Difference between revisions of "Team:Groningen/Attributions"

 
(27 intermediate revisions by 5 users not shown)
Line 1: Line 1:
 
{{Groningen}}
 
{{Groningen}}
 
<html>
 
<html>
 +
<!-- GACCAAGCCTGCAAAACCAAACTTATAAATCATTGGTAAGTCATGAAAGAAGTCATGGCATAAGTAGTAGACCTACATCCTAAGTAGTGAAGAATTATGCTAAGTTCTGAAGAGATAACAGAAGCGGTGAGCGAAGACATTAAGTCATTAAGTATTGAAGTAATGAAGTCTTTAAGGTATGAAGAGATTAAGGCCTGTCCTAAGACTTGAAGCAGTGAAGCAATATTCTCACGAAGGTATTAAGCCTTTCGCTCGCGAAGAGATGAAGCGTTTAAGGATTTGCCCTACGAAGGCTTCTTATAAGCCATACTATTTAGAAGGTGTGAAGTAGTGAAGGTGTTAAGGATTTAAGATTTGAAGCCATGAAGGAGTAATCTGGCATACCAGCGAAGAAGTGAAGCCCTTAAGACTTCCGCTAAGGCCTGAAGAGCTGAAGATTTCCCATAAGCCGTCAACAGGCCTACGGGAGAAGAATTGTCATTAAGAAGCGGTGTCAGAGCTAAATAGATAAGAAGTAAACTAAGAGGTTAAGGACTTAAGGAGTTAAGGGATTTCAAGCATAAGTGTTGAAAGAAGCCCTTAAGGACTGCACAAACTCTCGAAGAGTTTAGAGAAGCGATGAAGAGATTAACTAAGATATTTTCTCACTAAGGGCTGAGACCAATAAGAATTGGACGAAGACATGGAATAAGATGTTAGAGAAGGCGTACACGAAGACTTGAAGCTATTGGCGACACCGCCTGCATACTATCCCCCCTACTTTCTTCCTTACTTCATACATAAGGCCTGAAGTTATTAACGATCGATCTAAGGCCTGTTAGATATAAGACTTTAAGGCATCTAAAACATAAGCCGTTAAGTCTTGAAGCAATGAAGTAATCTTCGAAGCTATTAAGTGTTTAAGAAATGGTAGAAGCCCTGCCCGAAGATGTAACATATAACGAGAAGCGATCTTCTAAGTGCTCGACGAGAGAAGCGATGAAGTCTTGCTATAAGCTATGCCCAGTATAAGCCATGTTATAAGATTTTAAGTAATTTGATTTCTCCCTAAGAGCTGTGAGAGACAGCGAAGGCGTGGGATAAGGGTTCTACTAAGGGGTTACCGAAGCTATCTCACTGCGAAGTTCTGAAGAAAAACTTTGTCCTCAAGAAGCGGTGAAGTTGTAGGCTCTCGAAGAACTAACAGAAGAAAAACTTTCAGCTGCCGAAGACGTTAAGTTTTTAAGCTATTAAGCACTTAAGCGATTAAGGTTTTAAGAAATAGACTTCAACGAGAAATAAGCGTTGAAGCCCTGAGCTAAGGACTAGAAATGACTCCGAAGCATTTAAGCACTACAACTGCATGCTAAGACCTATCAAACACGCAGATAAAAACTGTAAAAACTAGATAAGATGTTAAGCAATTCACGAAGAAAAACTTTACACGACCGAAGCCCTTAAGTAGTATGACTCCTGTAACACGAAGTTGTATCATAAGGGATATTCGAAGACCTGAAGACGTGAAGGTCTGAAGACCTATTCATAAGAAGGCGTTAAGACCTGAAGCCCTGAACGAAGATAAAAACTGAAGTAGTGAAGCACTATCCGAAGACTTACACTAAGATATGAAGCCATAGGCTAAGCGGTGGCCAGGATAAGGGATGAAGCGCTAACCGAAGGAGTGAAGTTCTCAGATTTCGACCGATATAAGCAGTCGGCTAAGGCTTGAAGTCGTTAAGAATTGAAGGCCTGAAGACTTGAAGTTTTCGGCCATATAAGTAATGCCCTAAGGACTCGCCACCATAAGATTTGCGCTACATTGCGACACCACATCCTAAGCTCTTAAGACCTGAAGGCATAGAAATGCTAAGCGGAAAAATCGACGAAGTCCTATACTAAGACGTTAAGTTTTGTAATAAGGACTTATCTGGCGAAGAGCTACTAGAAGGTATGAAGCCTTCCCAGAAGTGCTTAAGGATTTTCCACCAGCCACACACATAGAAGTGGTTCGAGCTATTTCGAAGAGATAGGCTAAGAACTCTGCGAAGGTATGAAGGCCTTAGCTAGCTAAGCCGTTAAGTATTTAAGAGTTCAACAGCAGAAGTCGTTAAGGTGTCGTCAATCAACCGTCCCATCTAAGGAATAAAAATCACTCGATAAGATTTTAAGGACTGAAGCGTTACACTAAGGAATGAAGTCATTCAAGAAGTGGTGAAGTTATGGACTAAGGTGTCCCATAAGACATGAAGCGGTTAAGCACTGAAGGAGTGAAGATAAAAACTTAAGAGCTTAAGCAATTAAGACATGAAGTGTTGCACCCACCGAC -->
 
