Difference between revisions of "Team:British Columbia/Project/Bio-Pathways"

Abstract

"Lorem ipsum dolor sit amet, consectetur adipiscing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris nisi ut aliquip ex ea commodo consequat. Duis aute irure dolor in reprehenderit in voluptate velit esse cillum dolore eu fugiat nulla pariatur. Excepteur sint occaecat cupidatat non proident, sunt in culpa qui officia deserunt mollit anim id est laborum."

Key Achievements

Introduction

Escherichia coli is commonly used as a chassis for the biosynthesis of valuable chemicals. Advantages to its use include fast growth kinetics, ease of acquiring high density cultures, ability to grow on many types of media that can be made from inexpensive reagents, and tractability for genetic manipulation (Rosano and Ceccarelli 2014). As such, many past iGEM teams have chosen to engineer biosynthetic pathways into E. coli for production of a wide range of commercially-desired products such as biofuels, violacein, astaxanthin, and its precursor β-carotene.

This year, we intend to build a platform for producing valuable chemicals more sustainably by bridging lignocellulose processing directly to product manufacture. For our project, we decided to engineer E. coli to produce β-carotene in tandem to its growth with C.crescentus. In particular, we designed our system so that E. coli metabolizes the simple sugars released from cellulosic degradation accomplished by cellulase-expressing C. crescentus, to in turn produce β-carotene as a secondary metabolite.

β-carotene is a carotenoid found in many colored fruits and vegetables. It is the biosynthetic precursor to vitamin A which has roles in gene expression, vision, maintenance of body linings and skin, immune defenses, growth of the body, and normal development of cells (Webb, Sizer, and Whitney 2003). Aside from being a precursor, β-carotene also has functions as a potent quencher of singlet toxic oxygen species, and can act as an antioxidant that scavenges free radicals in human low density lipoprotein (LDL), high density lipoprotein (HDL), and cell membranes (Bendich 2004).

We chose to produce β-carotene as a proof-of-concept approach to validating the functionality of our system. However, our platform can be applied to the production of higher value chemicals as well. We anticipate that directly linking chemical production to treatment of lignocellulosic biomass, in the form of a microbial consortium, would result in both effectively reducing the costs associated with chemical production and valorizing lignocellulosic waste.

Methods

Growth of DH5α E. coli cells expressing β-carotene in minimal medium

Chemically competent DH5α E. coli cells were transformed with the 2009 Cambridge iGEM team’s construct, BBa_K274210, which encodes an operon for β-carotene production using pyruvate and glyceraldehyde-3-phosphate as substrates. Transformed cells were plated onto LB agar + CM plates and grown overnight at 37°C. Isolated colonies with yellow-orange color were then inoculated - in triplicates, into LB + CM and grown for 24 hours at 37°C while shaking, to serve as overnight cultures in subsequent experiments for growth curve generation. Likewise, untransformed DH5α E. coli cells that did not produce β-carotene were also inoculated - in triplicates, into LB+CM, to serve as a negative control.

To generate a curve for growth in minimal medium containing varying concentrations of glucose, overnight cultures of DH5α E. coli cells that either expressed or did not express β-carotene were inoculated to a starting optical density (OD600) of 0.01, in 100 ml of M9 minimal medium containing 100 μg/ml ampicillin, and either 0.05, 0.10 or 0.20% glucose, in triplicates. The cultures were incubated at 37°C and OD600 was subsequently measured at different times over the course of approximately 50 hours using a spectrophotometer.

To generate a curve for growth in minimal medium containing cellobiose or cellulose, overnight cultures of DH5α E. coli cells that either expressed or did not express β-carotene were inoculated to a starting optical density (OD600) of 0.01, in 100 ml of M9 minimal medium containing 100 μg/ml ampicillin, and either 0.20% cellobiose or 0.20% cellulose, in triplicates. The cultures were incubated at 37°C and OD600 was again subsequently measured at different times over the course of approximately 50 hours using a spectrophotometer.

Characterizing β-carotene production in DH5α E. coli cells encoding β-carotene biosynthesis genes

DH5α E. coli cells that either encode or do not encode for β-carotene biosynthetic genes were inoculated - in triplicates, into 50 ml of M2 minimal media supplemented with 100 μg/ml ampicillin and 0.20% glucose. These were grown for 48 hours at 30°C while shaking.

We then used a method adopted from the 2009 Cambridge iGEM team, for β-carotene extraction. After 48 hours, the aforementioned 50 ml culture of cells were initially pelleted at 4000 RPM using a Beckman Coulter centrifuge for 20 minutes, and the resulting supernatant was discarded. 5 ml of acetone was added to each pellet, heated for 10 minutes at 50°C, and then vortexed to lyse the cells. The samples were then centrifuged at 14,000 rpm for 1 minute, and the supernatant containing β-carotene in acetone was collected. Using a scanning spectrophotometer, absorbance at a range of wavelengths from 300-600 nm was measured for each of the acetone-extracted β-carotene samples. Absorbance at these wavelengths was also taken for laboratory grade β-carotene, which served as a positive control.

Cloning CrtEBIY under a constitutive promoter into pSB1C3 plasmid

All Escherichia coli cultures were grown in Luria Broth (LB) media supplemented with 12.5 μg/ml chloramphenicol (CM) unless stated otherwise. All plasmid DNA extractions were performed with QIAprep Spin Miniprep Kit (Qiagen). DNA purification from gels or PCR mixtures were done with NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel).

DH5α E. coli cells encoding β-carotene under the BBa_R0011 constitutive promoter in pSB1A2 plasmid, was PCR-amplified from BBa_K274210 using the VF2 (5’ - TGCCACCTGACGTCTAAGAA -3’) and VR (5’ - ATTACCGCCTTTGAGTGAGC - 3’) primers. The CrtEBIY amplicons were then gel purified, digested with EcoRI and SpeI, and ligated to psB1C3 plasmid that was also digested with EcoRI and XbaI, as well as gel purified. The ligation mixture was then transformed into chemically competent K12 (MG1655) and DH5α E. coli, and transformed cells were plated onto LB agar + CM. Several transformants were grown overnight in LB+CM, subjected to miniprep, and extracted plasmids were sent for Sanger sequencing using the VF2 primer for confirmation of the correct insert.

Results

Conclusion

References

Rosano, Germán L. and Eduardo A. Ceccarelli. "Recombinant Protein Expression In Escherichia Coli: Advances And Challenges". Front. Microbiol., vol 5, 2014, Frontiers Media SA, doi:10.3389/fmicb.2014.00172.