Difference between revisions of "Team:Kyoto/Experiments"

Line 525: Line 525:
 
</ol>
 
</ol>
  
−
<h2>Cellulose Affinity Assay</h2>
+
<h2>Cellulose Affinity Assay with spectrophotometer</h2>
 
<ol>
 
<ol>
 
<li>Prepare LB +CP medium that contains objective E.coli, incubate overnight at 37&deg;C</li>
 
<li>Prepare LB +CP medium that contains objective E.coli, incubate overnight at 37&deg;C</li>
Line 535: Line 535:
 
<li>Transfer the cellulose sheet to a new buffer of the same volume, incubate for 1 hour</li>
 
<li>Transfer the cellulose sheet to a new buffer of the same volume, incubate for 1 hour</li>
 
<li>Measure OD600 values of the buffer This OD600 values are &lt;wash&gt;.</li>
 
<li>Measure OD600 values of the buffer This OD600 values are &lt;wash&gt;.</li>
 +
</ol>
 +
 +
<h2>Cellulose Affinity Assay with Fluorescence Microscope </h2>
 +
<ol>
 +
<li>Centrifuge overnight cell culture with 200g for 20min</li>
 +
<li>Resuspend in PBS to OD600 of 0.2/1.0</li>
 +
<li>Mix 1ml cell suspension and cellulose powder/Bemliese</li>
 +
<li>Stir in room temperature, 800rpm for 6h</li>
 +
<li>Pellet with microcentrifuge</li>
 +
<li>Fix samples with 4% PFA for 10min</li>
 +
<li>Pellet with microcentrifuge</li>
 +
<li>Resuspend in PBS 500ul</li>
 +
<li>Repeat step 7 and 8 two more times</li>
 +
<li>Add 500ul 1ug/ml DAPI and leave for 15min</li>
 +
<li>Pellet with microcentrifuge</li>
 +
<li>Resuspend in PBS 500ul</li>
 +
<li>Repeat step 11 and12 two more times</li>
 +
<li>Filter sample with filtering membrane with 200g centrifugation for 5min</li>
 +
<li>Add PBS 500ul then centrifuge 200g for additional 5min</li>
 +
<li>Resuspend the remaining cellulose on filtering membrane in PBS 400ul, transfer to 1.5ml tube</li>
 +
<li>Pellet with microcentrifuge</li>
 +
<li>Resuspend in 20ul fluorescence fading inhibitor</li>
 
</ol>
 
</ol>
  

Revision as of 20:04, 17 October 2016

Contents

1 Parts
2 Materials
3 Methods
4 Primer list

Parts

Basic Parts
Composite Parts

Materials

Kit Supplier
Wizard® SV Gel and PCR Promega
Ligation high Ver.2 TOYOBO
FastGene™Plasmid Mini Kit NIPPON Genetics Co.,Ltd
Enzyme Supplier
EcoRI TaKaRa, Promega
PstI TaKaRa, Promega
SpeI TaKaRa, Promega
XbaI TaKaRa, Promega
DraII TaKaRa
Marker Supplier
1kb DNA Ladder TaKaRa
Organism Supplier
E.coli DH5α Genotype TaKaRa
E.coli JM109 Competent Cells TaKaRa
Antibiotics Supplier
Chloramphericol nacalai tesque
Ampicillin Sodium Salt nacalai tesque
Equipment Suppliert
BEMLISE SR601 AsahiKASEI
BioPhotometer eppendorf
LABO SHAKER BIO CRAFT
CO2 INCUBATOR SANYO
Pipette Controller Biohit Midi Plus
MiniCentrifuge Model GMC-060 LMS CO.,LTD.
HIGH-SPEED REFRIGERATED CENTRIFUGE TOMY
HIGH-PRESSURE STEAM STERILIZER TOMY
VOTEX-GENE2 Scientific Industryes
Scanning Electron Miniscope TM1000s HITACHI
Fluorescence Microscope BX61N-34-FL-1-D OLYMPUS
Backbones Supplier
pSB1C3 iGEM registry
pSB1A2 iGEM registry
pSB3C5 iGEM registry
BBa_ J61002 iGEM registry
Buffer Supplier
Sodium Carbonate Wako
Sodium Bicarbonate Wako
Methanol(99.5%) Wako
Sodium Chloride Wako
SDS nacalai tesque
Trisaminomethane nacalai tesque
Potassium dihydrogenphosphste SIGAMA-ALDRICH
Potassium Chloride Wako
Glycine Wako
Agar, Powder Wako
Agarose XP Wako
10% Hydrochloric Acid Wako
Tween-20 SANTA CRUZ
Dimethyl sulfoxide Wako
Other Enzyme Supplier
KAPA™HiFi HotStart ReadyMix (2x) KAPABIOSYSTEMS
KAPA2G™ Fast HotStart ReadyMix with dye (2x) KAPABIOSYSTEMS
KAPATaq™EXtra HotStart ReadyMix with dye KAPABIOSYSTEMS
Quick Taq® HS DyeMix TOYOBO
SDSPAGE/WB Supplier
IMMOBILON - P Blotting Sandwiches Immobilon
REAL GEL PLATE (10%) BIO CRAFT
BE-210(SDSPAGE) BIO CRAFT
BE-330 BIO CRAFT
Amersham ECL Anti-Mouse IgG GE healthcare
Amersham ECL Anti-rabbit IgG GE healthcare
G2-4 rabbit anti-serum Sano
Amersham ECL Prime Blocking Reagent GE healthcare
Amersham ECL Prime WB Detection Reagent GE healthcare
Fluorescence Microscope Supplier
Immersion oil Type F OLYMPUS JAPAN
Filter Paper Qualitative 2 90mm ADVANTEC
Cellulose powder through 38μm(48mesh) Wako
5ml Polystyrene round-bottom tube with cell-strainer Cap FALCON

