Difference between revisions of "Team:Groningen/Attributions"

(Prototype team page)
 
 
(36 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
{{Groningen}}
 
{{Groningen}}
 
<html>
 
<html>
−
 
+
<!-- GACCAAGCCTGCAAAACCAAACTTATAAATCATTGGTAAGTCATGAAAGAAGTCATGGCATAAGTAGTAGACCTACATCCTAAGTAGTGAAGAATTATGCTAAGTTCTGAAGAGATAACAGAAGCGGTGAGCGAAGACATTAAGTCATTAAGTATTGAAGTAATGAAGTCTTTAAGGTATGAAGAGATTAAGGCCTGTCCTAAGACTTGAAGCAGTGAAGCAATATTCTCACGAAGGTATTAAGCCTTTCGCTCGCGAAGAGATGAAGCGTTTAAGGATTTGCCCTACGAAGGCTTCTTATAAGCCATACTATTTAGAAGGTGTGAAGTAGTGAAGGTGTTAAGGATTTAAGATTTGAAGCCATGAAGGAGTAATCTGGCATACCAGCGAAGAAGTGAAGCCCTTAAGACTTCCGCTAAGGCCTGAAGAGCTGAAGATTTCCCATAAGCCGTCAACAGGCCTACGGGAGAAGAATTGTCATTAAGAAGCGGTGTCAGAGCTAAATAGATAAGAAGTAAACTAAGAGGTTAAGGACTTAAGGAGTTAAGGGATTTCAAGCATAAGTGTTGAAAGAAGCCCTTAAGGACTGCACAAACTCTCGAAGAGTTTAGAGAAGCGATGAAGAGATTAACTAAGATATTTTCTCACTAAGGGCTGAGACCAATAAGAATTGGACGAAGACATGGAATAAGATGTTAGAGAAGGCGTACACGAAGACTTGAAGCTATTGGCGACACCGCCTGCATACTATCCCCCCTACTTTCTTCCTTACTTCATACATAAGGCCTGAAGTTATTAACGATCGATCTAAGGCCTGTTAGATATAAGACTTTAAGGCATCTAAAACATAAGCCGTTAAGTCTTGAAGCAATGAAGTAATCTTCGAAGCTATTAAGTGTTTAAGAAATGGTAGAAGCCCTGCCCGAAGATGTAACATATAACGAGAAGCGATCTTCTAAGTGCTCGACGAGAGAAGCGATGAAGTCTTGCTATAAGCTATGCCCAGTATAAGCCATGTTATAAGATTTTAAGTAATTTGATTTCTCCCTAAGAGCTGTGAGAGACAGCGAAGGCGTGGGATAAGGGTTCTACTAAGGGGTTACCGAAGCTATCTCACTGCGAAGTTCTGAAGAAAAACTTTGTCCTCAAGAAGCGGTGAAGTTGTAGGCTCTCGAAGAACTAACAGAAGAAAAACTTTCAGCTGCCGAAGACGTTAAGTTTTTAAGCTATTAAGCACTTAAGCGATTAAGGTTTTAAGAAATAGACTTCAACGAGAAATAAGCGTTGAAGCCCTGAGCTAAGGACTAGAAATGACTCCGAAGCATTTAAGCACTACAACTGCATGCTAAGACCTATCAAACACGCAGATAAAAACTGTAAAAACTAGATAAGATGTTAAGCAATTCACGAAGAAAAACTTTACACGACCGAAGCCCTTAAGTAGTATGACTCCTGTAACACGAAGTTGTATCATAAGGGATATTCGAAGACCTGAAGACGTGAAGGTCTGAAGACCTATTCATAAGAAGGCGTTAAGACCTGAAGCCCTGAACGAAGATAAAAACTGAAGTAGTGAAGCACTATCCGAAGACTTACACTAAGATATGAAGCCATAGGCTAAGCGGTGGCCAGGATAAGGGATGAAGCGCTAACCGAAGGAGTGAAGTTCTCAGATTTCGACCGATATAAGCAGTCGGCTAAGGCTTGAAGTCGTTAAGAATTGAAGGCCTGAAGACTTGAAGTTTTCGGCCATATAAGTAATGCCCTAAGGACTCGCCACCATAAGATTTGCGCTACATTGCGACACCACATCCTAAGCTCTTAAGACCTGAAGGCATAGAAATGCTAAGCGGAAAAATCGACGAAGTCCTATACTAAGACGTTAAGTTTTGTAATAAGGACTTATCTGGCGAAGAGCTACTAGAAGGTATGAAGCCTTCCCAGAAGTGCTTAAGGATTTTCCACCAGCCACACACATAGAAGTGGTTCGAGCTATTTCGAAGAGATAGGCTAAGAACTCTGCGAAGGTATGAAGGCCTTAGCTAGCTAAGCCGTTAAGTATTTAAGAGTTCAACAGCAGAAGTCGTTAAGGTGTCGTCAATCAACCGTCCCATCTAAGGAATAAAAATCACTCGATAAGATTTTAAGGACTGAAGCGTTACACTAAGGAATGAAGTCATTCAAGAAGTGGTGAAGTTATGGACTAAGGTGTCCCATAAGACATGAAGCGGTTAAGCACTGAAGGAGTGAAGATAAAAACTTAAGAGCTTAAGCAATTAAGACATGAAGTGTTGCACCCACCGAC -->
−
 