<article>
 
<article>
 
<section>
 
<section>
 
<h2>Attributions</h2>
 
<h2>Attributions</h2>
 
 
−
<p>In addition to the financial and material support from our <a  
+
<p>In addition to the financial &amp; material support from our <a  
−
href="/Team:Groningen/Sponsors">sponsors</a>, we also had help from  
+
href="/Team:Groningen/Sponsors">sponsors</a>, and the invaluable coaching from our <a href="/Team:Groningen/Supervisors">supervisors</a>, we also had help from  
 
the following people and organisations, and would like to thank  
 
the following people and organisations, and would like to thank  
 
them.</p>
 
them.</p>
Line 14: Line 15:
 
<h3>Artwork</h3>
 
<h3>Artwork</h3>
 
 
−
<p>Most of the CryptoGErM art was made by Kathinka and Daniel. In  
+
<p>All of the CryptoGErM art was made by Kathinka, except for the logo, which was made by Daniel, based on an original design by Mareike. In  
 
addition to their works we also used some of the icons and other  
 
addition to their works we also used some of the icons and other  
 
work made by these people:</p>
 
work made by these people:</p>
 
 
−
<ul>
+
<div class="split">
 +
<ul class="left flone">
 
<li><strong>Yazzer Perez</strong> from the Noun Project: <a href="https://thenounproject.com/term/teamwork/56376/">teamwork</a> icon.</li>
 
<li><strong>Yazzer Perez</strong> from the Noun Project: <a href="https://thenounproject.com/term/teamwork/56376/">teamwork</a> icon.</li>
 
<li><strong>Eunji Kang</strong> from the Noun Project: <a href="https://thenounproject.com/term/connection/205723/">connection</a> icon.</li>
 
<li><strong>Eunji Kang</strong> from the Noun Project: <a href="https://thenounproject.com/term/connection/205723/">connection</a> icon.</li>
Line 29: Line 31:
 
<li><strong>lipi</strong> from the Noun Project: <a href="https://thenounproject.com/term/validation/583783/">Check Mark</a> icon</li>
 
<li><strong>lipi</strong> from the Noun Project: <a href="https://thenounproject.com/term/validation/583783/">Check Mark</a> icon</li>
 
<li><strong>Anthony Bossard</strong> from the Noun Project: <a href="https://thenounproject.com/term/erlenmeyer/367441/">Erlenmeyer Flask</a> icon</li>
 
<li><strong>Anthony Bossard</strong> from the Noun Project: <a href="https://thenounproject.com/term/erlenmeyer/367441/">Erlenmeyer Flask</a> icon</li>
 +
</ul>
 +
<ul class="right flone">
 
<li><strong>To Uyen</strong> from the Noun Project: <a href="https://thenounproject.com/term/up/445288/">up</a> icon</li>
 
<li><strong>To Uyen</strong> from the Noun Project: <a href="https://thenounproject.com/term/up/445288/">up</a> icon</li>
−
<li><strong>Inka Mahlandt</strong> for editing the videos I made in the lab</li>
+
<li><strong>Nikita Sokolov</strong> from the Noun Project: <a href="https://thenounproject.com/term/plus/669265">plus</a> and <a href="https://thenounproject.com/term/minus/669266">minus</a> icons</li>
 +
<li><strong>Grant Taylor Sizemore</strong> from the Noun Project: <a href="https://thenounproject.com/term/safety-goggles/164945/">Safety Goggle</a> icon</li>
 +
<li><strong>James Keuning</strong> from the Noun Project: <a href="https://thenounproject.com/jmkeuning/collection/careers/?i=10278">Lab Coat</a> icon</li>
 +
<li><strong>Gan Khoon Lay</strong> from the Noun Project: <a href="https://thenounproject.com/leremy/collection/forbidden-sign/?i=621063">Forbidden Food</a> icon</li>
 +
<li><strong>Carlos Dias</strong> from the Noun Project: <a href="https://thenounproject.com/term/wash-hands/74973/">Hand Washing</a> icon</li>
 +
<li><strong>Bluetip Design</strong> from the Noun Project: <a href="https://thenounproject.com/term/Checked/334313/">Checked</a> icon</li>
 +
<li><strong>Inka Mahlandt</strong> for editing the videos made in the lab</li>
 +
<li><strong>Justin Knight</strong> and the iGEM Foundation for the iGEM Giant Jamboree photos</li>
 
