Difference between revisions of "Team:Groningen"

 
(19 intermediate revisions by 4 users not shown)
Line 1: Line 1:
 
{{Groningen}}
 
{{Groningen}}
 
<html>
 
<html>
 +
<!-- GACCAAGCCTGCAAAAGCAAACGGCAAACCTGACTGGACCAAAAAATCAGTAGTCCGAAGGTATAAACATCCGTGCGTAAGAAGCCATCCACTAAGTATTTAAGATTTGAAGTTGTCATATAGAGAAGGCATTAAGGGTTCACATAAGAGCTACACCTGAGAAGGCATCCAAGCACTGCATAAGTTATTCTCTTTCTGTCGAAGAAATGCAATAAGGAGTTAAGGCCTGAAGTAATTTGATAAGGGTTTAAGACTTTAAGACCTTAAGGCCTTAAGCGATTAAGAATTGGGAATAAAAAAATCCGGCGAAGGAATGCAATCTCCCAAGAAGGTCTGAAGTGATGAAGAGCTTAAGTACTGAAGTCTTGAAGAAATTAAGTCATAACCGAAGCATTCACAATCCGTACTAAGTTATTGTATAAAAAAACTAGAAGTTGTGAAGAAATTAAGTAATTAAGATAAAAAAACTGAAGCTATTAAGGTCTTCGCTAAGAGCTGAAGGCTTGAAGGTGAAAAAAATCGACTAAGGGGTGAAGACCTCGACGAAGTCGTTAAGAGTTGGGAGCACCCACCGAC -->
 
<article>
 
<article>
 
<section class="split">
 
<section class="split">
<div class="half-left">
+
<div class="left flone">
<h2>CryptoGE®M: Encode it, keep it</h2>
+
<h2>CryptoGE<sup>®</sup>M: Encode it, Keep it</h2>
 
 
<p>The world's silicon supply won't be able to  
+
<p>The world's silicon supply won't be able to cover the demand  
cover the demand for data storage by 2040. However, nature has  
+
for flash data storage by 2040. However, nature has been encoding  
been encoding enormous amounts of information in DNA for  
+
enormous amounts of information in DNA for billions of years.  
billions of years. By introducing a sequence into DNA of  
+
By introducing a sequence into DNA of bacterial spores, one of  
bacterial spores, one of the most resistant-to-harsh-conditions
+
the most durable and resilient forms of life,  
forms of life, "CryptoGERM" tries to combine storing  
+
"CryptoGE<sup>®</sup>M" tries to combine storing information and
information and transferring it in a safe way. The goal is to  
+
transferring it in a safe way. The goal is to safely send a key  
safely send a key and an encrypted message in two separate  
+
and an encrypted message in two separate spore systems of  
spore systems of Bacillus subtilis. Digital and biological  
+
<em>Bacillus subtilis</em>. Digital and biological protection layers
protection layers will prevent this information from being  
+
will prevent this information from being captured by
captured by unauthorized parties. The message is protected by  
+
unauthorized parties. The message is protected by computational
computational encryption, while the sensitive key can only be  
+
encryption, while the sensitive key can only be accessed from
accessed from the spores with the right growing conditions. For  
+
the spores with the right growing conditions. For example,  
example, light-switchable antibiotics have to be activated by  
+
light-switchable antibiotics have to be activated by the
the correct frequency of light. If the recipient fails, the  
+
correct frequency of light. If the recipient fails, the  
 
sequence will be destroyed and the message is lost forever.</p>
 
sequence will be destroyed and the message is lost forever.</p>
 
</div>
 
</div>
  
<div class="half-right img"><img src="https://static.igem.org/mediawiki/2016/0/0d/T--Groningen--logo-bacilli.png" alt="Bacilli" /></div>
+
<div class="right flone img centrate"><a class="img" href="/Team:Groningen/Tour"><img src="https://static.igem.org/mediawiki/2016/c/cc/T--Groningen--Bacilluscoupletour.png" alt="Bacilli" /></a></div>
 
</section>
 
</section>
 
<section>
 
<section>
 
<p class="centrate down-one">
 
<p class="centrate down-one">
<a class="biglink centrate bleu" href="/Team:Groningen/Tour">Take the Tour!</a>
+
<a class="biglink centrate bleu" href="/Team:Groningen/Tour">Take the Tour!</a> <span style="font-size: 2em">|</span>
 +
<a class="biglink centrate bleu" href="/Team:Groningen/Results">View our Results</a>
 
</p>
 
</p>
 +
</section>
 +
<hr />
 +
<section class="cycler centrate">
 +
<img class="active" src="https://static.igem.org/mediawiki/2016/5/5e/T--Groningen--Team-all-6-960.jpg" />
 +
<img class="base" src="https://static.igem.org/mediawiki/2016/5/5a/T--Groningen--Team-agar.jpg" />
 
</section>
 
</section>
 
</article>
 
</article>
 
</html>
 
</html>
 
{{Groningen/footer}}
 
{{Groningen/footer}}

Latest revision as of 00:23, 3 December 2016

CryptoGE®M
Team
Project
Biology
Computing
Human Practice
Acknowledgements

CryptoGE®M: Encode it, Keep it

The world's silicon supply won't be able to cover the demand for flash data storage by 2040. However, nature has been encoding enormous amounts of information in DNA for billions of years. By introducing a sequence into DNA of bacterial spores, one of the most durable and resilient forms of life, "CryptoGE®M" tries to combine storing information and transferring it in a safe way. The goal is to safely send a key and an encrypted message in two separate spore systems of Bacillus subtilis. Digital and biological protection layers will prevent this information from being captured by unauthorized parties. The message is protected by computational encryption, while the sensitive key can only be accessed from the spores with the right growing conditions. For example, light-switchable antibiotics have to be activated by the correct frequency of light. If the recipient fails, the sequence will be destroyed and the message is lost forever.

Bacilli

Take the Tour! | View our Results


Oop top