|
|
| (38 intermediate revisions by 5 users not shown) |
| Line 1: |
Line 1: |
| | {{Groningen}} | | {{Groningen}} |
| | <html> | | <html> |
| | + | <!-- GACCAAGCCTGCAAAAGCAAACGGCAAACCTGACTGGACCAAAAAATCAGTAGTCCGAAGGTATAAACATCCGTGCGTAAGAAGCCATCCACTAAGTATTTAAGATTTGAAGTTGTCATATAGAGAAGGCATTAAGGGTTCACATAAGAGCTACACCTGAGAAGGCATCCAAGCACTGCATAAGTTATTCTCTTTCTGTCGAAGAAATGCAATAAGGAGTTAAGGCCTGAAGTAATTTGATAAGGGTTTAAGACTTTAAGACCTTAAGGCCTTAAGCGATTAAGAATTGGGAATAAAAAAATCCGGCGAAGGAATGCAATCTCCCAAGAAGGTCTGAAGTGATGAAGAGCTTAAGTACTGAAGTCTTGAAGAAATTAAGTCATAACCGAAGCATTCACAATCCGTACTAAGTTATTGTATAAAAAAACTAGAAGTTGTGAAGAAATTAAGTAATTAAGATAAAAAAACTGAAGCTATTAAGGTCTTCGCTAAGAGCTGAAGGCTTGAAGGTGAAAAAAATCGACTAAGGGGTGAAGACCTCGACGAAGTCGTTAAGAGTTGGGAGCACCCACCGAC --> |
| | + | <article> |
| | + | <section class="split"> |
| | + | <div class="left flone"> |
| | + | <h2>CryptoGE<sup>®</sup>M: Encode it, Keep it</h2> |
| | + | |
| | + | <p>The world's silicon supply won't be able to cover the demand |
| | + | for flash data storage by 2040. However, nature has been encoding |
| | + | enormous amounts of information in DNA for billions of years. |
| | + | By introducing a sequence into DNA of bacterial spores, one of |
| | + | the most durable and resilient forms of life, |
| | + | "CryptoGE<sup>®</sup>M" tries to combine storing information and |
| | + | transferring it in a safe way. The goal is to safely send a key |
| | + | and an encrypted message in two separate spore systems of |
| | + | <em>Bacillus subtilis</em>. Digital and biological protection layers |
| | + | will prevent this information from being captured by |
| | + | unauthorized parties. The message is protected by computational |
| | + | encryption, while the sensitive key can only be accessed from |
| | + | the spores with the right growing conditions. For example, |
| | + | light-switchable antibiotics have to be activated by the |
| | + | correct frequency of light. If the recipient fails, the |
| | + | sequence will be destroyed and the message is lost forever.</p> |
| | + | </div> |
| | | | |
| − | <div class="column full_size" > | + | <div class=" right flone img centrate">< a class=" img" href="/ Team: Groningen/ Tour">< img src="https:// static.igem.org/ mediawiki/ 2016/ c/ cc/ T--Groningen--Bacilluscoupletour. png" alt=" Bacilli" /></a></ div> |
| − | <img src="http://placehold.it/800x300/d3d3d3/f2f2f2">
| + | </section> |
| − | </div> | + | <section> |
| − | | + | <p class="centrate down-one"> |
| − | <div class="column full_size" >
| + | <a class="biglink centrate bleu" href="/Team:Groningen/Tour">Take the Tour!</a> <span style="font-size: 2em">|</span> |
| − | <h2> Welcome to iGEM 2016! </h2>
| + | <a class="biglink centrate bleu" href="/Team: Groningen/Results"> View our Results</a> |
| − | <p>Your team has been approved and you are ready to start the iGEM season! </p>
| + | </p> |
| − | | + | </section> |
| − | </div>
| + | <hr /> |
| − | | + | <section class="cycler centrate"> |
| − | <div class="column half_size" >
| + | <img class="active" src="https://static.igem.org/mediawiki/2016/5/5e/T--Groningen--Team-all-6-960.jpg" /> |
| − | <h5>Before you start: </h5>
| + | <img class="base" src="https://static.igem.org/mediawiki/2016/5/5a/T--Groningen--Team-agar.jpg" /> |
| − | <p> Please read the following pages:</p>
| + | </section> |
| − | <ul> | + | </article> |
| − | <li> <a href="https://2016.igem.org/Requirements">Requirements page </a> </li>
| + | |
| − | <li> <a href="https://2016.igem.org/Wiki_How-To">Wiki Requirements page</a></li>
| + | |
| − | <li> <a href="https://2016.igem.org/Resources/Template_Documentation"> Template Documentation </a></li>
| + | |
| − | </ul> | + | |
| − | </div> | + | |
| − | | + | |
| − | <div class="column half_size" > | + | |
| − | <div class="highlight"> | + | |
| − | <h5> Styling your wiki </h5>
| + | |
| − | <p>You may style this page as you like or you can simply leave the style as it is. You can easily keep the styling and edit the content of these default wiki pages with your project information and completely fulfill the requirement to document your project.</p>
| + | |