</ul>
 
</ul>
 +
</div>
 
</section>
 
</section>
 
 
Line 37: Line 49:
 
<h3>Computing &amp; Modelling</h3>
 
<h3>Computing &amp; Modelling</h3>
 
 
−
<p>The modelling in CryptoGErM was done by Matthia and Carlos; the  
+
<p>Most of the modelling in CryptoGErM was done by Matthia, with some help from Carlos; the  
−
software &amp; wiki were built by Marco. For these parts we had  
+
software &amp; wiki were built by Marco, with help from Luis, Bara
−
help from the following people:</p>
+
and Mareike. For these parts we had help from the following  
 +
people:</p>
 
 
 
<ul>
 
<ul>
Line 65: Line 78:
 
such comments were really helpful for our project.</li>
 
such comments were really helpful for our project.</li>
 
 
−
<li><strong>Jan Jaap Hoogstins</strong>: collection manager  
+
<li><strong>JaapJan Hoogstins</strong>: collection manager  
 
from the Groninger Archieven for the facilities and the  
 
from the Groninger Archieven for the facilities and the  
 
interview given to CryptoGErM. It was really helpful for the  
 
interview given to CryptoGErM. It was really helpful for the  
Line 83: Line 96:
 
<h3>Lab</h3>
 
<h3>Lab</h3>
 
 
−
<p>Eike, Daniel, Bara and Sambit were the main lab workers, with
+
<p>Eike, Daniel, Bara, Sambit, Mareike, Ilona, Bente and Carlos were working in the lab. We wish to thank the following
−
help from Mareike, Ilona and Bente. We wish to thank the following
+
 
people for sharing their knowledge and support.</p>
 
people for sharing their knowledge and support.</p>
 
 
Line 97: Line 109:
 
<li><strong>Jan Kiel and Ger Telkamp</strong> for helping us  
 
<li><strong>Jan Kiel and Ger Telkamp</strong> for helping us  
 
obtain all the necessary equipment</li>
 
obtain all the necessary equipment</li>
 +
 +
<li><strong>Luiza Morawska</strong> for tips and tricks on how
 +
to work with <em>Bacillus subtilis</em> and the pDR111
 +
plasmid</li>
 +
 +
<li><strong>Ard Jan Grimbergen</strong> for showing us how the
 +
plate reader works</li>
 +
 +
<li><strong>Lance Keller</strong> for a very short introduction
 +
to FACS data analysis </li>
 +
 +
                                <li><strong>The janitors</strong> for rescuing the spores out of the broken centrifuge</li>
 +
 +
<li><strong>MolGen</strong></li>
 +
 
</ul>
 
</ul>
 
</section>
 
</section>
Line 107: Line 134:
 
summer. We thank her for her contributions to the project.</li>
 
summer. We thank her for her contributions to the project.</li>
 
<li><strong>Peter Rauch</strong> for moral support</li>
 
<li><strong>Peter Rauch</strong> for moral support</li>
−
<li><strong>Marco Wiering</strong> for general inspiration</li>
+
                                <li><strong>Erik Sikkema</strong> for supervising Ilona's internship</li>
 +
<li><strong>Marco Wiering</strong> for spiritual support and inspiration</li>
 
<li><strong>Gordon Freeman</strong></li>
 
<li><strong>Gordon Freeman</strong></li>
 +
                                <li><strong>Marc van der Maarel</strong> for presentation coaching</li>
 
<li><strong>StackOverflow</strong></li>
 
<li><strong>StackOverflow</strong></li>
 +
<li><strong>ImageMagick &amp; FFmpeg</strong> for everything with audio and video</li>
 +
<li><strong>The guy down the hall</strong> for <em>always</em> being there</li>
 
<li><strong>Mom &amp; dad</strong></li>
 
<li><strong>Mom &amp; dad</strong></li>
 
</ul>
 
</ul>
 +
</section>
 +
 +
<section class="centrate">
 +
<img src="https://static.igem.org/mediawiki/2016/thumb/0/08/T--Groningen--Attributions-thanks-collabara.jpg/800px-T--Groningen--Attributions-thanks-collabara.jpg" />
 
