Team:Kyoto/Experiments

Contents
  • 1 Parts
  • 2 Primer list
  • 3 Materials
  • 4 Methods

    Parts

    Basic Parts
    Composite Parts

    Primer list

    Primer name Sequence Length Tm GC% Designer Manufacturer
    m.scfv Fw TGTTTCTCCAGATGAACAGCCTGAGAG 27bp 66 47 Li Thermo Fisher Scientific Inc.
    m.scfv Rv TCATCTGGAGAAACAACACATACTTGG 27bp 67 44 Li Thermo Fisher Scientific Inc.
    c.scfv Fw AGGCGGATCCGGTATGGCCGAGGTGCAGC 29bp 74 69 Li Thermo Fisher Scientific Inc.
    c.scfv Rv TACTAGTAGCGGCCGCTGCAGTACACCTAGGACGGT
    GACCTTGG    		 44bp 75 60 Li Thermo Fisher Scientific Inc.
    m.BAN Fw TGCCGACCATGGCCGAGGTGCAGCTG 26bp 72 69 Li Thermo Fisher Scientific Inc.
    m.BAN RV TCGGCCATGGTCGGCAGGGTGAAC 24bp 69 67 Li Thermo Fisher Scientific Inc.
    VF2 TGCCACCTGACGTCTAAGAA 20bp 57 50 iGEM Thermo Fisher Scientific Inc.
    VR ATTACCGCCTTTGAGTGAGC 20bp 56 50 iGEM Thermo Fisher Scientific Inc.
    BAN+scFv.Fw ACTAGAGAAAGAGGAGAAATACTAGATGGCGTTC 34bp 62 41 Uchino Macrogen Japan Corp.
    J23114+RBS.Rv GAACGCCATCTAGTATTTCTCCTCTTTCTCTAGTGC
    TAGCATTGTACCTAGGACTGAGCTAGC     		63bp 72 46 Uchino Macrogen Japan Corp.
    J23108+RBS.Rv GAACGCCATCTAGTATTTCTCCTCTTTCTCTAGT 34bp 62 41 Uchino Macrogen Japan Corp.
    J23100+RBS.Rv GAACGCCATCTAGTATTTCTCCTCTTTCTCTAGTGC
    TAGCACTGTACCTAGGACTGAGC     		59bp 72 47 Uchino Macrogen Japan Corp.
    Cex.Fw GGTCCGGCCGGGTGCCAGGTG 21bp 71 81 Uchino Macrogen Japan Corp.
    Clos.Fw TCATCAATGTCAGTTGAATTTTACAACTCTAAC 33bp 58 30 Uchino Macrogen Japan Corp.
    INP_His_Cex.Rv CACCTGGCACCCGGCCGGACCATGATGATGATGATG
    ATGGGATCCGCCTCCTGCA     		55bp 80 62 Uchino Macrogen Japan Corp.
    INP_His_Clos.Rv GTTAGAGTTGTAAAATTCAACTGACATTGATGAATG
    ATGATGATGATGATGGGATCCGCCTCCTGCA     		67bp 72 40 Uchino Macrogen Japan Corp.
    BAN_His_Cex.Rv CACCTGGCACCCGGCCGGACCATGATGATGATGATG
    ATGGGTCGGCAGGGTGAAC    		 55bp 80 62 Uchino Macrogen Japan Corp.
    BAN_His_Clos.Rv GTTAGAGTTGTAAAATTCAACTGACATTGATGAATG
    ATGATGATGATGATGGGTCGGCAGGGTGAAC    		 67bp 72 40 Uchino Macrogen Japan Corp.
    scFv_ctl_Fw TAGCACTAGAGAAAGAGGAGAAATACTAGATGGCCG
    AGGTGCAGCTGG    		 48bp 72 50 Uchino Macrogen Japan Corp.
    scFv_ctl_Rv, CBDcex_ctl_Rv, CBDclos_ctl_Rv CATCTAGTATTTCTCCTCTTTCTCTAGTGCTAGC 34bp 61 41 Uchino Macrogen Japan Corp.
    CBDcex_ctl_Fw TAGCACTAGAGAAAGAGGAGAAATACTAGATGGGTC
    CGGCCGGGTGCCA    		 49bp 74 53 Uchino Macrogen Japan Corp.
    CBDclos_ctl_Fw TAGCACTAGAGAAAGAGGAGAAATACTAGATGTCAT
    CAATGTCAGTTGAATTTTACAAC    		 59bp 67 34 Uchino Macrogen Japan Corp.
    RFP_His_CBDcex.Rv CCACAGCACCTGGCACCCGGCCGGACCATGATGATG
    ATGATGATGTTATTAAGCACCGGTGGAGTGACG    		 69bp 79 57 Uchino Macrogen Japan Corp.
    RFP_His_CBDclos.Rv GAGTTGTAAAATTCAACTGACATTGATGAATGATGA
    TGATGATGATGTTATTAAGCACCGGTGGAGTGACG    		 71bp 71 38 Uchino Macrogen Japan Corp.
    INP primer for CBD.Fw ACGACGACTGGATCGAAGTTAAAG 24bp 58 46 Miyazaki Hokkaido System Science Co., Ltd.
    CBDcex primer.Rv GCCGTTGAAGCCGAACTG 18bp 57 61 Miyazaki Hokkaido System Science Co., Ltd.
    scFv primer1'Fw TGCAACCTCTGCATTCATCTT 21bp 56 43 Miyazaki Hokkaido System Science Co., Ltd.
    scFv primer2'Rv CCCTGGCCCCAGTAGTCA 18bp 59 67 Miyazaki Hokkaido System Science Co., Ltd.
    rRNA 16S forward primer1 GACGGGGGCCCGCACAAG 18bp 65 78 Miyazaki Hokkaido System Science Co., Ltd.
    rRNA 16S reverse primer1 CTGGTCGTAAGGGCCATG 18bp 56 61 Miyazaki Hokkaido System Science Co., Ltd.
    Prefix-F GAATTCGCGGCCGCTTCTAG 20bp 60 60 iGEM Hokkaido System Science Co., Ltd.
    Suffix-R CTGCAGCGGCCGCTACTAGTA 21bp 62 62 iGEM Hokkaido System Science Co., Ltd.
    INP_His_coding_Rv ggaCTGCAGCGGCCGCTACTAGTACTAATGATGATG
    ATGATGATGggatccgcctcctgcaccg    		 64bp 78 56 Uchino invitrogen
    INP_His_coding_Fw ctgGAATTCGCGGCCGCTTCTAGAGatgaccctgga
    caaagctctgg    		 47bp 75bp 57 Uchino invitrogen