+
<article>
−
<div class="column full_size judges-will-not-evaluate">
+
<section>
−
<h3>★  ALERT! </h3>
+
<h2>Attributions</h2>
−
<p>This page is used by the judges to evaluate your team for the <a href="https://2016.igem.org/Judging/Medals">Attributions bronze criterion</a>. </p>
+
−
 
+
<p>In addition to the financial &amp; material support from our <a  
−
 
+
href="/Team:Groningen/Sponsors">sponsors</a>, and the invaluable coaching from our <a href="/Team:Groningen/Supervisors">supervisors</a>, we also had help from
−
 
+
the following people and organisations, and would like to thank
−
<p> Delete this box in order to be evaluated for this medal. See more information at <a href="https://2016.igem.org/Judging/Pages_for_Awards/Instructions"> Instructions for Pages for awards</a>.</p>
+
them.</p>
−
</div>
+
</section>
−
 
+
−
 
+
<section>
−
 
+
<h3>Artwork</h3>
−
 
+
−
 
+
<p>All of the CryptoGErM art was made by Kathinka, except for the logo, which was made by Daniel, based on an original design by Mareike. In
−
 
+
addition to their works we also used some of the icons and other
−
 
+
work made by these people:</p>
−
 
+
−
<div class="column full_size">
+
<div class="split">
−
 
+
<ul class="left flone">
−
 
+
<li><strong>Yazzer Perez</strong> from the Noun Project: <a href="https://thenounproject.com/term/teamwork/56376/">teamwork</a> icon.</li>
−
<p> Each team must clearly attribute work done by the student team members on this page. The team must distinguish work done by the students from work done by others, including the host labs, advisors, instructors, and individuals not on the team roster. </p>
+
<li><strong>Eunji Kang</strong> from the Noun Project: <a href="https://thenounproject.com/term/connection/205723/">connection</a> icon.</li>
−
 
+
<li><strong>Vítor Carvalho</strong> from the Noun Project: <a href="https://thenounproject.com/term/software-engineering/532299/">software engineering</a> icon.</li>
−
</div>
+
<li><strong>creative outlet</strong> from the Noun Project: <a href="https://thenounproject.com/term/idea-setting/621024/">Idea settings</a> icon.</li>
−
 
+
<li><strong>Flaticon/Freepik</strong>: <a href="http://www.freepik.com/free-icon/toolbox_739382.htm">Toolbox</a> icon.</li>
−
 
+
<li><strong>Lloyd Humphreys</strong> from the Noun Project: <a href="https://thenounproject.com/term/dna/96527/">DNA</a> icon</li>
−
<div class="clear"></div>
+
<li><strong>Carla Dias</strong> from the Noun Project: <a href="https://thenounproject.com/term/scissors/546113/">Scissors</a> icon</li>
−
 
+
<li><strong>bilel djettaou</strong> from the Noun Project: <a href="https://thenounproject.com/term/petri/649730/">Petri</a> icon</li>
−
 
+
<li><strong>lipi</strong> from the Noun Project: <a href="https://thenounproject.com/term/validation/583783/">Check Mark</a> icon</li>
−
<div class="column half_size">
+
<li><strong>Anthony Bossard</strong> from the Noun Project: <a href="https://thenounproject.com/term/erlenmeyer/367441/">Erlenmeyer Flask</a> icon</li>
−
<h5> Why is this page needed? </h5>
+
−
<p>The Attribution requirement helps the judges know what you did yourselves and what you had help with. We don't mind if you get help with difficult or complex techniques, but you must report what work your team did and what work was done by others.</p>
+
−
<p>
+
−
For example, you might choose to work with an animal model during your project. Working with animals requires getting a license and applying far in advance to conduct certain experiments in many countries. This is difficult to achieve during the course of a summer, but much easier if you can work with a postdoc or PI who has the right licenses.</p>
+
−
</div>
+
−
 