</section>
 
</section>
 
</article>
 
</article>
 
</html>
 
</html>
 
{{Groningen/footer}}
 
{{Groningen/footer}}

Latest revision as of 12:06, 8 December 2016

CryptoGE®M
CryptoGE®M
Team
Team
Members Supervisors Collaborations Achievements Contact
Project
Project
Tour Description Design Results Demonstrate Applications Future Notebook
Biology
Biology
Experiments Parts Safety Lab journal
Computing
Computing
Modelling Software Encoding Decoding
Human Practice
Human Practices
Human Practices Gold Silver
Acknowledgements
Support
Sponsors Attributions

Attributions

In addition to the financial & material support from our sponsors, and the invaluable coaching from our supervisors, we also had help from the following people and organisations, and would like to thank them.

Artwork

All of the CryptoGErM art was made by Kathinka, except for the logo, which was made by Daniel, based on an original design by Mareike. In addition to their works we also used some of the icons and other work made by these people:

  • Yazzer Perez from the Noun Project: teamwork icon.
  • Eunji Kang from the Noun Project: connection icon.
  • Vítor Carvalho from the Noun Project: software engineering icon.
  • creative outlet from the Noun Project: Idea settings icon.
  • Flaticon/Freepik: Toolbox icon.
  • Lloyd Humphreys from the Noun Project: DNA icon
  • Carla Dias from the Noun Project: Scissors icon
  • bilel djettaou from the Noun Project: Petri icon
  • lipi from the Noun Project: Check Mark icon
  • Anthony Bossard from the Noun Project: Erlenmeyer Flask icon
  • To Uyen from the Noun Project: up icon
  • Nikita Sokolov from the Noun Project: plus and minus icons
  • Grant Taylor Sizemore from the Noun Project: Safety Goggle icon
  • James Keuning from the Noun Project: Lab Coat icon
  • Gan Khoon Lay from the Noun Project: Forbidden Food icon
  • Carlos Dias from the Noun Project: Hand Washing icon
  • Bluetip Design from the Noun Project: Checked icon
  • Inka Mahlandt for editing the videos made in the lab
  • Justin Knight and the iGEM Foundation for the iGEM Giant Jamboree photos

Computing & Modelling

Most of the modelling in CryptoGErM was done by Matthia, with some help from Carlos; the software & wiki were built by Marco, with help from Luis, Bara and Mareike. For these parts we had help from the following people:

Human Practices & Safety

Human practices was managed by Luis and Bente with help from Kathinka, Ilona, Mareike and these people and organisations:

  • G. van Willingen: Coordinating Senior Advisor CBRN Safety and Security, Biosafety Officer and Environmental Safety Officer of Leiden Universital Medical Centre (LUMC)
  • National Cyber Security Center for the comments received during the development of the project; such comments were really helpful for our project.
  • JaapJan Hoogstins: collection manager from the Groninger Archieven for the facilities and the interview given to CryptoGErM. It was really helpful for the development and execution of our project!
  • C.J.B. van der Vlugt-Bergmans from the National Institute for Public Health and the Environment (RIVM) for the orientation in the current regulations for Genetically Modified Bacteria (GMO)
  • Diana Flores Flores, for her feedback in the elaboration of our survey

Lab

Eike, Daniel, Bara, Sambit, Mareike, Ilona, Bente and Carlos were working in the lab. We wish to thank the following people for sharing their knowledge and support.

  • Ben L. Feringa, Mickel J. Hansen, Michael M. Lerch, Wiktor Szymanski and the rest of Synthetic Organic Chemistry group for supplying us with spirofloxacin and for their chemical expertise.
  • Jan-Willem Veening for his feedback
  • Jan Kiel and Ger Telkamp for helping us obtain all the necessary equipment
  • Luiza Morawska for tips and tricks on how to work with Bacillus subtilis and the pDR111 plasmid
  • Ard Jan Grimbergen for showing us how the plate reader works
  • Lance Keller for a very short introduction to FACS data analysis
  • The janitors for rescuing the spores out of the broken centrifuge
  • MolGen

General thanks

  • Yue Sun withdrew from our team during the summer. We thank her for her contributions to the project.
  • Peter Rauch for moral support
  • Erik Sikkema for supervising Ilona's internship
  • Marco Wiering for spiritual support and inspiration
  • Gordon Freeman
  • Marc van der Maarel for presentation coaching
  • StackOverflow
  • ImageMagick & FFmpeg for everything with audio and video
  • The guy down the hall for always being there
  • Mom & dad
Oop top
Team
Project
Biology
Modelling
Computing
Human Practices
Support