Difference between revisions of "Team:British Columbia/Project/S-Layer/Laccases"

Abstract

Lignin is a complex heteropolymer consisting of aromatic units, which are connected to each other through a variety of bonds.The complex polymer combines with cellulosic fibers in a highly recalcitrant structure, which limits the the accessibility of cellulose to cellulolytic enzymes. For this part of our project, we attempt to engineer C. crescentus S-layer to express lignin-modifying enzymes to pretreat raw biomass and make it more accessible to cellulases. We expect that the "delignification" step will enhance hydrolysis rate and overall sugar yield.

Key Achievements

Introduction

Current pretreatment and hydrolysis approaches to biomass depolymerization involve thermochemical methods that apply alkaline chemicals, in addition to high heat and pressure (Chundawat S. 2011). These methods enhance the fractionation of lignin and hemicellulose components from the plant cell wall, thereby allowing enzymes access to the cellulosic fraction for downstream processing. Although these methods are effective, their high cost to industries and to the environment requires that alternative methods to remove the more recalcitrant components of lignocellulosic biomass, are erected. We intend to produce a system that minimally relies on external thermochemical treatments to make the cellulosic component of biomass available for valuable-chemical production. To achieve this, we attempted to engineer surface layer expression of a small laccase derived from Amycolatopsis sp. 75iv2 shown to act on and degrade lignin (Majumdar S. 2014), in Caulobacter crescentus.

Laccases belong to a superfamily of enzymes called multicopper oxidases (MCO), and are expressed by several rot-fungi and soil bacteria (Sirim D. 2011). As an MCO, they catalyze the one-electron oxidation of substrates through associated four-electron reductions of molecular oxygen to water, using four copper ions coordinated in designated copper centers (Jones Solomon E. 2015, Kunamneni A. 2007). Their broad phenolic and polyphenolic substrate specificity allows for direct transformation of lignin, or removal of toxic phenols that arise during lignocellulosic biomass pre-treatment (Kunamneni A. 2007).

For this part of our project we have aimed to display laccase activity fused to the rsaA protein for the display on Caulobacter cell surface. The use of fusion proteins expressed on the surface of the cell would help to "pretreat" raw biomass by removing lignin component and allowing cellulases access to the cellulosic fraction of the biomass.

Methods

All Caulobacter cultures were grown in PYE media supplemented with 2 μg/ml chloramphenicol unless stated otherwise. All plasmid DNA extractions were performed with QIAprep Spin Miniprep Kit (Qiagen). DNA purification from gels or PCR mixtures were done with NucleoSpin® Gel and PCR Clean-up kit(Macherey-Nagel).

Cloning of laccase enzyme into rsaA plasmid in C. crescentus

The small laccase (sLAC) gene from Amycolatopsis sp. 75iv2 ATCC 39116 was amplified using the following primers: sLAC_pSB1C3_F (5'-TCCgaattcgcggccgcttctagATGCAGGGCACGACCCGG) and sLAC_pSB1C3_R (5'-TCCtactagtagcggccgctgcagTCAGTGTTCGTGGACACC) to clone the construct in pSB1C3. The amplicon was digested with EcoRI and PstI, PCR purified and ligated into a pSB1C3, which was also digested EcoRI and PstI and gel purified. Site-directed mutagenesis (SDM) was done to remove any forbidden cut-sites using a protocol outlined in Nobebook section and the following primers:SDM_sLAC_F (5'-GTACGCCGAGAAGATTTCCGACGAGCTGTAC) and SDM_sLAC_R(5'-GTACAGCTCGTCGGAAATCTTCTCGGCGTAC). After the mutation was sequence confirmed, the selected region of laccase gene was amplified to add the BglII and PstI using following the primers: 5'-GTTTCTTCAGATCTACGACCCGGCGGATCACG and 5'-GTTTCTTCCTGCAGAGACACCGGCCGGCATCGT . The sLAC amplicon was digested with BglII and PstI restriction enzymes, PCR purified and ligated into a p4A723 RsaA plasmid conferring chloramphenicol (CM) resistance. The ligation mix was transformed into chemically competent DH5alpha E. coli cells and transformed cells were plated onto LB + CM (12.5 µg/mL). Insertion of sLAC into p4A723 was preliminarily confirmed by colony PCR of selected transformants, using the aforementioned primers for sLAC, and checking for appropriately sized bands (850 bp). The selected colonies were sent for Sanger sequencing using the IRAT_F(5'CGGAGCCGCCAGAACGGTCAGGCCGACATTCAC) for confirmation. After sequence confirmation, the isolated construct DNA were electroporated into electrocompetent C.crescentus with an RsaA Amber mutation and colonies were grown on a PYE-CM plate. One colony was selected and streaked onto a fresh plate, which would be used for all future assays.