+
−
 
+
−
<div class="column half_size">
+
−
<h5> What should this page have?</h5>
+
−
 
+
−
<ul>
+
−
<li>General Support</li>
+
−
<li>Project support and advice</li>
+
−
<li>Fundraising help and advice</li>
+
−
<li>Lab support</li>
+
−
<li>Difficult technique support</li>
+
−
<li>Project advisor support</li>
+
−
<li>Wiki support</li>
+
−
<li>Presentation coaching</li>
+
−
<li>Human Practices support</li>
+
−
<li> Thanks and acknowledgements for all other people involved in helping make a successful iGEM team</li>
+
 
</ul>
 
</ul>
 +
<ul class="right flone">
 +
<li><strong>To Uyen</strong> from the Noun Project: <a href="https://thenounproject.com/term/up/445288/">up</a> icon</li>
 +
<li><strong>Nikita Sokolov</strong> from the Noun Project: <a href="https://thenounproject.com/term/plus/669265">plus</a> and <a href="https://thenounproject.com/term/minus/669266">minus</a> icons</li>
 +
<li><strong>Grant Taylor Sizemore</strong> from the Noun Project: <a href="https://thenounproject.com/term/safety-goggles/164945/">Safety Goggle</a> icon</li>
 +
<li><strong>James Keuning</strong> from the Noun Project: <a href="https://thenounproject.com/jmkeuning/collection/careers/?i=10278">Lab Coat</a> icon</li>
 +
<li><strong>Gan Khoon Lay</strong> from the Noun Project: <a href="https://thenounproject.com/leremy/collection/forbidden-sign/?i=621063">Forbidden Food</a> icon</li>
 +
<li><strong>Carlos Dias</strong> from the Noun Project: <a href="https://thenounproject.com/term/wash-hands/74973/">Hand Washing</a> icon</li>
 +
<li><strong>Bluetip Design</strong> from the Noun Project: <a href="https://thenounproject.com/term/Checked/334313/">Checked</a> icon</li>
 +
<li><strong>Inka Mahlandt</strong> for editing the videos made in the lab</li>
 +
<li><strong>Justin Knight</strong> and the iGEM Foundation for the iGEM Giant Jamboree photos</li>
 +
</ul>
 
</div>
 
</div>
 +
</section>
 +
 +
<section>
 +
<h3>Computing &amp; Modelling</h3>
 +
 +
<p>Most of the modelling in CryptoGErM was done by Matthia, with some help from Carlos; the
 +
software &amp; wiki were built by Marco, with help from Luis, Bara
 +
and Mareike. For these parts we had help from the following
 +
people:</p>
 +
 +
<ul>
 +
<li><strong>Chris Veness</strong>: <a href="http://www.movable-type.co.uk/scripts/aes.html">AES in Javascript</a>.</li>
 +
<li><strong>chitchcock</strong>: <a href="https://gist.github.com/chitchcock/5112270">CRC16-CCITT in Javascript</a>.</li>
 +
<li><strong>Jos Roerdink</strong>: feedback on the modelling</li>
 +
<li><strong>Bayu Jayawardhana</strong>: inspiration for the modelling</li>
 +
</ul>
 +
</section>
 +
 +
<section>
 +
<h3>Human Practices &amp; Safety</h3>
 +
 +
<p>Human practices was managed by Luis and Bente with help from
 +
Kathinka, Ilona, Mareike and these people and organisations:</p>
 +
 +
<ul>
 +
<li><strong>G. van Willingen</strong>: Coordinating Senior
 +
Advisor CBRN Safety and Security, Biosafety Officer and
 +
Environmental Safety Officer of Leiden Universital Medical
 +
Centre (LUMC)</li>
 +
 +
<li><strong>National Cyber Security Center</strong> for
 +
the comments received during the development of the project;
 +
such comments were really helpful for our project.</li>
 +
 +
<li><strong>JaapJan Hoogstins</strong>: collection manager
 +
from the Groninger Archieven for the facilities and the
 +
interview given to CryptoGErM. It was really helpful for the
 +
development and execution of our project!</li>
 +
 +
<li><strong>C.J.B. van der Vlugt-Bergmans</strong> from
 +
the National Institute for Public Health and the Environment
 +
(RIVM) for the orientation in the current regulations for
 +
Genetically Modified Bacteria (GMO)</li>
 +
 +
<li><strong>Diana Flores Flores</strong>, for her feedback in
 +
the elaboration of our survey</li>
 +
</ul>
 +
</section>
 +
 +
<section>
 +
<h3>Lab</h3>
 +
 +
<p>Eike, Daniel, Bara, Sambit, Mareike, Ilona, Bente and Carlos were working in the lab. We wish to thank the following
 +
people for sharing their knowledge and support.</p>
 +
 +
<ul>
 +
<li><strong>Ben L. Feringa, Mickel J. Hansen, Michael M. Lerch,
 +
Wiktor Szymanski and the rest of Synthetic Organic Chemistry
 +
group</strong> for supplying us with spirofloxacin and for
 +
their chemical expertise.</li>
 +
 +
<li><strong>Jan-Willem Veening</strong> for his feedback</li>
 +
 +
<li><strong>Jan Kiel and Ger Telkamp</strong> for helping us
 +
obtain all the necessary equipment</li>
 +
 +
<li><strong>Luiza Morawska</strong> for tips and tricks on how
 +
to work with <em>Bacillus subtilis</em> and the pDR111
 +
plasmid</li>
  
