|
|
| (26 intermediate revisions by 4 users not shown) |
| Line 1: |
Line 1: |
| | {{Groningen}} | | {{Groningen}} |
| | <html> | | <html> |
| | + | <!-- GACCAAGCCTGCAAAAGCAAACGGCAAACCTGACTGGACCAAAAAATCAGTAGTCCGAAGGTATAAACATCCGTGCGTAAGAAGCCATCCACTAAGTATTTAAGATTTGAAGTTGTCATATAGAGAAGGCATTAAGGGTTCACATAAGAGCTACACCTGAGAAGGCATCCAAGCACTGCATAAGTTATTCTCTTTCTGTCGAAGAAATGCAATAAGGAGTTAAGGCCTGAAGTAATTTGATAAGGGTTTAAGACTTTAAGACCTTAAGGCCTTAAGCGATTAAGAATTGGGAATAAAAAAATCCGGCGAAGGAATGCAATCTCCCAAGAAGGTCTGAAGTGATGAAGAGCTTAAGTACTGAAGTCTTGAAGAAATTAAGTCATAACCGAAGCATTCACAATCCGTACTAAGTTATTGTATAAAAAAACTAGAAGTTGTGAAGAAATTAAGTAATTAAGATAAAAAAACTGAAGCTATTAAGGTCTTCGCTAAGAGCTGAAGGCTTGAAGGTGAAAAAAATCGACTAAGGGGTGAAGACCTCGACGAAGTCGTTAAGAGTTGGGAGCACCCACCGAC --> |
| | <article> | | <article> |
| − | <section> | + | <section class="split"> |
| − | <div class="split">
| + | <div class="left flone"> |
| − | <div class="half-left"> | + | <h2>CryptoGE<sup>®</sup>M: Encode it, Keep it</h2> |
| − | <h2>CryptoGE®M: Encode it, keep it</h2>
| + | |
| − |
| + | <p>The world's silicon supply won't be able to cover the demand |
| − | <p class="half-left">The world's silicon supply won't be able to | + | for flash data storage by 2040. However, nature has been encoding |
| − | cover the demand for data storage by 2040. However, nature has been
| + | enormous amounts of information in DNA for billions of years. |
| − | encoding enormous amounts of information in DNA for billions of | + | By introducing a sequence into DNA of bacterial spores, one of |
| − | years. By introducing a sequence into DNA of bacterial spores, one
| + | the most durable and resilient forms of life, |
| − | of the most resistant-to-harsh-conditions forms of life, | + | "CryptoGE<sup>®</sup>M" tries to combine storing information and |
| − | "CryptoGERM" tries to combine storing information and transferring | + | transferring it in a safe way. The goal is to safely send a key |
| − | it in a safe way. The goal is to safely send a key and an encrypted | + | and an encrypted message in two separate spore systems of |
| − | message in two separate spore systems of Bacillus subtilis. Digital
| + | <em>Bacillus subtilis</em>. Digital and biological protection layers |
| − | and biological protection layers will prevent this information from
| + | will prevent this information from being captured by |
| − | being captured by unauthorized parties. The message is protected by
| + | unauthorized parties. The message is protected by computational |
| − | computational encryption, while the sensitive key can only be | + | encryption, while the sensitive key can only be accessed from |
| − | accessed from the spores with the right growing conditions. For
| + | the spores with the right growing conditions. For example, |
| − | example, light-switchable antibiotics have to be activated by the
| + | light-switchable antibiotics have to be activated by the |
| − | correct frequency of light. If the recipient fails, the sequence | + | correct frequency of light. If the recipient fails, the |
| − | will be destroyed and the message is lost forever.</p> | + | sequence will be destroyed and the message is lost forever.</p> |
| − | </div>
| + | |
| − | <div class="half-right">
| + | |
| − | <p class="half-right img"><img src="https://static.igem.org/mediawiki/2016/0/0d/T--Groningen--logo-bacilli.png" alt="Bacilli" /></p>
| + | |
| − | </div>
| + | |
| | </div> | | </div> |
| | + | |
| | + | <div class="right flone img centrate"><a class="img" href="/Team:Groningen/Tour"><img src="https://static.igem.org/mediawiki/2016/c/cc/T--Groningen--Bacilluscoupletour.png" alt="Bacilli" /></a></div> |
| | + | </section> |
| | + | <section> |
| | + | <p class="centrate down-one"> |
| | + | <a class="biglink centrate bleu" href="/Team:Groningen/Tour">Take the Tour!</a> <span style="font-size: 2em">|</span> |
| | + | <a class="biglink centrate bleu" href="/Team:Groningen/Results">View our Results</a> |
| | + | </p> |
| | + | </section> |
| | + | <hr /> |
| | + | <section class="cycler centrate"> |
| | + | <img class="active" src="https://static.igem.org/mediawiki/2016/5/5e/T--Groningen--Team-all-6-960.jpg" /> |
| | + | <img class="base" src="https://static.igem.org/mediawiki/2016/5/5a/T--Groningen--Team-agar.jpg" /> |
| | </section> | | </section> |
| | </article> | | </article> |
| | </html> | | </html> |
| | {{Groningen/footer}} | | {{Groningen/footer}} |
