|
|
(33 intermediate revisions by 6 users not shown) |
Line 1: |
Line 1: |
| {{Groningen}} | | {{Groningen}} |
| <html> | | <html> |
| + | <!-- GACCAAGCCTGCAAAACCAAACTTATAAATCATTGGTAAGTCATGAAAGAAGTCATGGCATAAGTAGTAGACCTACATCCTAAGTAGTGAAGAATTATGCTAAGTTCTGAAGAGATAACAGAAGCGGTGAGCGAAGACATTAAGTCATTAAGTATTGAAGTAATGAAGTCTTTAAGGTATGAAGAGATTAAGGCCTGTCCTAAGACTTGAAGCAGTGAAGCAATATTCTCACGAAGGTATTAAGCCTTTCGCTCGCGAAGAGATGAAGCGTTTAAGGATTTGCCCTACGAAGGCTTCTTATAAGCCATACTATTTAGAAGGTGTGAAGTAGTGAAGGTGTTAAGGATTTAAGATTTGAAGCCATGAAGGAGTAATCTGGCATACCAGCGAAGAAGTGAAGCCCTTAAGACTTCCGCTAAGGCCTGAAGAGCTGAAGATTTCCCATAAGCCGTCAACAGGCCTACGGGAGAAGAATTGTCATTAAGAAGCGGTGTCAGAGCTAAATAGATAAGAAGTAAACTAAGAGGTTAAGGACTTAAGGAGTTAAGGGATTTCAAGCATAAGTGTTGAAAGAAGCCCTTAAGGACTGCACAAACTCTCGAAGAGTTTAGAGAAGCGATGAAGAGATTAACTAAGATATTTTCTCACTAAGGGCTGAGACCAATAAGAATTGGACGAAGACATGGAATAAGATGTTAGAGAAGGCGTACACGAAGACTTGAAGCTATTGGCGACACCGCCTGCATACTATCCCCCCTACTTTCTTCCTTACTTCATACATAAGGCCTGAAGTTATTAACGATCGATCTAAGGCCTGTTAGATATAAGACTTTAAGGCATCTAAAACATAAGCCGTTAAGTCTTGAAGCAATGAAGTAATCTTCGAAGCTATTAAGTGTTTAAGAAATGGTAGAAGCCCTGCCCGAAGATGTAACATATAACGAGAAGCGATCTTCTAAGTGCTCGACGAGAGAAGCGATGAAGTCTTGCTATAAGCTATGCCCAGTATAAGCCATGTTATAAGATTTTAAGTAATTTGATTTCTCCCTAAGAGCTGTGAGAGACAGCGAAGGCGTGGGATAAGGGTTCTACTAAGGGGTTACCGAAGCTATCTCACTGCGAAGTTCTGAAGAAAAACTTTGTCCTCAAGAAGCGGTGAAGTTGTAGGCTCTCGAAGAACTAACAGAAGAAAAACTTTCAGCTGCCGAAGACGTTAAGTTTTTAAGCTATTAAGCACTTAAGCGATTAAGGTTTTAAGAAATAGACTTCAACGAGAAATAAGCGTTGAAGCCCTGAGCTAAGGACTAGAAATGACTCCGAAGCATTTAAGCACTACAACTGCATGCTAAGACCTATCAAACACGCAGATAAAAACTGTAAAAACTAGATAAGATGTTAAGCAATTCACGAAGAAAAACTTTACACGACCGAAGCCCTTAAGTAGTATGACTCCTGTAACACGAAGTTGTATCATAAGGGATATTCGAAGACCTGAAGACGTGAAGGTCTGAAGACCTATTCATAAGAAGGCGTTAAGACCTGAAGCCCTGAACGAAGATAAAAACTGAAGTAGTGAAGCACTATCCGAAGACTTACACTAAGATATGAAGCCATAGGCTAAGCGGTGGCCAGGATAAGGGATGAAGCGCTAACCGAAGGAGTGAAGTTCTCAGATTTCGACCGATATAAGCAGTCGGCTAAGGCTTGAAGTCGTTAAGAATTGAAGGCCTGAAGACTTGAAGTTTTCGGCCATATAAGTAATGCCCTAAGGACTCGCCACCATAAGATTTGCGCTACATTGCGACACCACATCCTAAGCTCTTAAGACCTGAAGGCATAGAAATGCTAAGCGGAAAAATCGACGAAGTCCTATACTAAGACGTTAAGTTTTGTAATAAGGACTTATCTGGCGAAGAGCTACTAGAAGGTATGAAGCCTTCCCAGAAGTGCTTAAGGATTTTCCACCAGCCACACACATAGAAGTGGTTCGAGCTATTTCGAAGAGATAGGCTAAGAACTCTGCGAAGGTATGAAGGCCTTAGCTAGCTAAGCCGTTAAGTATTTAAGAGTTCAACAGCAGAAGTCGTTAAGGTGTCGTCAATCAACCGTCCCATCTAAGGAATAAAAATCACTCGATAAGATTTTAAGGACTGAAGCGTTACACTAAGGAATGAAGTCATTCAAGAAGTGGTGAAGTTATGGACTAAGGTGTCCCATAAGACATGAAGCGGTTAAGCACTGAAGGAGTGAAGATAAAAACTTAAGAGCTTAAGCAATTAAGACATGAAGTGTTGCACCCACCGAC --> |
| <article> | | <article> |
| <section> | | <section> |
| <h2>Attributions</h2> | | <h2>Attributions</h2> |
| | | |
− | <p>In addition to the financial and material support from our <a | + | <p>In addition to the financial & material support from our <a |
− | href="/Team:Groningen/Sponsors">sponsors</a>, we also had help | + | href="/Team:Groningen/Sponsors">sponsors</a>, and the invaluable coaching from our <a href="/Team:Groningen/Supervisors">supervisors</a>, we also had help from |
