|
|
| (28 intermediate revisions by 4 users not shown) |
| Line 1: |
Line 1: |
| | {{Groningen}} | | {{Groningen}} |
| | <html> | | <html> |
| | + | <!-- GACCAAGCCTGCAAAAGCAAACGGCAAACCTGACTGGACCAAAAAATCAGTAGTCCGAAGGTATAAACATCCGTGCGTAAGAAGCCATCCACTAAGTATTTAAGATTTGAAGTTGTCATATAGAGAAGGCATTAAGGGTTCACATAAGAGCTACACCTGAGAAGGCATCCAAGCACTGCATAAGTTATTCTCTTTCTGTCGAAGAAATGCAATAAGGAGTTAAGGCCTGAAGTAATTTGATAAGGGTTTAAGACTTTAAGACCTTAAGGCCTTAAGCGATTAAGAATTGGGAATAAAAAAATCCGGCGAAGGAATGCAATCTCCCAAGAAGGTCTGAAGTGATGAAGAGCTTAAGTACTGAAGTCTTGAAGAAATTAAGTCATAACCGAAGCATTCACAATCCGTACTAAGTTATTGTATAAAAAAACTAGAAGTTGTGAAGAAATTAAGTAATTAAGATAAAAAAACTGAAGCTATTAAGGTCTTCGCTAAGAGCTGAAGGCTTGAAGGTGAAAAAAATCGACTAAGGGGTGAAGACCTCGACGAAGTCGTTAAGAGTTGGGAGCACCCACCGAC --> |
| | <article> | | <article> |
| − | <h2>CryptoGE®M: Encode it, keep it</h2>
| |
| − |
| |
| | <section class="split"> | | <section class="split"> |
| − | <p class="half-left">The world's silicon supply won't be able to cover the demand for data storage by 2040. However, nature has been encoding enormous amounts of information in DNA for billions of years. By introducing a sequence into DNA of bacterial spores, one of the most resistant-to-harsh-conditions forms of life, "CryptoGERM" tries to combine storing information and transferring it in a safe way. The goal is to safely send a key and an encrypted message in two separate spore systems of Bacillus subtilis. Digital and biological protection layers will prevent this information from being captured by unauthorized parties. The message is protected by computational encryption, while the sensitive key can only be accessed from the spores with the right growing conditions. For example, light-switchable antibiotics have to be activated by the correct frequency of light. If the recipient fails, the sequence will be destroyed and the message is lost forever.</p> | + | <div class="left flone"> |
| | + | <h2>CryptoGE<sup>®</sup>M: Encode it, Keep it</h2> |
| | + | |
| | + | <p>The world's silicon supply won't be able to cover the demand |
| | + | for flash data storage by 2040. However, nature has been encoding |
| | + | enormous amounts of information in DNA for billions of years. |
| | + | By introducing a sequence into DNA of bacterial spores, one of |
| | + | the most durable and resilient forms of life, |
| | + | "CryptoGE<sup>®</sup>M" tries to combine storing information and |
| | + | transferring it in a safe way. The goal is to safely send a key |
| | + | and an encrypted message in two separate spore systems of |
| | + | <em>Bacillus subtilis</em>. Digital and biological protection layers |
| | + | will prevent this information from being captured by |
| | + | unauthorized parties. The message is protected by computational |
| | + | encryption, while the sensitive key can only be accessed from |
| | + | the spores with the right growing conditions. For example, |
| | + | light-switchable antibiotics have to be activated by the |
| | + | correct frequency of light. If the recipient fails, the |
| | + | sequence will be destroyed and the message is lost forever.</p> |
| | + | </div> |
| | | | |
| − | < p class=" half-right img"><img src="https://static.igem.org/mediawiki/2016/ 0/ 0d/T--Groningen-- logo-bacilli.png" alt="Bacilli" /></p> | + | < div class="right flone img centrate"><a class="img" href="/Team:Groningen/Tour"><img src="https://static.igem.org/mediawiki/2016/ c/ cc/T--Groningen-- Bacilluscoupletour.png" alt="Bacilli" /></ a></div> |
| | + | </section> |
| | + | <section> |
| | + | <p class="centrate down-one"> |
| | + | <a class="biglink centrate bleu" href="/Team:Groningen/Tour">Take the Tour!</a> <span style="font-size: 2em">|</span> |
| | + | <a class="biglink centrate bleu" href="/Team:Groningen/Results">View our Results</a> |
| | + | </p> |
| | + | </section> |
| | + | <hr /> |
| | + | <section class="cycler centrate"> |
| | + | <img class="active" src="https://static.igem.org/mediawiki/2016/5/5e/T--Groningen--Team-all-6-960.jpg" /> |
| | + | <img class="base" src="https://static.igem.org/mediawiki/2016/5/5a/T--Groningen--Team-agar.jpg" /> |
| | </section> | | </section> |
| | </article> | | </article> |
| | </html> | | </html> |
| | {{Groningen/footer}} | | {{Groningen/footer}} |
