|
|
| (31 intermediate revisions by 4 users not shown) |
| Line 1: |
Line 1: |
| | {{Groningen}} | | {{Groningen}} |
| | <html> | | <html> |
| − | <article class="columnize"> | + | <!-- GACCAAGCCTGCAAAAGCAAACGGCAAACCTGACTGGACCAAAAAATCAGTAGTCCGAAGGTATAAACATCCGTGCGTAAGAAGCCATCCACTAAGTATTTAAGATTTGAAGTTGTCATATAGAGAAGGCATTAAGGGTTCACATAAGAGCTACACCTGAGAAGGCATCCAAGCACTGCATAAGTTATTCTCTTTCTGTCGAAGAAATGCAATAAGGAGTTAAGGCCTGAAGTAATTTGATAAGGGTTTAAGACTTTAAGACCTTAAGGCCTTAAGCGATTAAGAATTGGGAATAAAAAAATCCGGCGAAGGAATGCAATCTCCCAAGAAGGTCTGAAGTGATGAAGAGCTTAAGTACTGAAGTCTTGAAGAAATTAAGTCATAACCGAAGCATTCACAATCCGTACTAAGTTATTGTATAAAAAAACTAGAAGTTGTGAAGAAATTAAGTAATTAAGATAAAAAAACTGAAGCTATTAAGGTCTTCGCTAAGAGCTGAAGGCTTGAAGGTGAAAAAAATCGACTAAGGGGTGAAGACCTCGACGAAGTCGTTAAGAGTTGGGAGCACCCACCGAC --> |
| − | <h2>Project summary</h2>
| + | <article> |
| − |
| + | <section class="split"> |
| − | <section>
| + | <div class="left flone"> |
| − | <h3>Protecting data through encryption and storage in bacterial spore DNA.</h3>
| + | <h2>CryptoGE<sup>®</sup>M: Encode it, Keep it</h2> |
| | + | |
| | + | <p>The world's silicon supply won't be able to cover the demand |
| | + | for flash data storage by 2040. However, nature has been encoding |
| | + | enormous amounts of information in DNA for billions of years. |
| | + | By introducing a sequence into DNA of bacterial spores, one of |
| | + | the most durable and resilient forms of life, |
| | + | "CryptoGE<sup>®</sup>M" tries to combine storing information and |
| | + | transferring it in a safe way. The goal is to safely send a key |
| | + | and an encrypted message in two separate spore systems of |
| | + | <em>Bacillus subtilis</em>. Digital and biological protection layers |
| | + | will prevent this information from being captured by |
| | + | unauthorized parties. The message is protected by computational |
| | + | encryption, while the sensitive key can only be accessed from |
| | + | the spores with the right growing conditions. For example, |
| | + | light-switchable antibiotics have to be activated by the |
| | + | correct frequency of light. If the recipient fails, the |
| | + | sequence will be destroyed and the message is lost forever.</p> |
| | + | </div> |
| | | | |
| − | <p>In 2002, the amount of information stored digitally had eclipsed | + | < div class=" right flone img centrate"><a class=" img" href="/ Team:Groningen/ Tour">< img src=" https:// static. igem. org/mediawiki/2016/c/ cc/T--Groningen-- Bacilluscoupletour.png" alt=" Bacilli" /></a></ div> |
| − | information stored in analog format for the first time <sup
| + | |
| − | id=" ref-1"><a href=" #cite-1" >[1]</a></sup>. Just five years later, | + | |
| − | only 6% of the world’s data was still analog <sup id="ref-1"><a
| + | |
| − | href="#cite-1">[1]</a></sup>. In 2015, an estimated
| + | |
| − | 2,500,000,000,000 megabytes of new data were created every day, and
| + | |
| − | this number is growing at an increasing rate <sup id="ref-1"><a
| + | |
| − | href="#cite-1">[1]</a></sup>. It is not surprising that data
| + | |
| − | breaches orchestrated by hackers are on the rise as well. Financial
| + | |
| − | and legal records, military and government documents, these are
| + | |
| − | examples of important information that must be preserved for a long
| + | |
| − | time, but could cause great damage in the wrong hands. We have
| + | |
| − | become a civilization dependent on information, and this
| + | |
| − | information must be stored somewhere. As a result, we are faced
| + | |
| − | with two problems: where do we store all of our data, and how do we
| + | |
| − | keep it safe?</p>
| + | |
| − | | + | |
| − | <p>Storage of data in DNA has been proposed as early as the 1960’s,
| + | |
| − | but has only recently become a hot topic <sup id="ref-2"><a
| + | |
| − | href="#cite-2">[2]</a></sup>. This is in part due to the
| + | |
| − | ever-growing demand for data storage, as well as advancements in
| + | |
| − | DNA synthesis and sequencing technologies. Our goal is to create a
| + | |
| − | system for long-term data storage and data transfer which cannot be
| + | |
| − | hacked by digital means. Digital methods of encrypting information
| + | |