 +
<li><strong>Ard Jan Grimbergen</strong> for showing us how the
 +
plate reader works</li>
 +
 +
<li><strong>Lance Keller</strong> for a very short introduction
 +
to FACS data analysis </li>
  
−
<div class="clear"></div>
+
                                <li><strong>The janitors</strong> for rescuing the spores out of the broken centrifuge</li>
 +
 +
<li><strong>MolGen</strong></li>
  
−
<div class="column half_size">
+
</ul>
−
 
+
</section>
−
<div class="highlight">
+
−
<h5> Can we base our project on a previous one? </h5>
+
<section>
−
<p>Yes! You can have a project based on a previous team, or based on someone else's idea, <b>as long as you state this fact very clearly and give credit for the original project.</b> </p>
+
<h3>General thanks</h3>
−
</div>
+
−
</div>
+
<ul>
−
 
+
<li><strong>Yue Sun</strong> withdrew from our team during the
−
 
+
summer. We thank her for her contributions to the project.</li>
−
<div class="column half_size">
+
<li><strong>Peter Rauch</strong> for moral support</li>
−
 
+
                                <li><strong>Erik Sikkema</strong> for supervising Ilona's internship</li>
−
<h5>Inspiration</h5>
+
<li><strong>Marco Wiering</strong> for spiritual support and inspiration</li>
−
<p>Take a look at what other teams have done:</p>
+
<li><strong>Gordon Freeman</strong></li>
−
<ul>
+
                                <li><strong>Marc van der Maarel</strong> for presentation coaching</li>
−
<li><a href="https://2011.igem.org/Team:Imperial_College_London/Team">2011 Imperial College London</a> (scroll to the bottom)</li>
+
<li><strong>StackOverflow</strong></li>
−
<li><a href="https://2014.igem.org/Team:Exeter/Attributions">2014 Exeter </a></li>
+
<li><strong>ImageMagick &amp; FFmpeg</strong> for everything with audio and video</li>
−
<li><a href="https://2014.igem.org/Team:Melbourne/Attributions">2014 Melbourne </a></li>
+
<li><strong>The guy down the hall</strong> for <em>always</em> being there</li>
−
<li><a href="https://2014.igem.org/Team:Valencia_Biocampus/Attributions">2014 Valencia Biocampus</a></li>
+
<li><strong>Mom &amp; dad</strong></li>
−
</ul>
+
</ul>
−
 
+
</section>
−
</div>
+
−
 
+
<section class="centrate">
−
<div class="clear"></div>
+
<img src="https://static.igem.org/mediawiki/2016/thumb/0/08/T--Groningen--Attributions-thanks-collabara.jpg/800px-T--Groningen--Attributions-thanks-collabara.jpg" />
−
 
+
</section>
−
<div class="column half_size">
+
</article>
−
 
+
−
<h5>Team training and Project start</h5>
+
−
<p>Tell us if your institution teaches an iGEM or synthetic biology class and when you started your project:</p>
+
−
<ul>
+
−
<li>Does your institution teach an iGEM or synthetic biology course?</li>
+
−
<li>When did you start this course?</li>
+
−
<li>Are the syllabus and course materials freely available online?</li>
+
−
<li>When did you start your brainstorming?</li>
+
−
<li>When did you start in the lab?</li>
+
−
<li>When did you start working on  your project?</li>
+
−
 
