(A: 6.25μL/min, GECO cells B: 6.25μL/min, C: GECO+Piezo1 cells. CHO-K1 cell suspension was injected into gelatin treated microfluidics chips and incubated at 37°C, 5% CO2 incubator for 24 hours. Culture medium was then injected into the chip channels (with the inflow rate of 0μL/min,6.25μL/min and 50μL/min and controlled by micro syringe pump). The pump of culture medium started at t=10s. Cells’ response towards different shear force was measured by R-GECO fluorescence intensity under live cell imaging.)

At the pumping velocity of 6.25μL/min, GECO cells didn’t display much fluorescence change. While for GECO+Piezo1 cells, it can sense shear stress thus causing the influx of Ca2+.

See the design of microfluidics chip and the simulation of force field at Model

CHO-K1 cell suspension was injected into gelatin treated microfluidics chips and incubated at 37°C, 5% CO2 incubator for 24 hours. Then the culture medium was injected into the chip channels (with the inflow rate of 25μL/min, 50μL/min and100μL/min controlled by micro syringe pump). The pump of culture medium started at t=10s. Cells’ response towards different shear force was measured by R-GECO fluorescence intensity under live cell imaging.

See the result discussion at Result

4. Validation of audiogenetics

We designed both ultrasonic and audible sonic simulation hardware to quantitatively test stimulated cells.

Audible sonic stimulation

Buzzers, balanced amatures and speakers were used as sonic stimulators. Only buzzers induced obvious cell response in high frequency conditions (15kHz and 20kHz). A buzzer was attached to the bottom of a cell dish. When the buzzer was working, cells around the buzzer boundary was observed under microscope. Strong fluorescence intensity increased immediately after the buzzer was started. Cell fluorescence intensity increased greatly when stimulated by 15K and 20kHz sound. While no obvious fluorescence intensity change when GECO cells (without MS channel) were stimulated (Fig.8 ).

Fig.7 B

Fig.7 A

Fig. 8 (A) R-GECO+Piezo1 cell fluorescence intensity increased greatly when stimulated by 15K and 20KHz sound. While no obvious fluorescence intensity changed when GECO cells (without MS channel) were stimulated (B).

Ultrasonic Stimulation

Ultrasonic transducers can transform electric energy into ultrasonic radiant energy. There were four kinds of ultrasonic transducer tried. Pressure fields of 108kHz and 1.1MHz transducers were simulated for different power and distance. The pressure field distribution changes smoothly, while the pressure distribution was quite chaos in condition of 1.1MHz. Only strong cell response was observed in condition of 108kHz stimulation as shown in Fig9. No obvious cell response was observed for 1.1MHz stimulation.

Fig10. 1.1MHz, Adjustable Power Ultrasonic Transducer

Fig. 11 108KHz,4.1W Ultrasonic Stimulation Device

Fig 12. A

Fig 12. B

Fig.12 C

Fig.12 D

Fig. 12 (A) Pressure distribution of 108KHz ultrasonic transducer, the transducer was 1.0mm far above the cell layer. (B) Pressure distribution of 1.1MHz ultrasonic transducer. 3D pressure distribution for 108KHz condition (C) and 1.1MHz condition (D).

In experiment, 108KHz 4.1W ultrasonic device induced a strong cell response as is shown in the following. However, no cell response was observed when cells were stimulated by 1.1MHz transducer with the same power.

Fig.14 Fluorescence response of R-GECO+Piezo1 cell when stimulated by 108KHz ultrasonic transducer from 10s to 30s.

Long-term Stimulation

NFAT part can start gene expression when triggered by Ca2+ influx. The NFAT+Piezo1 cell expresses GFP when its MS channels open inducing a Ca2+ influx. Long-term stimulation (21h, 108KHz, 4.1W ultrasonic stimulation) experiment on Piezo1+NFAT cells showed GFP express level increased after 21h stimulation. 108KHz ultrasonic device was programmed to stimulate cells for duty cycle of 5s on and 10s off.