| − | <p>While you may not win Best Wiki with this styling, your team is still eligible for all other awards. This default wiki meets the requirements, it improves navigability and ease of use for visitors, and you should not feel it is necessary to style beyond what has been provided.</p>
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | | + | |
| − | <div class="column full_size" >
| + | |
| − | <h5> Wiki template information </h5>
| + | |
| − | <p>We have created these wiki template pages to help you get started and to help you think about how your team will be evaluated. You can find a list of all the pages tied to awards here at the <a href="https://2016.igem.org/Judging/Pages_for_Awards/Instructions">Pages for awards</a> link. You must edit these pages to be evaluated for medals and awards, but ultimately the design, layout, style and all other elements of your team wiki is up to you!</p>
| + | |
| − | | + | |
| − | </div> | + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | <div class="column half_size" >
| + | |
| − | <h5> Editing your wiki </h5>
| + | |
| − | <p>On this page you can document your project, introduce your team members, document your progress and share your iGEM experience with the rest of the world! </p>
| + | |
| − | <p> <a href=" https:/ /2016.igem.org/wiki/index.php?title=Team: Example&action=edit"> Click here to edit this page! </a> </p> | + | |
| − | | + | |
| − | </div>
| + | |
| − | | + | |
| − | | + | |
| − | <div class="column half_size" >
| + | |
| − | <h5>Tips</h5>
| + | |
| − | <p>This wiki will be your team’s first interaction with the rest of the world, so here are a few tips to help you get started: </p>
| + | |
| − | <ul>
| + | |
| − | <li>State your accomplishments! Tell people what you have achieved from the start. </li>
| + | |
| − | <li>Be clear about what you are doing and how you plan to do this.</li> | + | |
| − | <li>You have a global audience! Consider the different backgrounds that your users come from.</li> | + | |
| − | <li>Make sure information is easy to find; nothing should be more than 3 clicks away. </li>
| + | |
| − | <li>Avoid using very small fonts and low contrast colors; information should be easy to read. </li>
| + | |
| − | <li>Start documenting your project as early as possible; don’t leave anything to the last minute before the Wiki Freeze. For a complete list of deadlines visit the <a href="https://2016.igem.org/Calendar">iGEM 2016 calendar</a> </li>
| + | |
| − | <li>Have lots of fun! </li> | + | |
| − | </ul>
| + | |
| − | </div>
| + | |
| − | | + | |
| − | | + | |
| − | <div class="column half_size" >
| + | |
| − | <h5>Inspiration</h5>
| + | |
| − | <p> You can also view other team wikis for inspiration! Here are some examples:</p>
| + | |
| − | <ul>
| + | |
| − | <li> <a href="https://2014.igem.org/Team:SDU-Denmark/"> 2014 SDU Denmark </a> </li>
| + | |
| − | <li> <a href="https://2014.igem.org/Team:Aalto-Helsinki">2014 Aalto-Helsinki</a> </li>
| + | |
| − | <li> <a href="https://2014.igem.org/Team:LMU-Munich">2014 LMU-Munich</a> </li>
| + | |
| − | <li> <a href="https://2014.igem.org/Team:Michigan"> 2014 Michigan</a></li> | + | |
| − | <li> <a href="https://2014.igem.org/Team:ITESM-Guadalajara">2014 ITESM-Guadalajara </a></li>
| + | |
| − | <li> <a href="https://2014.igem.org/Team:SCU-China"> 2014 SCU-China </a></li>
| + | |
| − | </ul>
| + | |
| − | </div>
| + | |
| − | | + | |
| − | <div class="column half_size" >
| + | |
| − | <h5> Uploading pictures and files </h5>
| + | |
| − | <p> You can upload your pictures and files to the iGEM 2016 server. Remember to keep all your pictures and files within your team's namespace or at least include your team's name in the file name. <br />
| + | |
| − | When you upload, set the "Destination Filename" to <code>Team:YourOfficialTeamName/NameOfFile.jpg</code>. (If you don't do this, someone else might upload a different file with the same "Destination Filename", and your file would be erased!)</p>
| + | |
| − | | + | |
| − | | + | |
| − | <div class="button_click" onClick=" parent.location= 'https://2016.igem.org/Special:Upload '"> | + | |
| − | UPLOAD FILES
| + | |
| − | </div> | + | |
| − | | + | |
| − | </div>
| + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | | + | |
| − | | + | |
| | </html> | | </html> |
| | + | {{Groningen/footer}} |