Methods

Westernblot (Against His tag)

  1. Apply sample to SDS-PAGE minigel (BIOCLAFT 10%).
  2. Soak the gel in transfer buffer
  3. Soak PVDF membrane in 100% methanol for 30 sec
  4. Soak PVDF membrane and filter paper in transfer buffer, leave for 5 min
  5. Set filter paper, membrane, gels, filter paper to semidry transferor in this order from anode to cathode
  6. Transfer the proteins from the gels to the membrane with 100mA for 1 h
  7. Soak membrane in blocking buffer (ECL Blocking reagent 5 g TBST 100ml) for 1 h
  8. Wash for 5 min 3 times with TBST
  9. Apply 1' antibody (anti-His tag or anti-NoVLP 10μl TBST 10 ml) and shake for 1 h
  10. Wash for 5 min 3 times with TBST
  11. Apply 2' antibody (anti-rabbit HRP 4μl:TBST 10ml) and shake for 1 h
  12. Wash for 5 min 3 times
  13. Drain excess wash buffer from the washed membrane and place it protein side up on flat surface
  14. Add detection reagent onto the membrane, covering all of the membrane
  15. Incubate for 5 minutes at room temperature
  16. Drain off excess detection reagent by dabbing with Kimwipe
  17. Place the sample in the CCD camera compartment and record the images

Western Blot (against NoVLP)

*Sample Preparation*

  1. Mix milliQ 12.5ul, SDSlysisbuffer 4.5ul, and VLP.
  2. Mix MilliQ 2.5ul, SDSlysisbuffer 2.5ul, and GE dual protein marker 5ul.
  3. Vortex 1. and 2., then centrifuge them with a minicentrifuge.
  4. Heat the solutions at 95 °C for 5 min.
  5. Vortex the solutions, and centrifuge them again.

Cellulose Affinity Assay with spectrophotometer

  1. Prepare LB +CP medium that contains objective E.coli, incubate overnight at 37°C
  2. Centrifuge this solution at 200g for 10 min.
  3. Collect the pellet, and add Carbonate bicarbonate buffe so that OD600 values come to about 0.2
  4. Take 1ml out of the cell suspension, and measure OD600 values. This OD600 values are <before>.
  5. Incubate the cell suspension with 3cm by 2.5 cm cellulose sheet (BEMLIESE #606) for 1 h
  6. Measure OD600 values of the cell suspension. This OD600 values are <after>.
  7. Transfer the cellulose sheet to a new buffer of the same volume, incubate for 1 hour
  8. Measure OD600 values of the buffer This OD600 values are <wash>.

