|
|
(18 intermediate revisions by 4 users not shown) |
Line 1: |
Line 1: |
| {{Groningen}} | | {{Groningen}} |
| <html> | | <html> |
| + | <!-- GACCAAGCCTGCAAAAGCAAACGGCAAACCTGACTGGACCAAAAAATCAGTAGTCCGAAGGTATAAACATCCGTGCGTAAGAAGCCATCCACTAAGTATTTAAGATTTGAAGTTGTCATATAGAGAAGGCATTAAGGGTTCACATAAGAGCTACACCTGAGAAGGCATCCAAGCACTGCATAAGTTATTCTCTTTCTGTCGAAGAAATGCAATAAGGAGTTAAGGCCTGAAGTAATTTGATAAGGGTTTAAGACTTTAAGACCTTAAGGCCTTAAGCGATTAAGAATTGGGAATAAAAAAATCCGGCGAAGGAATGCAATCTCCCAAGAAGGTCTGAAGTGATGAAGAGCTTAAGTACTGAAGTCTTGAAGAAATTAAGTCATAACCGAAGCATTCACAATCCGTACTAAGTTATTGTATAAAAAAACTAGAAGTTGTGAAGAAATTAAGTAATTAAGATAAAAAAACTGAAGCTATTAAGGTCTTCGCTAAGAGCTGAAGGCTTGAAGGTGAAAAAAATCGACTAAGGGGTGAAGACCTCGACGAAGTCGTTAAGAGTTGGGAGCACCCACCGAC --> |
| <article> | | <article> |
| <section class="split"> | | <section class="split"> |
| <div class="left flone"> | | <div class="left flone"> |
− | <h2>CryptoGE®M: Encode it, keep it</h2> | + | <h2>CryptoGE<sup>®</sup>M: Encode it, Keep it</h2> |
| | | |
| <p>The world's silicon supply won't be able to cover the demand | | <p>The world's silicon supply won't be able to cover the demand |
− | for data storage by 2040. However, nature has been encoding | + | for flash data storage by 2040. However, nature has been encoding |
| enormous amounts of information in DNA for billions of years. | | enormous amounts of information in DNA for billions of years. |
| By introducing a sequence into DNA of bacterial spores, one of | | By introducing a sequence into DNA of bacterial spores, one of |
− | the most resistant-to-harsh-conditions forms of life, | + | the most durable and resilient forms of life, |
− | "CryptoGERM" tries to combine storing information and | + | "CryptoGE<sup>®</sup>M" tries to combine storing information and |
| transferring it in a safe way. The goal is to safely send a key | | transferring it in a safe way. The goal is to safely send a key |
| and an encrypted message in two separate spore systems of | | and an encrypted message in two separate spore systems of |
− | Bacillus subtilis. Digital and biological protection layers | + | <em>Bacillus subtilis</em>. Digital and biological protection layers |
| will prevent this information from being captured by | | will prevent this information from being captured by |
| unauthorized parties. The message is protected by computational | | unauthorized parties. The message is protected by computational |
Line 24: |
Line 25: |
| </div> | | </div> |
| | | |
− | <div class="right flone img"><img src="https://static.igem.org/mediawiki/2016/0/0d/T--Groningen--logo-bacilli.png" alt="Bacilli" /></div> | + | <div class="right flone img centrate"><a class="img" href="/Team:Groningen/Tour"><img src="https://static.igem.org/mediawiki/2016/c/cc/T--Groningen--Bacilluscoupletour.png" alt="Bacilli" /></a></div> |
| </section> | | </section> |
| <section> | | <section> |
| <p class="centrate down-one"> | | <p class="centrate down-one"> |
− | <a class="biglink centrate bleu" href="/Team:Groningen/Tour">Take the Tour!</a> | + | <a class="biglink centrate bleu" href="/Team:Groningen/Tour">Take the Tour!</a> <span style="font-size: 2em">|</span> |
| + | <a class="biglink centrate bleu" href="/Team:Groningen/Results">View our Results</a> |
| </p> | | </p> |
| + | </section> |
| + | <hr /> |
| + | <section class="cycler centrate"> |
| + | <img class="active" src="https://static.igem.org/mediawiki/2016/5/5e/T--Groningen--Team-all-6-960.jpg" /> |
| + | <img class="base" src="https://static.igem.org/mediawiki/2016/5/5a/T--Groningen--Team-agar.jpg" /> |
| </section> | | </section> |
| </article> | | </article> |
| </html> | | </html> |
| {{Groningen/footer}} | | {{Groningen/footer}} |