    Materials

    Kit

    Name Supplier
    Wizard® SV Gel and PCR Promega
    FastGene™Plasmid Mini Kit NIPPON Genetics Co.,Ltd
    PureYield™ Plasmid Midiprep System Promega
    FastGene™Gel/PCR Extraction Kit NIPPON Genetics Co.,Ltd

    Restriction Enzyme

    Name Supplier
    EcoRI TaKaRa, Promega
    PstI TaKaRa, Promega
    SpeI TaKaRa, Promega
    XbaI TaKaRa, Promega
    DraII TaKaRa

    Polymerase

    Name Supplier
    KAPA™HiFi HotStart ReadyMix (2x) KAPABIOSYSTEMS
    KAPA2G™ Fast HotStart ReadyMix with dye (2x) KAPABIOSYSTEMS
    KAPATaq™EXtra HotStart ReadyMix with dye KAPABIOSYSTEMS
    Quick Taq® HS DyeMix TOYOBO

    DNA ligase

    Name Supplier
    Ligation high Ver.2 TOYOBO

    Marker

    Name Supplier
    1kb DNA Ladder TaKaRa
    100bp DNA Ladder TaKaRa
    1kb Plus DNA Ladder Thermo Fisher Scientific

    Organism

    Name Supplier
    E.coli DH5α Genotype TaKaRa
    E.coli BL21(DE3)pLysS Competent Cells Promega

    Antibiotics

    Name Supplier
    Chloramphenicol nacalai tesque
    Ampicillin Sodium Salt nacalai tesque

    Equipment

    Name Supplier
    Bemliese SR601 AsahiKASEI
    BioPhotometer eppendorf
    LABO SHAKER BIO CRAFT
    CO2 INCUBATOR SANYO
    Pipette Controller Biohit Midi Plus
    MiniCentrifuge Model GMC-060 LMS CO.,LTD.
    HIGH-SPEED REFRIGERATED CENTRIFUGE TOMY
    HIGH-PRESSURE STEAM STERILIZER TOMY
    VOTEX-GENE2 Scientific Industryes
    Scanning Electron Miniscope TM1000s HITACHI
    Fluorescence Microscope BX61N-34-FL-1-D OLYMPUS
    SCIECE IMAGING SYSTEM LAS-3000 Fuji film
    Chemi Doc XRS+ BIO-RAD
    Cuvette Eppendorf

