|
|
(21 intermediate revisions by 4 users not shown) |
Line 1: |
Line 1: |
| {{Groningen}} | | {{Groningen}} |
| <html> | | <html> |
| + | <!-- GACCAAGCCTGCAAAAGCAAACGGCAAACCTGACTGGACCAAAAAATCAGTAGTCCGAAGGTATAAACATCCGTGCGTAAGAAGCCATCCACTAAGTATTTAAGATTTGAAGTTGTCATATAGAGAAGGCATTAAGGGTTCACATAAGAGCTACACCTGAGAAGGCATCCAAGCACTGCATAAGTTATTCTCTTTCTGTCGAAGAAATGCAATAAGGAGTTAAGGCCTGAAGTAATTTGATAAGGGTTTAAGACTTTAAGACCTTAAGGCCTTAAGCGATTAAGAATTGGGAATAAAAAAATCCGGCGAAGGAATGCAATCTCCCAAGAAGGTCTGAAGTGATGAAGAGCTTAAGTACTGAAGTCTTGAAGAAATTAAGTCATAACCGAAGCATTCACAATCCGTACTAAGTTATTGTATAAAAAAACTAGAAGTTGTGAAGAAATTAAGTAATTAAGATAAAAAAACTGAAGCTATTAAGGTCTTCGCTAAGAGCTGAAGGCTTGAAGGTGAAAAAAATCGACTAAGGGGTGAAGACCTCGACGAAGTCGTTAAGAGTTGGGAGCACCCACCGAC --> |
| <article> | | <article> |
| <section class="split"> | | <section class="split"> |
− | <div class="half-left"> | + | <div class="left flone"> |
− | <h2>CryptoGE®M: Encode it, keep it</h2> | + | <h2>CryptoGE<sup>®</sup>M: Encode it, Keep it</h2> |
| | | |
− | <p>The world's silicon supply won't be able to | + | <p>The world's silicon supply won't be able to cover the demand |
− | cover the demand for data storage by 2040. However, nature has
| + | for flash data storage by 2040. However, nature has been encoding |
− | been encoding enormous amounts of information in DNA for
| + | enormous amounts of information in DNA for billions of years. |
− | billions of years. By introducing a sequence into DNA of
| + | By introducing a sequence into DNA of bacterial spores, one of |
− | bacterial spores, one of the most resistant-to-harsh-conditions
| + | the most durable and resilient forms of life, |
− | forms of life, "CryptoGERM" tries to combine storing
| + | "CryptoGE<sup>®</sup>M" tries to combine storing information and |
− | information and transferring it in a safe way. The goal is to | + | transferring it in a safe way. The goal is to safely send a key |
− | safely send a key and an encrypted message in two separate
| + | and an encrypted message in two separate spore systems of |
− | spore systems of Bacillus subtilis. Digital and biological
| + | <em>Bacillus subtilis</em>. Digital and biological protection layers |
− | protection layers will prevent this information from being | + | will prevent this information from being captured by |
− | captured by unauthorized parties. The message is protected by | + | unauthorized parties. The message is protected by computational |
− | computational encryption, while the sensitive key can only be | + | encryption, while the sensitive key can only be accessed from |
− | accessed from the spores with the right growing conditions. For | + | the spores with the right growing conditions. For example, |
− | example, light-switchable antibiotics have to be activated by
| + | light-switchable antibiotics have to be activated by the |
− | the correct frequency of light. If the recipient fails, the | + | correct frequency of light. If the recipient fails, the |
| sequence will be destroyed and the message is lost forever.</p> | | sequence will be destroyed and the message is lost forever.</p> |
− |
| |
− | <p class="centrate">
| |
− | <a class="biglink centrate bleu" href="/Team:Groningen/Tour">Take the Tour!</a>
| |
− | </p>
| |
| </div> | | </div> |
| | | |
− | <div class="half-right img"><img src="https://static.igem.org/mediawiki/2016/0/0d/T--Groningen--logo-bacilli.png" alt="Bacilli" /></div> | + | <div class="right flone img centrate"><a class="img" href="/Team:Groningen/Tour"><img src="https://static.igem.org/mediawiki/2016/c/cc/T--Groningen--Bacilluscoupletour.png" alt="Bacilli" /></a></div> |
| + | </section> |
| + | <section> |
| + | <p class="centrate down-one"> |
| + | <a class="biglink centrate bleu" href="/Team:Groningen/Tour">Take the Tour!</a> <span style="font-size: 2em">|</span> |
| + | <a class="biglink centrate bleu" href="/Team:Groningen/Results">View our Results</a> |
| + | </p> |
| + | </section> |
| + | <hr /> |
| + | <section class="cycler centrate"> |
| + | <img class="active" src="https://static.igem.org/mediawiki/2016/5/5e/T--Groningen--Team-all-6-960.jpg" /> |
| + | <img class="base" src="https://static.igem.org/mediawiki/2016/5/5a/T--Groningen--Team-agar.jpg" /> |
| </section> | | </section> |
| </article> | | </article> |
| </html> | | </html> |
| {{Groningen/footer}} | | {{Groningen/footer}} |