Cellulose Affinity Assay with Fluorescence Microscope

  1. Centrifuge overnight cell culture with 200g for 20min
  2. Resuspend in PBS to OD600 of 0.2/1.0
  3. Mix 1ml cell suspension and cellulose powder/Bemliese
  4. Stir in room temperature, 800rpm for 6h
  5. Pellet with microcentrifuge
  6. Fix samples with 4% PFA for 10min
  7. Pellet with microcentrifuge
  8. Resuspend in PBS 500ul
  9. Repeat step 7 and 8 two more times
  10. Add 500ul 1ug/ml DAPI and leave for 15min
  11. Pellet with microcentrifuge
  12. Resuspend in PBS 500ul
  13. Repeat step 11 and12 two more times
  14. Filter sample with filtering membrane with 200g centrifugation for 5min
  15. Add PBS 500ul then centrifuge 200g for additional 5min
  16. Resuspend the remaining cellulose on filtering membrane in PBS 400ul, transfer to 1.5ml tube
  17. Pellet with microcentrifuge
  18. Resuspend in 20ul fluorescence fading inhibitor

Growth Curve Drawing

  1. Measure OD600 of LB liquid medium (10μg/ml CP) and set blank.
  2. Prepare 10ml LB liquid medium (10μg/ml CP) with E.coli sample whose OD600 values are adjusted to 1.0, Cover the tube with a plastic sheet with airholes
  3. Start incubating at 160rpm, 37°C. Measure the absorbance promptly and set it 0 minute.
  4. Measure OD600 every 30 minutes (before 2hours)/every an hour (after 2hours).

RT-PCR

RT-PCR was performed using QuantiTect® Reverse Transcription Kit according to the manufacturer's protocol.

Scanning Electron Microscopy (2015 Summer Experiment)

Samples Centrifugal Force
INPNC-His-scFv(pSB3C5) 25ul+VLP2.5ul 200g
BclA-His-scFv(pSB3C5)25ul+VLP2.5ul 200g

*Sample Preparation (E.coli+VLP)*

  1. Prepare 45ml of sample E.coli liquid culture whose OD600 values are around 1.0
  2. Take 25ul, and pour into sample tubes.
  3. Centrifuge VLP with MiniCentrifuge. After tapping it, pour 2.5ul into tubes.
  4. Incubate for 24 hours.
  5. Centrifuge at 200g for 10 minutes.
  6. Suspend the pellets in 1ml PBS.
  7. Centrifuge at 200g for 10 minutes.
  8. Remove half of the supernatant, then suspend it again.

Scanning Electron Microscopy (2016 Summer Experiment)

Samples Centrifugal Force
INPNC-His-scFv(pSB3C5) 25ul+VLP2.5ul 3000g
BclA-His-scFv(pSB3C5)25ul+VLP2.5ul 3000g
INPNC-His-ctl 25ul+VLP2.5ul 3000g
BclA-His-ctl 25ul+VLP2.5ul 3000g
INPNC-His-scFv(pSB3C5) 25ul+VLP2.5ul 200g
BclA-His-scFv(pSB3C5)25ul+VLP2.5ul 200g
INPNC-His-ctl 25ul+VLP2.5ul 200g
BclA-His-ctl 25ul+VLP2.5ul 200g

*Sample Preparation (E.coli+VLP)*

  1. Prepare 45ml of sample E.coli liquid culture whose OD600 values are adjusted to 1.0
  2. Take 25ul, and pour into sample tubes.
  3. Centrifuge VLP with MiniCentrifuge. After tapping it, pour 2.5ul into tubes.
  4. Incubate for 24 hours.
  5. Centrifuge at 200g/3000g for 10 minutes.
  6. Suspend the pellets in 1ml PBS.
  7. Centrifuge at 200g/3000g for 10 minutes.
  8. Remove half of the supernatant, then suspend it again.

*Sample Preparation (PBS+VLP)*

  1. After tapping VLP, pour 2ul into 200ml PBS.
  2. Mark where pellets should have aggregated if E. coli were in the tube.
  3. Centrifuge at 200g for 10 minutes.
  4. Take 100ul of the supernatant, then pour into 1. tube.

Miniprep

Miniprep was performed using FastGene™Plasmid Mini Kit according to the manufacturer's protocols.