| − | and converting it into binary code are well established, and data
| + | |
| − | storage in DNA has already been demonstrated. Our project combines
| + | |
| − | these two approaches by first converting information into binary
| + | |
| − | code, encrypting it, and then storing it safely in DNA. Additional
| + | |
| − | measures based on molecular biology will prevent unauthorized
| + | |
| − | access, ensuring the safety of the stored information. </p>
| + | |
| − | | + | |
| − | <p>Our system will be useful for the kind of information that
| + | |
| − | should be stored and transferred in a very secure manner, but does
| + | |
| − | not have to be accessed quickly (within seconds). It will be
| + | |
| − | possible to obtain the message in about 24-48 hours, however, this
| + | |
| − | timeframe is likely to be reduced as new sequencing technologies
| + | |
| − | are developed. For example, this system could be used to store
| + | |
| − | patent and prototype information, genealogical records, legal and
| + | |
| − | financial records, banking account details, login data or even top
| + | |
| − | secret government documents. Given the stability and compactness of
| + | |
| − | DNA, our system could also be adapted to serve as a time capsule
| + | |
| − | for human knowledge.</p>
| + | |
| | </section> | | </section> |
| − | | + | <section> |
| − | <section> | + | <p class="centrate down-one"> |
| − | <h3>Advantages of data storage in spore DNA</h3> | + | <a class="biglink centrate bleu" href="/Team:Groningen/Tour">Take the Tour!</a> <span style="font-size: 2em">|</span> |
| − | | + | <a class="biglink centrate bleu" href="/Team:Groningen/Results">View our Results</a> |
| − | <ul>
| + | </p> |
| − | <li>DNA is a far more stable data storage medium compared to
| + | |
| − | magnetic and optical media, remaining intact for at least
| + | |
| − | 700,000 years at -4°C <sup id="ref-4"><a
| + | |
| − | href="#cite-4">[4]</a></sup>. Even in harsh environments, DNA | + | |
| − | has a half-life of over 500 years <sup id="ref-5"><a
| + | |
| − | href="#cite-5">[5]</a></sup>. In contrast, current storage
| + | |
| − | technology lasts only up to 30 years <sup id="ref-6"><a
| + | |
| − | href="#cite-6">[6]</a></sup>.</li>
| + | |
| − |
| + | |
| − | <li>Spores are extremely resistant to aging, radiation, heat,
| + | |
| − | and chemical damage. A viable spore-forming Bacillus strain was
| + | |
| − | isolated from 250 million year old salt crystals <sup
| + | |
| − | id="ref-7"><a href="#cite-7">[7]</a></sup>.</li>
| + | |
| − |
| + | |
| − | <li>The densest data storage medium commercially available | + | |
| − | today can hold up to 10 GB/mm<sup>3</sup>. DNA has a data
| + | |
| − | storage density of up to 109 GB/mm<sup>3</sup>, 8 orders of
| + | |
| − | magnitude higher. <sup id="ref-6"><a
| + | |
| − | href="#cite-6">[6]</a></sup></li>
| + | |
| − |
| + | |
| − | <li>Conservative estimates predict that based on global memory
| + | |
| − | demand, the amount of silicon (required for flash memory) is
| + | |
| − | expected to exceed silicon supply by 2040. <sup id="ref-8"><a
| + | |
| − | href="#cite-8">[8]</a></sup></li>
| + | |
| − |
| + | |
| − | <li>DNA storage will soon become a cheaper alternative for data
| + | |
| − | storage as DNA synthesis and sequencing costs drop. It is
| + | |
| − | estimated to become a cost-effective method for long-term data
| + | |
| − | storage within approximately ten years <sup id="ref-9"><a
| + | |
| − | href="#cite-9">[9]</a></sup>.</li>
| + | |
| − |
| + | |
| − | <li>Data storage in DNA is more environmentally friendly than
| + | |
| − | currently used digital data storage. In 2015, 416.2 terawatt
| + | |
| − | hours of electricity were used by data centers worldwide. This
| + | |
| − | is higher than the annual power consumption of the entire
| + | |
| − | UK<sup id="ref-10"><a href="#cite-10">[10]</a></sup>, and is
| + | |
| − | responsible for approximately 2% of global greenhouse
| + | |
| − | emissions, rivalling the airline industry <sup id="ref-11"><a
| + | |
| − | href="#cite-11">[11]</a></sup>. </li>
| + | |
| − |
| + | |
| − | <li>Data stored in DNA cannot be hacked by digital means.</li>