    Backbones

    Name Supplier
    pSB1C3 iGEM registry
    pSB1A2 iGEM registry
    pSB3C5 iGEM registry
    BBa_ J61002 iGEM registry

    Buffer

    Name Supplier
    Sodium Carbonate Wako
    Sodium Bicarbonate Wako
    Methanol(99.5%) Wako
    Sodium Chloride Wako
    SDS nacalai tesque
    Trisaminomethane nacalai tesque
    Potassium dihydrogenphosphste SIGAMA-ALDRICH
    Potassium Chloride Wako
    Glycine Wako
    Agar, Powder Wako
    Agarose XP Wako
    10% Hydrochloric Acid Wako
    Tween-20 SANTA CRUZ
    Dimethyl sulfoxide Wako

    SDSPAGE/Western blotting

    Name Supplier
    IMMOBILON - P Blotting Sandwiches Immobilon
    REAL GEL PLATE (10%) BIO CRAFT
    BE-210(SDSPAGE) BIO CRAFT
    BE-330 BIO CRAFT
    Amersham ECL Anti-Mouse IgG GE healthcare
    Amersham ECL Anti-rabbit IgG GE healthcare
    GII-4 rabbit anti-serum Dr. Sano
    Amersham ECL Prime Blocking Reagent GE healthcare
    Amersham ECL Prime WB Detection Reagent GE healthcare
    Amersham ECL DualVue Western blotting Markers GE healthcare
    WESTERN-VIEW™ Western Protein Size Marker(32-165kDa) Wako

    Fluorescence Microscope

    Name Supplier
    Immersion oil Type F OLYMPUS JAPAN
    Filter Paper Qualitative 2 90mm ADVANTEC
    Cellulose powder through 38μm(48mesh) Wako
    5ml Polystyrene round-bottom tube with cell-strainer Cap FALCON
    -Cellstain- DAPI solution Doujindou

    Electronic Microscope

    Name Supplier
    Paraformaldehyde(PFA) Dr. Tadokoro
    Osmic acid Dr. Tadokoro
    Acetone Dr. Tadokoro

    Others

    Name Supplier
    virus like protein GⅡ-４(Japan 2006) Dr. Sano
    Norovirus like protein GⅡ-４(Narita 1997) National institute of infectious diseases
    plasmid encoding human anti Norovirus scFv antibody 12A2 (pcpIII/12A2) Dr. Moriguchi

    Methods

    Miniprep

    Minipreps were performed using FastGene™Plasmid Mini Kit according to the manufacturer's protocols.

    Gel Extraction

    Gel Extraction was performed using FastGene™Plasmid Mini Kit(GP3→MilliQ), and Wizard® SV Gel and PCR according to the manufacturer's protocols.

    Restriction Enzyme Digestion

    Restriction enzyme treatment was performed using Takara Bio's or Promega's restriction enzymes according to the respective manufacturer's protocols.

    Ligation

    Ligation was performed using Takara Bio's Ligation High Ver.2 according to the manufacturer's protocols.

    Transformation

    1. Thaw competent cells on ice
    2. Add DNA sample (1~20μl) to competent cells. leave them on ice for 30 minutes
    3. Keep them in heating block for 45 seconds, then cool on ice for 2 minutes
    4. Add 40~200μl SOC liquid culture medium, then incubate with shaking for 1hour at 37°C
    5. Seed cells onto LB+antibiotics agar plate. Incubate for 24 hours at 37°C

    PCR

    PCR was performed using Wizard® SV Gel and PCR, KAPA™HiFi HotStart ReadyMix (2x) according to the manufacturer's protocols

    Sequencing

    We outsourced the sequencing to Macrogen
    http://www.macrogen-japan.co.jp/cap_seq_0203.php

    RT-PCR

    RT-PCR was performed using QuantiTect® Reverse Transcription Kit according to the manufacturer's protocol.