Gel Extraction

Gel Extraction was performed using FastGene™Plasmid Mini Kit(GP3→MilliQ), and Wizard® SV Gel and PCR according to the manufacturer's protocols.

Restriction Enzyme Digestion

Restriction enzyme treatment was performed using Takara Bio's or Promega's restriction enzymes according to the respective manufacturer's protocols.

Ligation

Ligation was performed using Takara Bio's Ligation High Ver.2 according to the manufacturer's protocols.

Transformation

  1. Thaw competent cells on ice.
  2. Add DNA sample (1~20ul) to competent cells. leave them on ice for 30 minutes
  3. Keep them in heating block for 45 seconds, then cool on ice for 2 minutes.
  4. Add 40~200ul SOC liquid culture medium, then incubate under shaking culture for 1hour 37°C.
  5. Seed it onto LB+antibiotics agar culture. Incubate for 24 hours at 37°C.

PCR

PCR was performed using Wizard® SV Gel and PCR, KAPA™HiFi HotStart ReadyMix (2x) according to the manufacturer's protocols

Westernblotting (Membrane fraction)

Sample Preparation

  1. Cultivate 100ml of E. coli culture whose OD600 values are 0.5
  2. Divide the 100ml cell culture in to 50ml tube, centrifuge 5000 rpm for 10 min
  3. Wash with PBS 30ml, centrifuge 5000 rpm for 10 min
  4. Resuspend with 50mM Tris(pH8.0) 100mM NaCl 10% glycerol 10ml
  5. Sonicate both tubes
  6. Centrifuge 4000 rpm for 10 min at room temperature
  7. Ultracentrifuge the supernatant at 45000 rpm (around 190000g) at room temperature, then remove the resulting supernatant
  8. Resuspend in guanidine buffer (50mM Tris (8.0) 300mM NaCl 10mM Imidazole 6M Guanidine-HCl 0.1% NP40 1mM DTT) to denature proteins
  9. Use Ni-NTA beads to purify the target protein
  10. Resuspend the purified protein in SDS-buffer
  11. Follow the protocol for Westernblotting