| + | |
| − |
| + | |
| − | <li>DNA data storage is an apocalypse-proof technology because
| + | |
| − | DNA will be relevant to future civilizations. As long as
| + | |
| − | intelligent DNA-based life exists, there will be compelling
| + | |
| − | reasons to study and manipulate DNA.</li>
| + | |
| − | </ul> | + | |
| | </section> | | </section> |
| − | | + | <hr /> |
| − | <section>
| + | <section class="cycler centrate"> |
| − | <h3>Our approach</h3>
| + | <img class="active" src="https://static.igem.org/mediawiki/2016/5/5e/T--Groningen--Team-all-6-960.jpg" /> |
| − | | + | <img class="base" src="https://static.igem.org/mediawiki/2016/5/5a/T--Groningen--Team-agar.jpg" /> |
| − | <p><em>Security through layers.</em></p>
| + | |
| − | | + | |
| − | <p>We use a layered approach with a combination of digital and
| + | |
| − | biological security measures to ensure the information can only be
| + | |
| − | accessed by the intended recipient. The first layer is digital
| + | |
| − | encryption. The information is encrypted with the Advanced
| + | |
| − | Encryption Standard (AES) algorithm, converted into a DNA sequence
| + | |
| − | and integrated in the genomic DNA of Bacillus subtilis, a safe,
| + | |
| − | thoroughly categorized organism capable of sporulation. The binary
| + | |
| − | data obtained after encryption will be encoded into DNA according
| + | |
| − | to the following logic: since DNA consists of four nucleotides
| + | |
| − | namely T, A, C, and G, every nucleotide will represent a binary
| + | |
| − | pair (combination of a 0 and a 1). The T will be represented as 01,
| + | |
| − | A as 10, C as 00 and G as 11. The decryption key and the encrypted
| + | |
| − | message are integrated into two different Bacillus strains and are
| + | |
| − | protected from unauthorized access with additional security
| + | |
| − | layers.</p>
| + | |
| − | | + | |
| − | <p>Once the message and key are encoded in Bacillus DNA, the cells
| + | |
| − | are cultured in a sporulation-promoting medium. Bacterial spores
| + | |
| − | are among the most resistant biological entities currently known,
| + | |
| − | and thus represent an ideal substrate for long-term data storage.
| + | |
| − | The spores containing the encrypted message and key are
| + | |
| − | freeze-dried and embedded in separate filter papers (or any other
| + | |
| − | porous material) for storage and transfer, along with a
| + | |
| − | spiropyran-ciprofloxacin conjugate <sup id="ref-3"><a
| + | |
| − | href="#cite-3">[3]</a></sup>. The biological activity of this | + | |
| − | photoswitchable antibiotic is very low when the spiropyran
| + | |
| − | photoswitch is in its stable closed form, but increases
| + | |
| − | dramatically after irradiation with a specific wavelength of light
| + | |
| − | (in our case, 365 nm) which brings the photoswitch into a less
| + | |
| − | stable, open form. When the light source is removed, the compound
| + | |
| − | slowly reverts back to its biologically inactive state. Irradiation
| + | |
| − | with other wavelengths also results in deactivation. The strains
| + | |
| − | carrying the message and key (which possess resistance to the
| + | |
| − | antibiotic) are mixed with numerous decoy spores when brought onto
| + | |
| − | the carrier material. The decoy spores are not resistant, and do
| + | |
| − | not contain any encrypted information.</p>
| + | |
| − | | + | |
| − | <p>When the intended recipients want to access the stored data,
| + | |
| − | they place the filter paper with key carrying spores and antibiotic
| + | |
| − | in a culture medium, and irradiate it with the activating
| + | |
| − | wavelength of light. This wavelength must be known by the recipient
| + | |
| − | beforehand. The activated antibiotic kills the decoys but not our
| + | |
| − | key carrying strain. After culturing, their DNA is sequenced and
| + | |
| − | the key is found. The key contains information necessary to culture
| + | |
| − | the message carrying strain, and to decrypt the message. Without
| + | |
| − | activation, all the spores germinate and grow, including the
| + | |
| − | decoys. This makes it impossible to find the key by sequencing.