    Western blotting (basic protocol)

    1. Apply sample to SDS-PAGE minigel (BIOCRAFT 10%)
    2. Soak the gel in transfer buffer
    3. Soak PVDF membrane in 100% methanol for 30 sec
    4. Soak PVDF membrane and filter paper in transfer buffer, leave for 5 min
    5. Set filter paper, membrane, gels, filter paper in this order to semidry transfer from anode to cathode
    6. Transfer the proteins from the gel to the membrane with 100 mA for 1 h
    7. Soak membrane in blocking buffer (dilution of 5 g ECL Blocking reagent by 100ml of TBST) for 1 h
    8. Wash for 5 min 3 times with TBST
    9. Apply 1' antibody (dilution of 10 μl of 1’antibody by 10ml of Blocking buffer) and shake for 1 h
    10. Wash for 5 min 3 times with TBST
    11. Apply 2' antibody (dilution of 4μl of 2’antibody by 10ml of Blocking buffer) and shake for 1 h
    12. Wash for 5 min 3 times with TBST
    13. Drain excess wash buffer from the washed membrane and place on flat surface, protein side up
    14. Add detection reagent onto the membrane, covering all of the membrane
    15. Incubate for 5 minutes at room temperature
    16. Drain off excess detection reagent by dabbing with Kimwipe
    17. Place the sample in the CCD camera compartment and record the images

    Western blotting (anti-NoVLP)

    Sample Preparation

    1. Mix MilliQ 12.5ul, SDS sample buffer 4.5 ul, and VLP 1 ul
    2. Vortex well and centrifuge with a minicentrifuge
    3. Follow the protocol for our basic Western Blotting

    Western blotting (Membrane fraction)

    Sample Preparation

    1. Cultivate 100 ml of E. coli culture whose OD600 values are 0.5
    2. Divide the 100 ml cell culture in two 50 ml tubes, centrifuge 5000 rpm for 10 min
    3. Wash with PBS 30 ml, centrifuge 5000 rpm for 10 min
    4. Resuspend with 50 mM Tris (pH8.0) 100 mM NaCl 10% glycerol 10ml
    5. Combine the same sample tubes and sonicate 10 min
    6. Centrifuge 4000 rpm for 10 min at room temperature
    7. Ultracentrifuge the supernatant at 45000 rpm (around 190000g) at room temperature, then remove the resulting supernatant
    8. Resuspend pellet in guanidine buffer (50 mM Tris (8.0) 300 mM NaCl 10 mM Imidazole 6M Guanidine-HCl 0.1% NP40 1mM DTT) to denature proteins
    9. Use Ni-NTA beads to purify the target protein
    10. Resuspend the purified protein in SDS-buffer
    11. Follow the protocol for Western Blotting

    Western blotting (Whole cell)

    Sample Preparation

    1. Cultivate 100 ml of E. coli culture overnight
    2. Pour 400 ul of the E.coli cell culture into 1.5 tubes
    3. Centrifuge 5000 rpm for 1 min and remove the supernatant
    4. Wash pellet with 1 ml of PBS
    5. Centrifuge 5000rpm for 1 min and remove the supernatant
    6. Add MilliQ 15 ul and SDS sample buffer 5 ul
    7. Vortex well and centrifuge with a minicentrifuge
    8. Sonicate for 10min
    9. Centrifuge with a minicentrifuge
    10. Follow the protocol for Western Blotting

    Growth Curve Drawing

    1. Measure OD600 of LB liquid medium (10μg/ml CP) and set blank
    2. Prepare 10ml LB liquid medium (10μg/ml CP) with E.coli sample whose OD600 values are adjusted to 1.0, Cover the tube with a plastic sheet with airholes
    3. Start incubating at 160rpm, 37°C. Measure the absorbance promptly and set it 0 minute
    4. Measure OD600 every 30 minutes (before 2hours)/every hour (after 2hours)

    Cellulose Affinity Assay with spectrophotometer

    1. Prepare LB +CP medium that contains objective E.coli, incubate overnight at 37°C
    2. Centrifuge this culture at 200g for 10 min.
    3. Collect the pellet, and add Carbonate bicarbonate buffer so that OD600 values come to about 0.2
    4. Take 1ml out of the cell suspension, and measure OD600 values. These OD600 values are <before>
    5. Incubate the cell suspension with 3cm by 2.5 cm cellulose sheet (BEMLIESE #606) for 1 h
    6. Measure OD600 values of the cell suspension. These OD600 values are <after>
    7. Transfer the cellulose sheet to a new buffer of the same volume, incubate for 1 hour
    8. Measure OD600 values of the buffer. These OD600 values are <wash>