− | from the following people, and would like to thank them.</p> | + | the following people and organisations, and would like to thank |
| + | them.</p> |
| </section> | | </section> |
| | | |
Line 13: |
Line 15: |
| <h3>Artwork</h3> | | <h3>Artwork</h3> |
| | | |
− | <ul> | + | <p>All of the CryptoGErM art was made by Kathinka, except for the logo, which was made by Daniel, based on an original design by Mareike. In |
| + | addition to their works we also used some of the icons and other |
| + | work made by these people:</p> |
| + | |
| + | <div class="split"> |
| + | <ul class="left flone"> |
| <li><strong>Yazzer Perez</strong> from the Noun Project: <a href="https://thenounproject.com/term/teamwork/56376/">teamwork</a> icon.</li> | | <li><strong>Yazzer Perez</strong> from the Noun Project: <a href="https://thenounproject.com/term/teamwork/56376/">teamwork</a> icon.</li> |
| <li><strong>Eunji Kang</strong> from the Noun Project: <a href="https://thenounproject.com/term/connection/205723/">connection</a> icon.</li> | | <li><strong>Eunji Kang</strong> from the Noun Project: <a href="https://thenounproject.com/term/connection/205723/">connection</a> icon.</li> |
Line 24: |
Line 31: |
| <li><strong>lipi</strong> from the Noun Project: <a href="https://thenounproject.com/term/validation/583783/">Check Mark</a> icon</li> | | <li><strong>lipi</strong> from the Noun Project: <a href="https://thenounproject.com/term/validation/583783/">Check Mark</a> icon</li> |
| <li><strong>Anthony Bossard</strong> from the Noun Project: <a href="https://thenounproject.com/term/erlenmeyer/367441/">Erlenmeyer Flask</a> icon</li> | | <li><strong>Anthony Bossard</strong> from the Noun Project: <a href="https://thenounproject.com/term/erlenmeyer/367441/">Erlenmeyer Flask</a> icon</li> |
| + | </ul> |
| + | <ul class="right flone"> |
| + | <li><strong>To Uyen</strong> from the Noun Project: <a href="https://thenounproject.com/term/up/445288/">up</a> icon</li> |
| + | <li><strong>Nikita Sokolov</strong> from the Noun Project: <a href="https://thenounproject.com/term/plus/669265">plus</a> and <a href="https://thenounproject.com/term/minus/669266">minus</a> icons</li> |
| + | <li><strong>Grant Taylor Sizemore</strong> from the Noun Project: <a href="https://thenounproject.com/term/safety-goggles/164945/">Safety Goggle</a> icon</li> |
| + | <li><strong>James Keuning</strong> from the Noun Project: <a href="https://thenounproject.com/jmkeuning/collection/careers/?i=10278">Lab Coat</a> icon</li> |
| + | <li><strong>Gan Khoon Lay</strong> from the Noun Project: <a href="https://thenounproject.com/leremy/collection/forbidden-sign/?i=621063">Forbidden Food</a> icon</li> |
| + | <li><strong>Carlos Dias</strong> from the Noun Project: <a href="https://thenounproject.com/term/wash-hands/74973/">Hand Washing</a> icon</li> |
| + | <li><strong>Bluetip Design</strong> from the Noun Project: <a href="https://thenounproject.com/term/Checked/334313/">Checked</a> icon</li> |