Cloning of a laccase enzyme into pSB1C3 plasmid with Ptac promoter and rbs

The amplified with sLAC_pSB1C3_F and sLAC_pSB1C3_R laccase was digested using EcoRI and XbaI restriction enzymes. Ptac and rbs were amplified and digested as descibed in Methods for cellulases cloning. The plasmid digest was then purified by agarose gel purification while the pTAC RBS digest was purified by PCR purification. Both purified digest were ligated together using standard ligation protocol and ligation mix was then transformed in chemically competent DH5α E. coli.

Copper toxicity test

Caulobacter was inoculated in triplicates in PYE media supplemented with varying concentrations (from 0 to 10mM) of CuSO4. The cultures were incubated at 30C for 72 hours, while shaking. The OD600 was measured to determine concentrations of CuSO4 which inhibit Caulobacter growth.

ABTS Assay to characterize sLAC activity

sLac Caulobacter and p4A723 as a negative control were inoculated into flasks containing 15 mL cultures of PYE in the presence or absence of 300 µM CuSO4. The cultures were grown for 3 days, OD600 was normalized and ABTS assay was performed in 96-well plates. The protocols were derived from More et al(2011). Specifically, 176 µl of Sodium Acetate (pH 5), 10 µl of a culture, 4 µl of 0.5 M CuSO4 (10 mM CuSO4 final concentration) and 10 µl of 10 mM ABTS (0.5 mM ABTS final concentration). The plate for incubated at 30C for an hour and absorbance at 420nm was read.

Results

The small laccases(sLac) was selected as a candidate to be expressed on S-layer due to it small size (276aa). The region of 4-272aa was successfully cloned in p4A723 plasmid and transformed in Caulobacter.

Because sLAC requires CuSO4 for proper folding of its catalytic site (Majumdar S. 2014), we performed a CuSO4 toxicity test on p4A723 Caulobacter to determine the maximum concentration of copper that the bacterium could tolerate. First, we did a test with a wide range of copper concentrations. After 2 days of incubation we determined the growth of Caulobacter falls off steeply when grown in the presence 0.5 mM of CuSO4 (Fig. 1A). Next we performed the same assay with a narrow range of copper to determine whether the bacterium would grow in the presence of CuSO4 concentrations between 0.1 mM and 0.5 mM. For this assay we inoculate Caulobacter expressing sLac on the surface. From the growth results we determined that 300 µM is not toxic to the cells, so we used the concentration for our future experiments(Fig. 1B).

Figure 1. Copper toxicity test. A) Growth measurements of p4A723 Caulobacter cultures grown for 2 days in triplicates in PYE supplemented with 0, 0.0001, 0.001, 0.01, 0.5, 1 and 10mM CuSO4. B) Growth measurements of sLac Caulobacter in PYE supplemented with 0.1, 0.2, 0.3, 0.4, 0.5 mM CuSo4 to more precisely determine toxic concentration of copper.

To measure laccase activity on the surface of Caulobacter we performed ABTS assay. The assay was performed in the presence and absence of copper. The sLac-expressing Caulobacter demostastated slightly higher activity than the control. Additional tests are required to confirm proper folding and activity of sLac

Conclusion

Display of lignin-modifying enzymes on cell surface is inheretantly more difficult than the display of cellulases due to their co-factor dependancies. Also most laccases are homodimers or homotrimers what makes their proper folding on cell surface even more challenging. The sLac we used in our study is a homotrimer, so it's fusion to rsaA might not lead to a completely functional enzyme. The selection of small single-chain laccases is necessary to validate the approach and confirm the lignin transformation activitiesleading to the enhanced hydrolysis rate.

References

Chundawat S, Beckham G, Himmel M, Dale B. 2011. Deconstruction of Lignocellulosic Biomass to Fuels and Chemicals. Annual Review of Chemical and Biomolecular Engineering 2:121-145.

Sirim D, Wagner F, Wang L, Schmid R, Pleiss J. 2011. The Laccase Engineering Database: a classification and analysis system for laccases and related multicopper oxidases. Database 2011:bar006.

Jones Solomon E. 2015. Electron transfer and reaction mechanism of laccases. Cell. Mol. Life Sci. 72:869-883.

Reiss R, Ihssen J, Richter M, Eichhorn E, Schilling B, Thöny-Meyer L. 2013. Laccase versus Laccase-Like Multi-Copper Oxidase: A Comparative Study of Similar Enzymes with Diverse Substrate Spectra. PLoS ONE 8:e65633.

Kunamneni A, Ballesteros A, Plou FJ, Alcalde M. 2007. Fungal laccase – a versatile enzyme for biotechnological applications, p 233-245. In Mendez-Vilas A (ed). Communicating current research and educational topics and trends in applied microbiology. FORMATEX, Badajoz.

Majumdar S, Lukk T, Solbiati J, Bauer S, Nair S, Cronan J, Gerlt J. 2014. Roles of Small Laccases from Streptomyces in Lignin Degradation. Biochemistry 53:4047-4058.

More S, Malini S. 2011. Isolation, Purification, and Characterization of Fungal Laccase from Pleurotus sp. Enzyme Research 2011:1-7.