    Cellulose Affinity Assay with Fluorescence Microscope

    Sample Preparation

    1. Centrifuge overnight cell culture at 200g for 20min
    2. Resuspend in PBS to OD600 of 0.2/1.0
    3. Mix 1ml cell suspension and cellulose powder/Bemliese
    4. Stir at room temperature, 800rpm for 6h
    5. Pellet with minicentrifuge
    6. Fix samples with 4% PFA for 10min
    7. Pellet with minicentrifuge
    8. Resuspend in PBS 500μl
    9. Repeat step 7 and 8 two more times
    10. Add 500μl 1ug/ml DAPI and leave for 15min
    11. 1Pellet with minicentrifuge
    12. 1Resuspend in PBS 500μl
    13. Repeat step 11 and12 two more times
    14. Filter sample with filtering membrane with 200g centrifugation for 5min
    15. Add PBS 500μl then centrifuge 200g for additional 5min
    16. Resuspend the remaining cellulose on filtering membrane in PBS 400μl, transfer to 1.5ml tube
    17. Pellet with minicentrifuge
    18. Resuspend in 20μl fluorescence fading inhibitor

    Statistics Analysis

    1. Randomly photograph at 600x the samples obtained from cellulose binding assay with a fluorescent microscope
    2. Measeure the total area of the cellulose using ImageJ, and count the number of E. coli bound to the cellulose
    3. Divide the number of E. coli binding to cellulose by the area (μm^2) of cellulose
    4. Conduct an F test on the cell number/cellulose(um^2) using Excel2016 MSO (16.0.6701.1041), and compare INPNC-His-ctl expressing E. coli with INPNC-His-CBDcex expressing E. coli
    5. Conduct Welch’s t-test (two-sided) and compare INPNC-His-ctl expressing E. coli with INPNC-His-CBDcex expressing E. coli

    Scanning Electron Microscopy (2015 Summer Experiment)

    Samples Centrifugal Force
    INPNC-His-scFv(pSB3C5) 25μl+VLP2.5μl 200g
    BclA-His-scFv(pSB3C5)25μl+VLP2.5μl 200g

    Sample Preparation (E.coli+VLP)

    1. Prepare 45ml of sample E.coli liquid culture whose OD600 values are around 1.0
    2. Take 25μl, and pour into sample tubes
    3. Centrifuge VLP with minicentrifuge. After tapping it, pour 2.5μl into tubes
    4. Incubate for 24 hours
    5. Centrifuge at 200g for 10 minutes
    6. Suspend the pellets in 1ml PBS
    7. Centrifuge at 200g for 10 minutes
    8. Remove half of the supernatant, then resuspend with PBS

    Scanning Electron Microscopy (2016 Summer Experiment)

    Samples Centrifugal Force
    INPNC-His-scFv(pSB3C5) 25μl+VLP2.5μl 3000g
    BclA-His-scFv(pSB3C5)25μl+VLP2.5μl 3000g
    INPNC-His-ctl 25μl+VLP2.5μl 3000g
    BclA-His-ctl 25μl+VLP2.5μl 3000g
    INPNC-His-scFv(pSB3C5) 25μl+VLP2.5μl 200g
    BclA-His-scFv(pSB3C5)25μl+VLP2.5μl 200g
    INPNC-His-ctl 25μl+VLP2.5μl 200g
    BclA-His-ctl 25μl+VLP2.5μl 200g

    Sample Preparation (E.coli+VLP)

    1. Prepare 45ml of sample E.coli liquid culture whose OD600 values are adjusted to 1.0
    2. Take 25μl aliquot, and transfer into sample tubes
    3. Centrifuge VLP with minicentrifuge. After tapping it, add 2.5μl into tubes
    4. Incubate for 24 hours
    5. Centrifuge at 200g/3000g for 10 minutes
    6. Suspend the pellets in 1ml PBS
    7. Centrifuge at 200g/3000g for 10 minutes
    8. Remove half of the supernatant, then resuspend in PBS

    Sample Preparation (PBS+VLP)

    1. After tapping VLP, pour 2μl into 200ml PBS
    2. Mark where pellets should have aggregated if E. coli were in the tube
    3. Centrifuge at 200g for 10 minutes
    4. Take 100μl of the supernatant, then pour into 1. tube

    Shape Analysis

    1. Determine aspect ratios of all E.coli from the SEM pictures using ImageJ
    2. Conduct an F test on the aspect ratios using Excel2016 MSO (16.0.6701.1041), and compare BclA-His-scFv expressing E. coli with INPNC-His-scFv expressing E. coli
    3. Conduct Welch’s t-test　 (two-sided) and compare BclA-His-scFv expressing E. coli with INPNC-His-scFv expressing E. coli