+
−
</ul>
+
−
 
+
−
</div>
+
−
 
+
−
 
+
−
 
+
−
 
+
−
</div>
+
 
</html>
 
</html>
 +
{{Groningen/footer}}

Latest revision as of 12:06, 8 December 2016

CryptoGE®M
CryptoGE®M
Team
Team
Members Supervisors Collaborations Achievements Contact
Project
Project
Tour Description Design Results Demonstrate Applications Future Notebook
Biology
Biology
Experiments Parts Safety Lab journal
Computing
Computing
Modelling Software Encoding Decoding
Human Practice
Human Practices
Human Practices Gold Silver
Acknowledgements
Support
Sponsors Attributions

Attributions

In addition to the financial & material support from our sponsors, and the invaluable coaching from our supervisors, we also had help from the following people and organisations, and would like to thank them.

Artwork

All of the CryptoGErM art was made by Kathinka, except for the logo, which was made by Daniel, based on an original design by Mareike. In addition to their works we also used some of the icons and other work made by these people:

  • Yazzer Perez from the Noun Project: teamwork icon.
  • Eunji Kang from the Noun Project: connection icon.
  • Vítor Carvalho from the Noun Project: software engineering icon.
  • creative outlet from the Noun Project: Idea settings icon.
  • Flaticon/Freepik: Toolbox icon.
  • Lloyd Humphreys from the Noun Project: DNA icon
  • Carla Dias from the Noun Project: Scissors icon
  • bilel djettaou from the Noun Project: Petri icon
  • lipi from the Noun Project: Check Mark icon
  • Anthony Bossard from the Noun Project: Erlenmeyer Flask icon
  • To Uyen from the Noun Project: up icon
  • Nikita Sokolov from the Noun Project: plus and minus icons
  • Grant Taylor Sizemore from the Noun Project: Safety Goggle icon
  • James Keuning from the Noun Project: Lab Coat icon
  • Gan Khoon Lay from the Noun Project: Forbidden Food icon
  • Carlos Dias from the Noun Project: Hand Washing icon
  • Bluetip Design from the Noun Project: Checked icon
  • Inka Mahlandt for editing the videos made in the lab
  • Justin Knight and the iGEM Foundation for the iGEM Giant Jamboree photos

Computing & Modelling

Most of the modelling in CryptoGErM was done by Matthia, with some help from Carlos; the software & wiki were built by Marco, with help from Luis, Bara and Mareike. For these parts we had help from the following people:

Human Practices & Safety

Human practices was managed by Luis and Bente with help from Kathinka, Ilona, Mareike and these people and organisations:

  • G. van Willingen: Coordinating Senior Advisor CBRN Safety and Security, Biosafety Officer and Environmental Safety Officer of Leiden Universital Medical Centre (LUMC)
  • National Cyber Security Center for the comments received during the development of the project; such comments were really helpful for our project.
  • JaapJan Hoogstins: collection manager from the Groninger Archieven for the facilities and the interview given to CryptoGErM. It was really helpful for the development and execution of our project!
  • C.J.B. van der Vlugt-Bergmans from the National Institute for Public Health and the Environment (RIVM) for the orientation in the current regulations for Genetically Modified Bacteria (GMO)
  • Diana Flores Flores, for her feedback in the elaboration of our survey

Lab

Eike, Daniel, Bara, Sambit, Mareike, Ilona, Bente and Carlos were working in the lab. We wish to thank the following people for sharing their knowledge and support.

  • Ben L. Feringa, Mickel J. Hansen, Michael M. Lerch, Wiktor Szymanski and the rest of Synthetic Organic Chemistry group for supplying us with spirofloxacin and for their chemical expertise.
  • Jan-Willem Veening for his feedback
  • Jan Kiel and Ger Telkamp for helping us obtain all the necessary equipment
  • Luiza Morawska for tips and tricks on how to work with Bacillus subtilis and the pDR111 plasmid
  • Ard Jan Grimbergen for showing us how the plate reader works
  • Lance Keller for a very short introduction to FACS data analysis
  • The janitors for rescuing the spores out of the broken centrifuge
  • MolGen

General thanks

  • Yue Sun withdrew from our team during the summer. We thank her for her contributions to the project.
  • Peter Rauch for moral support
  • Erik Sikkema for supervising Ilona's internship
  • Marco Wiering for spiritual support and inspiration
  • Gordon Freeman
  • Marc van der Maarel for presentation coaching
  • StackOverflow
  • ImageMagick & FFmpeg for everything with audio and video
  • The guy down the hall for always being there
  • Mom & dad
Oop top
Team
Project
Biology
Modelling
Computing
Human Practices
Support