Primer list

Primer name Sequence Length Tm GC% Designer Manufacturer
m.scfv Fw TGTTTCTCCAGATGAACAGCCTGAGAG 27bp 66 47 Li Thermo Fisher Scientific Inc.
m.scfv Rv TCATCTGGAGAAACAACACATACTTGG 27bp 67 44 Li Thermo Fisher Scientific Inc.
c.scfv Fw AGGCGGATCCGGTATGGCCGAGGTGCAGC 29bp 74 69 Li Thermo Fisher Scientific Inc.
c.scfv Rv TACTAGTAGCGGCCGCTGCAGTACACCTAGGACGGT
GACCTTGG		 44bp 75 60 Li Thermo Fisher Scientific Inc.
m.BAN Fw TGCCGACCATGGCCGAGGTGCAGCTG 26bp 72 69 Li Thermo Fisher Scientific Inc.
m.BAN RV TCGGCCATGGTCGGCAGGGTGAAC 24bp 69 67 Li Thermo Fisher Scientific Inc.
VF2 TGCCACCTGACGTCTAAGAA 20bp 57 50 iGEM Thermo Fisher Scientific Inc.
VR ATTACCGCCTTTGAGTGAGC 20bp 56 50 iGEM Thermo Fisher Scientific Inc.
BAN+scFv.Fw ACTAGAGAAAGAGGAGAAATACTAGATGGCGTTC 34bp 62 41 Uchino Macrogen Japan Corp.
J23114+RBS.Rv GAACGCCATCTAGTATTTCTCCTCTTTCTCTAGTGC
TAGCATTGTACCTAGGACTGAGCTAGC 		63bp 72 46 Uchino Macrogen Japan Corp.
J23108+RBS.Rv GAACGCCATCTAGTATTTCTCCTCTTTCTCTAGT 34bp 62 41 Uchino Macrogen Japan Corp.
J23100+RBS.Rv GAACGCCATCTAGTATTTCTCCTCTTTCTCTAGTGC
TAGCACTGTACCTAGGACTGAGC 		59bp 72 47 Uchino Macrogen Japan Corp.
Cex.Fw GGTCCGGCCGGGTGCCAGGTG 21bp 71 81 Uchino Macrogen Japan Corp.
Clos.Fw TCATCAATGTCAGTTGAATTTTACAACTCTAAC 33bp 58 30 Uchino Macrogen Japan Corp.
INP_His_Cex.Rv CACCTGGCACCCGGCCGGACCATGATGATGATGATG
ATGGGATCCGCCTCCTGCA 		55bp 80 62 Uchino Macrogen Japan Corp.
INP_His_Clos.Rv GTTAGAGTTGTAAAATTCAACTGACATTGATGAATG
ATGATGATGATGATGGGATCCGCCTCCTGCA 		67bp 72 40 Uchino Macrogen Japan Corp.
BAN_His_Cex.Rv CACCTGGCACCCGGCCGGACCATGATGATGATGATG
ATGGGTCGGCAGGGTGAAC		 55bp 80 62 Uchino Macrogen Japan Corp.
BAN_His_Clos.Rv GTTAGAGTTGTAAAATTCAACTGACATTGATGAATG
ATGATGATGATGATGGGTCGGCAGGGTGAAC		 67bp 72 40 Uchino Macrogen Japan Corp.
scFv_ctl_Fw TAGCACTAGAGAAAGAGGAGAAATACTAGATGGCCG
AGGTGCAGCTGG		 48bp 72 50 Uchino Macrogen Japan Corp.
scFv_ctl_Rv, CBDcex_ctl_Rv, CBDclos_ctl_Rv CATCTAGTATTTCTCCTCTTTCTCTAGTGCTAGC 34bp 61 41 Uchino Macrogen Japan Corp.
CBDcex_ctl_Fw TAGCACTAGAGAAAGAGGAGAAATACTAGATGGGTC
CGGCCGGGTGCCA		 49bp 74 53 Uchino Macrogen Japan Corp.
CBDclos_ctl_Fw TAGCACTAGAGAAAGAGGAGAAATACTAGATGTCAT
CAATGTCAGTTGAATTTTACAAC		 59bp 67 34 Uchino Macrogen Japan Corp.
RFP_His_CBDcex.Rv CCACAGCACCTGGCACCCGGCCGGACCATGATGATG
ATGATGATGTTATTAAGCACCGGTGGAGTGACG		 69bp 79 57 Uchino Macrogen Japan Corp.
RFP_His_CBDclos.Rv GAGTTGTAAAATTCAACTGACATTGATGAATGATGA
TGATGATGATGTTATTAAGCACCGGTGGAGTGACG		 71bp 71 38 Uchino Macrogen Japan Corp.
INP primer for CBD.Fw ACGACGACTGGATCGAAGTTAAAG 24bp 58 46 Miyazaki Hokkaido System Science Co., Ltd.
CBDcex primer.Rv GCCGTTGAAGCCGAACTG 18bp 57 61 Miyazaki Hokkaido System Science Co., Ltd.
scFv primer1'Fw TGCAACCTCTGCATTCATCTT 21bp 56 43 Miyazaki Hokkaido System Science Co., Ltd.
scFv primer2'Rv CCCTGGCCCCAGTAGTCA 18bp 59 67 Miyazaki Hokkaido System Science Co., Ltd.
rRNA 16S forward primer1 GACGGGGGCCCGCACAAG 18bp 65 78 Miyazaki Hokkaido System Science Co., Ltd.
rRNA 16S reverse primer1 CTGGTCGTAAGGGCCATG 18bp 56 61 Miyazaki Hokkaido System Science Co., Ltd.
Prefix-F GAATTCGCGGCCGCTTCTAG 20bp 60 60 iGEM Hokkaido System Science Co., Ltd.
Suffix-R CTGCAGCGGCCGCTACTAGTA 21bp 62 62 iGEM Hokkaido System Science Co., Ltd.
INP_His_coding_Rv ggaCTGCAGCGGCCGCTACTAGTACTAATGATGATG
ATGATGATGggatccgcctcctgcaccg		 64bp 78 56 Uchino invitrogen
INP_His_coding_Fw ctgGAATTCGCGGCCGCTTCTAGAGatgaccctgga
caaagctctgg		 47bp 75bp 57 Uchino invitrogen

Sequence

We outsourced the sequencing to Macrogen
http://www.macrogen-japan.co.jp/cap_seq_0203.php