Difference between revisions of "Team:EPFL/Software DATABASE"

User interface

In line with our goal of making dCas9-based gate technology as easy as possible to use, our user interface is remarkably simple. Buttons on the side-bar allow you to create standard parts of different types. Once these parts are on the workbench, they can be dragged-and-dropped so that the user can rearrange them as they wish. The possible relationships between parts include their genetic order and transcriptional activation or repression. These relationships can be defined by the users through dragging-and-dropping links between the parts.

Part Forms

When selecting the parts that have to be used for each gate two options are given: users can choose parts that have already been submitted to the database, or they may choose to submit new parts. In the case of submitting new parts, the relevant entry information is prompted by neat forms. This information generally includes, but is not limited, to the name and sequence of the part.

Sequence Highlighter

In the case of promoters, multiple functional areas may exist. For example, certain regions of the promoter may be known to be particularly effective targets for repression, and others for activation. In addition, some areas may be known to be able to modified, without changing the function of the promoter. We have a developed a fun tool with a clean design which helps users define these regions in new promoters. By dragging the cursor over certain areas of the promoter, these areas can be defined as activating, repressing, or variable regions.

Gate designer: Saving Elements

Once parts are submitted through the user interface, they are immediately uploaded to the database. After this point they can be suggested to users when they search for the part again.

Gate designer: APIs

intelligene.plus comes with handy APIs, which can be used to call the database from an external source, such as an application like Cello.

http://intelligene.plus/api/apidef?t=typeofdata&query=query&organism=organismName&strain=strainName&format=format

Example:

http://intelligene.plus/api/db?t=pem&query=m&organism=yeast&strain=w303&format=json

{"status":true,"response":[
    {
        "id":"1",
        "name":"PCP-MxiI",
        "sequence":"atgtccaaaaccatcgttctttcggtcggcgaggctactcgcactctgactgagatccagtccaccgcagaccgtcagatcttcgaagagaaggtcgggcctctggtgggtcggctgcgcctcacggcttcgctccgtcaaaacggagccaagaccgcgtatcgcgtcaacctaaaactggatcaggcggacgtcgttgattccggacttccgaaagtgcgctacactcaggtatggtcgcacgacgtgacaatcgttgcgaatagcaccgaggcctcgcgcaaatcgttgtacgatttgaccaagtccctcgtcgcgacctcgcaggtcgaagatcttgtcgtcaaccttgtgccgctgggccgtGGCTCCATGGAACGTGTGAGAATGATTAATGTGCAAAGGCTGTTAGAAGCCGCAGAGTTTTTAGAAAGAAGAGAAAGAGAATGCGAACACGGGTATGCCAGTTCTTTCCCTAGCATGCCCTCTCCCAGA",
        "description":"Linear DNA encoding for the fused protein PCP-MxiI. PCP is an RNA binding protein for the sequence PP7, MxiI: gene encoding for MAX-interacting protein I, a mammalian transcriptional repressor domain that is reported to interact with the histone deacetylase Sin3 homolog in yeast."
    },
    {
        "id":"2",
        "name":"activator PEM",
        "sequence":"CGATCGATTGCTAGCTGAGCATCAGCTAGCAC",
        "description":"test dev"
    },
    {
        "id":"3",
        "name":"repressor PEM",
        "sequence":"CGATGCTATGCGGCGGCGCGCATCGATCAGCATCG",
        "description":"test dev"
    },
    {
        "id":"4",
        "name":"MCP-VP64",
        "sequence":"CGATGCTATGCGGCGGCGCGCATCGATCAGCATCGCGATGCTATGCGGCGGCGCGCATCGATCAGCATCGCGATGCTATGCGGCGGCGCGCATCGATCAGCATCGCGATGCTATGCGGCGGCGCGCATCGATCAGCATCGCGATGCTATGCGGCGGCGCGCATCGATCAGCATCGCGATGCTATGCGGCGGCGCGCATCGATCAGCATCG",
        "description":"linear DNA encoding for the RNA binding protein MCP fused to the transcriptional activation domain VP64. VP64 is a transcriptional activator composed of four tandem copies of VP16 connected with glycine-serine linkers. When fused to another protein domain that can bind near the promoter of a gene, VP64 acts as a strong transcriptional activator"
    }
]}
                        

System requirements

The software can run on almost any web server featuring PHP & MySQL.

More specifically, it runs on the LAMP platform. This means your web server (or web hosting account) should be featured with the following software: Linux + Apache + MySQL + PHP.

For all practical purposes, it will run on the vast majority of current web hosting offers.

Software Requirements

Your web server / web hosting account should have the following software versions:

• Linux: any modern distribution will work.
• On shared hosting accounts, you should not even need to worry about this.
• For dedicated servers, we like to use CentOS but RedHat, Debian and others will work just as well.
• Note: it is possible to run the software on Windows, especially for development. This is not an officially supported platform though and we do not recommend it for production servers, especially regarding performance & security.
• Note: running on Mac OS X works fine, especially with a package like MAMP.
• Apache: version 2.0 or above.
• Note: it is possible to run intelligene.plus on Lighttpd or NginX but these are not officially supported configurations and will likely require manual configuration as these servers will not read our .htaccess File.
• MySQL: version 5.0.3 or above.
• InnoDB MUST be enabled (All decent web hosts offer InnoDB)
• Note: At this point we do not believe that database abstraction is a practical proposition.
• PHP: version 5.2 or above. No additional requirements.

Installation

Just download the code from here and put it on a server. Dump the database (link) and then load the index.php.

Note that intelligene.plus can be used with no downloads/installations required at www.intelligene.plus.