buffer (50mM Tris (8.0) 300mM NaCl 10mM Imidazole 6M Guanidine-HCl 0.1% NP40 1mM DTT) to denature proteins
- Use Ni-NTA beads to purify the target protein
- Resuspend the purified protein in SDS-buffer
- Follow the protocol for Westernblotting
Primer list
Primer name | Sequence | Length | Tm | GC% | Designer | Manufacturer |
---|---|---|---|---|---|---|
m.scfv Fw | TGTTTCTCCAGATGAACAGCCTGAGAG | 27bp | 66 | 47 | Li | Thermo Fisher Scientific Inc. |
m.scfv Rv | TCATCTGGAGAAACAACACATACTTGG | 27bp | 67 | 44 | Li | Thermo Fisher Scientific Inc. |
c.scfv Fw | AGGCGGATCCGGTATGGCCGAGGTGCAGC | 29bp | 74 | 69 | Li | Thermo Fisher Scientific Inc. |
c.scfv Rv | TACTAGTAGCGGCCGCTGCAGTACACCTAGGACGGT GACCTTGG |
44bp | 75 | 60 | Li | Thermo Fisher Scientific Inc. |
m.BAN Fw | TGCCGACCATGGCCGAGGTGCAGCTG | 26bp | 72 | 69 | Li | Thermo Fisher Scientific Inc. |
m.BAN RV | TCGGCCATGGTCGGCAGGGTGAAC | 24bp | 69 | 67 | Li | Thermo Fisher Scientific Inc. |
VF2 | TGCCACCTGACGTCTAAGAA | 20bp | 57 | 50 | iGEM | Thermo Fisher Scientific Inc. |
VR | ATTACCGCCTTTGAGTGAGC | 20bp | 56 | 50 | iGEM | Thermo Fisher Scientific Inc. |
BAN+scFv.Fw | ACTAGAGAAAGAGGAGAAATACTAGATGGCGTTC | 34bp | 62 | 41 | Uchino | Macrogen Japan Corp. |
J23114+RBS.Rv | GAACGCCATCTAGTATTTCTCCTCTTTCTCTAGTGC TAGCATTGTACCTAGGACTGAGCTAGC |
63bp | 72 | 46 | Uchino | Macrogen Japan Corp. |
J23108+RBS.Rv | GAACGCCATCTAGTATTTCTCCTCTTTCTCTAGT | 34bp | 62 | 41 | Uchino | Macrogen Japan Corp. |
J23100+RBS.Rv | GAACGCCATCTAGTATTTCTCCTCTTTCTCTAGTGC TAGCACTGTACCTAGGACTGAGC |
59bp | 72 | 47 | Uchino | Macrogen Japan Corp. |
Cex.Fw | GGTCCGGCCGGGTGCCAGGTG | 21bp | 71 | 81 | Uchino | Macrogen Japan Corp. |
Clos.Fw | TCATCAATGTCAGTTGAATTTTACAACTCTAAC | 33bp | 58 | 30 | Uchino | Macrogen Japan Corp. |
INP_His_Cex.Rv | CACCTGGCACCCGGCCGGACCATGATGATGATGATG ATGGGATCCGCCTCCTGCA |
55bp | 80 | 62 | Uchino | Macrogen Japan Corp. |
INP_His_Clos.Rv | GTTAGAGTTGTAAAATTCAACTGACATTGATGAATG ATGATGATGATGATGGGATCCGCCTCCTGCA |
67bp | 72 | 40 | Uchino | Macrogen Japan Corp. |
BAN_His_Cex.Rv | CACCTGGCACCCGGCCGGACCATGATGATGATGATG ATGGGTCGGCAGGGTGAAC |
55bp | 80 | 62 | Uchino | Macrogen Japan Corp. |
BAN_His_Clos.Rv | GTTAGAGTTGTAAAATTCAACTGACATTGATGAATG ATGATGATGATGATGGGTCGGCAGGGTGAAC |
67bp | 72 | 40 | Uchino | Macrogen Japan Corp. |
scFv_ctl_Fw | TAGCACTAGAGAAAGAGGAGAAATACTAGATGGCCG AGGTGCAGCTGG |
48bp | 72 | 50 | Uchino | Macrogen Japan Corp. |
scFv_ctl_Rv, CBDcex_ctl_Rv, CBDclos_ctl_Rv | CATCTAGTATTTCTCCTCTTTCTCTAGTGCTAGC | 34bp | 61 | 41 | Uchino | Macrogen Japan Corp. |
CBDcex_ctl_Fw | TAGCACTAGAGAAAGAGGAGAAATACTAGATGGGTC CGGCCGGGTGCCA |
49bp | 74 | 53 | Uchino | Macrogen Japan Corp. |
CBDclos_ctl_Fw | TAGCACTAGAGAAAGAGGAGAAATACTAGATGTCAT CAATGTCAGTTGAATTTTACAAC |
59bp | 67 | 34 | Uchino | Macrogen Japan Corp. |
RFP_His_CBDcex.Rv | CCACAGCACCTGGCACCCGGCCGGACCATGATGATG ATGATGATGTTATTAAGCACCGGTGGAGTGACG |
69bp | 79 | 57 | Uchino | Macrogen Japan Corp. |
RFP_His_CBDclos.Rv | GAGTTGTAAAATTCAACTGACATTGATGAATGATGA TGATGATGATGTTATTAAGCACCGGTGGAGTGACG |
71bp | 71 | 38 | Uchino | Macrogen Japan Corp. |
INP primer for CBD.Fw | ACGACGACTGGATCGAAGTTAAAG | 24bp | 58 | 46 | Miyazaki | Hokkaido System Science Co., Ltd. |
CBDcex primer.Rv | GCCGTTGAAGCCGAACTG | 18bp | 57 | 61 | Miyazaki | Hokkaido System Science Co., Ltd. |
scFv primer1'Fw | TGCAACCTCTGCATTCATCTT | 21bp | 56 | 43 | Miyazaki | Hokkaido System Science Co., Ltd. |
scFv primer2'Rv | CCCTGGCCCCAGTAGTCA | 18bp | 59 | 67 | Miyazaki | Hokkaido System Science Co., Ltd. |
rRNA 16S forward primer1 | GACGGGGGCCCGCACAAG | 18bp | 65 | 78 | Miyazaki | Hokkaido System Science Co., Ltd. |
rRNA 16S reverse primer1 | CTGGTCGTAAGGGCCATG | 18bp | 56 | 61 | Miyazaki | Hokkaido System Science Co., Ltd. |
Prefix-F | GAATTCGCGGCCGCTTCTAG | 20bp | 60 | 60 | iGEM | Hokkaido System Science Co., Ltd. |
Suffix-R | CTGCAGCGGCCGCTACTAGTA | 21bp | 62 | 62 | iGEM | Hokkaido System Science Co., Ltd. |
INP_His_coding_Rv | ggaCTGCAGCGGCCGCTACTAGTACTAATGATGATG ATGATGATGggatccgcctcctgcaccg |
64bp | 78 | 56 | Uchino | invitrogen |
INP_His_coding_Fw | ctgGAATTCGCGGCCGCTTCTAGAGatgaccctgga caaagctctgg |
47bp | 75bp | 57 | Uchino | invitrogen |
Sequence
We outsourced the sequencing to Macrogen
http://www.macrogen-japan.co.jp/cap_seq_0203.php