| + | <li><strong>Inka Mahlandt</strong> for editing the videos made in the lab</li> |
| + | <li><strong>Justin Knight</strong> and the iGEM Foundation for the iGEM Giant Jamboree photos</li> |
| </ul> | | </ul> |
| + | </div> |
| </section> | | </section> |
| | | |
| <section> | | <section> |
− | <h3>Software</h3> | + | <h3>Computing & Modelling</h3> |
| + | |
| + | <p>Most of the modelling in CryptoGErM was done by Matthia, with some help from Carlos; the |
| + | software & wiki were built by Marco, with help from Luis, Bara |
| + | and Mareike. For these parts we had help from the following |
| + | people:</p> |
| | | |
| <ul> | | <ul> |
| <li><strong>Chris Veness</strong>: <a href="http://www.movable-type.co.uk/scripts/aes.html">AES in Javascript</a>.</li> | | <li><strong>Chris Veness</strong>: <a href="http://www.movable-type.co.uk/scripts/aes.html">AES in Javascript</a>.</li> |
| <li><strong>chitchcock</strong>: <a href="https://gist.github.com/chitchcock/5112270">CRC16-CCITT in Javascript</a>.</li> | | <li><strong>chitchcock</strong>: <a href="https://gist.github.com/chitchcock/5112270">CRC16-CCITT in Javascript</a>.</li> |
| + | <li><strong>Jos Roerdink</strong>: feedback on the modelling</li> |
| + | <li><strong>Bayu Jayawardhana</strong>: inspiration for the modelling</li> |
| </ul> | | </ul> |
| </section> | | </section> |
Line 38: |
Line 64: |
| <section> | | <section> |
| <h3>Human Practices & Safety</h3> | | <h3>Human Practices & Safety</h3> |
| + | |
| + | <p>Human practices was managed by Luis and Bente with help from |
| + | Kathinka, Ilona, Mareike and these people and organisations:</p> |
| | | |
| <ul> | | <ul> |
Line 45: |
Line 74: |
| Centre (LUMC)</li> | | Centre (LUMC)</li> |
| | | |
− | <!-- <li>National Cyber Security Center: or | + | <li><strong>National Cyber Security Center</strong> for |
| the comments received during the development of the project; | | the comments received during the development of the project; |
− | such comments were really helpful for our project.</li> --> | + | such comments were really helpful for our project.</li> |
| | | |
− | <li><strong>Jan Jaap Hoogstins</strong>: collection manager | + | <li><strong>JaapJan Hoogstins</strong>: collection manager |
| from the Groninger Archieven for the facilities and the | | from the Groninger Archieven for the facilities and the |
| interview given to CryptoGErM. It was really helpful for the | | interview given to CryptoGErM. It was really helpful for the |
| development and execution of our project!</li> | | development and execution of our project!</li> |
| | | |
− | <li><strong>Dr. ir. C.J.B. van der Vlugt-Bergmans</strong> from | + | <li><strong>C.J.B. van der Vlugt-Bergmans</strong> from |
| the National Institute for Public Health and the Environment | | the National Institute for Public Health and the Environment |