5. Selection by Cre-loxp system

Cre-loxp system played an important role in directed evolution, because we needed to screen a single cell colony only with one loxp site in the genome of each CHO-K1 cell for single copy insert of mutated TRPC5. Here we tested the function of cre-loxp system by making 3 different groups of transfection in the cells that already inserted with loxp gene on genomes using Lipofectamine® 3000.

Fig.15 Result of the test of Cre-loxp system

Few cells survives (Fig15. a) after antibiotics screening without transfecting Cre recombinase gene, which means that there is a small possibility that loxp gene can insert into genomes by interior transposase in cells. To find out the optimal ratio of Cre recombinase gene to Neomycin-loxp gene in the process of transfection, we compared two different ratio, 3:3 (Fig15. b) and 1:3 (Fig15. c), with equal amount of Neomycin-loxp gene but different amount of Cre recombinase gene.(All pictures was captured by Nikon microscope (Nikon TS100) 120 hours after transfection, 600 μg/ml neomycin were added 72hours screening.

From observation, we know that excess Cre recombinase is not appropriate in transfection process. The most possible reason is that surplus Cre recombinase is harmful for cells, so they may random cut and recombine genes in cell’s genome. Thus, we finally chose 1:3 as the ratio of Cre recombinase gene to Neomycin-loxp gene in transfection.

6. Mutagenesis of TRPC5

Mutation frequency calibration

1. Define ideal mutation frequency

Mutation frequency is the product of DNA polymerase error rate and number of duplications. It depends on initial target amount and fold amplification. Mutation frequencies of 1~4 amino acid changes (2~7 nucleotide changes) per gene are commonly employed.

We have mutated the ankyrin repeats region (734bp length) of TRPC5 by employ 500ng initial tartget and 32 cycle amplification according to the protocol of GeneMorph II Random Mutagenesis Kit (Agilent Technologies,Catalog #200550).

2. Calibration of mutation frequency by sequencing

To calibrate the mutation frequency in experimental condition, we sequenced 20 mutated TRPC5 samples in the region of ankyrin repeats. The table below shows the correspondence between mutation(s) and sequenced sample numbers.

Table 1 Practical mutations and sample numbers

5 samples have been detected mutation(s). However, the transformation result showed that the digestion might be incomplete (Table 2). Still, the data could offer us some information. Basically, the practical mutation frequency with initial target amount of 500ng was similar with the theoretical mutation frequency.

Table 2. Transformation result of mutated TRPC5 ligation product vs control

To construct a large-scale mutation library with different mutation frequencies in the specific region, we also did error-prone PCR with different initial target amounts to get TRPC5 mutants with low, medium and high mutation rate.

Library construction

3. Calculate competent cell efficiency from experimental result

(1). Formula: \frac{\text{Colonies}}{\text{ng of DNA plated}}\times 1000ng/\mu g

(2). Calculation: 237 / 0.02 x 1000=1.185x107 cfu/μg

(3). Actual meaning: 20pg, 5640bp TRPC5 plasmid → 3.457x106 copies

3.457x106 / 237=14586, which means 1 of 14586 plasmids would actually grow on the plate.

4. Compare three methods for mutation library construction

Table 5. Transformation Results of Three Methods for Mutation Library Construction. All groups were transformed with 5μl products after all experiment procedure with 100ul competent cell. Restriction Enzyme Digestion and Ligation method and Gibson assembly method used the same mole of TRPC5 backbone. Transformation operations were all the same.

From the table, we can know Restriction Enzyme Digestion and Ligation method is the most efficient way of constructing library.

(1). 62ng, 4906bp plasmid → 1.232x1010 copies

(2). Efficiency= \frac{(1772-330)\times 20 \div 5}{1.232 \times 10^10 \times \frac{1}{14586}}\times 100\% = 0.68\%

We needed to consider their effect on CHO-k1 cell if being directly transfected without transformation and plasmid construction. Since the ligation efficiency was 0.68%, we did an experiment comparing the survival rate of CHO-k1 cells after being transfected with linear DNA and circular DNA. After antibiotic screening, we luckily found that the former one were almost dead, while the latter one were good. Thus we could directly transfect the ligation products into cell without transformation, preventing the mutation library from decreasing.