| + | |
| − | Once the key is obtained, the message carrying strain can be
| + | |
| − | cultured. Their DNA is then sequenced and the message can be
| + | |
| − | decrypted.</p>
| + | |
| − | </section>
| + | |
| − | | + | |
| − | <section>
| + | |
| − | <h3>Sources</h3>
| + | |
| − | | + | |
| − | <ul>
| + | |
| − | <li id="cite-1"><a href="#ref-1">[1]</a> World’s shift from analog to digital is nearly complete — <a href=" http://www.nbcnews.com/id/41516959/ns/technology_and_science-innovation/t/worlds-shift-analog-digital-nearly-complete/#.V3J0cvmLTcs">NBC news</a></li>
| + | |
| − | | + | |
| − | <li id="cite-2"><a href="#ref-2">[2]</a> Some fundamental issues of microminiaturization — Radiotekhnika, 1964, No. 1, pp. 3-12</li>
| + | |
| − | | + | |
| − | <li id="cite-3"><a href="#ref-3">[3]</a> Ciprofloxacin−Photoswitch Conjugates: A Facile Strategy for Photopharmacology — Bioconjugate Chem. 2015, 26, 2592−2597 DOI: 10.1021/acs.bioconjchem.5b00591</li>
| + | |
| − | | + | |
| − | <li id="cite-4"><a href="#ref-4">[4]</a> Ancient DNA: Towards a million-year-old genome — Nature 499, 34–35 (04 July 2013) DOI:10.1038/nature12263</li>
| + | |
| − | | + | |
| − | <li id="cite-5"><a href="#ref-5">[5]</a> The half-life of DNA in bone: measuring decay kinetics in 158 dated fossils — Proc Biol Sci. 2012 Dec 7;279(1748):4724-33 DOI: 10.1098/rspb.2012.1745</li>
| + | |
| − | | + | |
| − | <li id="cite-6"><a href="#ref-6">[6]</a> A DNA-Based Archival Storage System — <a href="http://dx.doi.org/10.1145/2872362.2">ASPLOS 2016 DOI</a></li>
| + | |
| − | | + | |
| − | <li id="cite-7"><a href="#ref-7">[7]</a> Isolation of a 250 million-year-old halotolerant bacterium from a primary salt crystal— Nature 407, 897-900 (19 October 2000) DOI:10.1038/35038060</li>
| + | |
| − | | + | |
| − | <li id="cite-8"><a href="#ref-8">[8]</a> Nucleic Acid Memory — Nature Materials 15, 366–370 (2016) DOI:10.1038/nmat4594</li>
| + | |
| − | | + | |
| − | <li id="cite-9"><a href="#ref-9">[9]</a> Synthetic double-helix faithfully stores Shakespeare's sonnets — Nature DOI:10.1038/nature.2013.12279</li>
| + | |
| − | | + | |
| − | <li id="cite-10"><a href="#ref-10">[10]</a> Global warming: Data centres to consume three times as much energy in next decade, experts warn. — <a href="http://www.independent.co.uk/environment/global-warming-data-centres-to-consume-three-times-as-much-energy-in-next-decade-experts-warn-a6830086.html">The Independent</a></li>
| + | |
| − | | + | |
| − | <li id="cite-11"><a href="#ref-11">[11]</a> GeSI SMARTer 2020: The Role of ICT in Driving a Sustainable Future — <a href="http://gesi.org/assets/js/lib/tinymce/jscripts/tiny_mce/plugins/ajaxfilemanager/uploaded/SMARTer2020-report.pdf">GeSI</a></li>
| + | |
| − | </ul>
| + | |
| | </section> | | </section> |
| | </article> | | </article> |
| | </html> | | </html> |
| | {{Groningen/footer}} | | {{Groningen/footer}} |