| (RIVM) for the orientation in the current regulations for | | (RIVM) for the orientation in the current regulations for |
Line 61: |
Line 90: |
| <li><strong>Diana Flores Flores</strong>, for her feedback in | | <li><strong>Diana Flores Flores</strong>, for her feedback in |
| the elaboration of our survey</li> | | the elaboration of our survey</li> |
| + | </ul> |
| + | </section> |
| + | |
| + | <section> |
| + | <h3>Lab</h3> |
| + | |
| + | <p>Eike, Daniel, Bara, Sambit, Mareike, Ilona, Bente and Carlos were working in the lab. We wish to thank the following |
| + | people for sharing their knowledge and support.</p> |
| + | |
| + | <ul> |
| + | <li><strong>Ben L. Feringa, Mickel J. Hansen, Michael M. Lerch, |
| + | Wiktor Szymanski and the rest of Synthetic Organic Chemistry |
| + | group</strong> for supplying us with spirofloxacin and for |
| + | their chemical expertise.</li> |
| + | |
| + | <li><strong>Jan-Willem Veening</strong> for his feedback</li> |
| + | |
| + | <li><strong>Jan Kiel and Ger Telkamp</strong> for helping us |
| + | obtain all the necessary equipment</li> |
| + | |
| + | <li><strong>Luiza Morawska</strong> for tips and tricks on how |
| + | to work with <em>Bacillus subtilis</em> and the pDR111 |
| + | plasmid</li> |
| + | |
| + | <li><strong>Ard Jan Grimbergen</strong> for showing us how the |
| + | plate reader works</li> |
| + | |
| + | <li><strong>Lance Keller</strong> for a very short introduction |
| + | to FACS data analysis </li> |
| + | |
| + | <li><strong>The janitors</strong> for rescuing the spores out of the broken centrifuge</li> |
| + | |
| + | <li><strong>MolGen</strong></li> |
| | | |
| </ul> | | </ul> |
| + | </section> |
| + | |
| + | <section> |
| + | <h3>General thanks</h3> |
| + | |
| + | <ul> |
| + | <li><strong>Yue Sun</strong> withdrew from our team during the |
| + | summer. We thank her for her contributions to the project.</li> |
| + | <li><strong>Peter Rauch</strong> for moral support</li> |
| + | <li><strong>Erik Sikkema</strong> for supervising Ilona's internship</li> |
| + | <li><strong>Marco Wiering</strong> for spiritual support and inspiration</li> |
| + | <li><strong>Gordon Freeman</strong></li> |
| + | <li><strong>Marc van der Maarel</strong> for presentation coaching</li> |
| + | <li><strong>StackOverflow</strong></li> |
| + | <li><strong>ImageMagick & FFmpeg</strong> for everything with audio and video</li> |
| + | <li><strong>The guy down the hall</strong> for <em>always</em> being there</li> |
| + | <li><strong>Mom & dad</strong></li> |
| + | </ul> |
| + | </section> |
| + | |
| + | <section class="centrate"> |
| + | <img src="https://static.igem.org/mediawiki/2016/thumb/0/08/T--Groningen--Attributions-thanks-collabara.jpg/800px-T--Groningen--Attributions-thanks-collabara.jpg" /> |
| </section> | | </section> |
| </article> | | </article> |
| </html> | | </html> |
| {{Groningen/footer}} | | {{Groningen/footer}} |