See Details

7. Cell screening for audiogenetics test

1. Transfect the cells with loxp gene, pNFAT+GFP gene, R-GECO gene (calcium indicator) by PiggyBac system and sort them into single colonies by FACS (BD FACSAria)

Fig.16 The R-GECO and GFP fluorescence of wild type cells and cells transfecd with loxp site, pNFAT+GFP gene and R-GECO gene

The data was collected in the process of sorting by FACS, total cells count is 10000. Cells transfected with R-GECO gene will continually express R-GECO, because CAG promoter is a constitutive promoter. Thus, most cells have red fluorescence (Fig16. b) compare with wild type control (Fig16. a). Cells transfected with pNFAT+GFP should not express GFP because promoter NFAT need to be activated by calcium signal indirectly. However, most cells still can express GFP (Fig.16 d) compare with wild type control (Fig.16 c), which mean there is some leaky expression of promoter NFAT or background calcium activity.

2. Select the single cell colony only with one copy number of loxp by qPCR


To evaluate the efficiency of each mutated channels, single cell colony with only one copy number is required when testing, so we designed the following experiments to achieve it. 



2.1 Primer design and primer efficiency test

The real-time PCR primers (Forward: TTGTCAAGACCGACCTGTCC, Reverse: TTCAGTGACAACGTCGAGCA) were designed by Primer-BLAST, a tool for finding specific primers, followed by BLAST specificity check. Firstly, we selected an appropriate annealing temperature to avoid unnecessary amplification as well as improving primer efficiency by normal PCR test in wild type CHO-K1 genomes, the result indicates that 62℃ may be the most appropriate annealing temperature. In addition, we also confirmed that the amplification product was accurate at 62℃ when the target was cells genome that transfected with neomycin-loxp gene by sequencing the PCR product.

Real-time PCR ( here we used TaKaRa-SYBR Premix Ex Taq II(Tli RNaseH Plus) ran in the ABI StepOne Plus qPCR instrument) can be used to calculate the primer efficiency of PCR amplification via Equation 1. In which X_n = PCR product quantity after n cycles, X_0 = initial copy number, E = amplification efficiency, n = cycle number.

X_n=x_0 \times (1+E)^n

Equation 1

The efficiency of the primer is 104% by calculating (Within the usual margin of error, which is 90%~110%). Also, the melt curve has only one peak, which means the designed primer is quite specific to the transfected CHO-K1 cell’s genomic DNA.


2.2 Select the cell colony with single copy number

In each qPCR screening experiment, we made a standard curve by employing a series of 5-fold dilution gradient Neomycin-loxp gene with known mole amount. Therefore, we could quantitatively examined the copy number of neomycin-loxp gene in single colony genomes by fitting the sample Ct data in the standard amplification plot. Standard curve was made by using the following data.

Table 10. Log(Relative Quantity) vs. Ct

Fig. 17 Fitted Standard Curve

(within the usual margins of error, which is 90%~110%)

Figure 18. Melt Curve of Neomycin-loxp Transfected CHO-K1 Cell’s gDNA

Copy Number

Table 11. Neomycin-loxp Copy Number of CHO-K1 Cell

Relative Quantity =10^\frac{\text{Ct}-14.902}{-3.1101}

Copy Number :

Plasmid used in standard curve: 0.1021 fmol, Relative Quantity=1

c=\frac{\text{Quantity}\cdot 102.1}{\text{fmole} } (c: copy number)

Figure 19. Amplification Plot for Standard

Figure 20. Amplification Plot for Sample

The efficiency of PiggyBac transposon system ranged from 2% for one transposon to 0.5% for five transposons ^[1]. Consequently, it’s quite possible for us to screen out the cells with single or low copies of Neomycin-loxp.

In practical experiments, we totally test 18 different single colony genomes. The lowest copy number of those selected CHO-K1 cell transfected with Neomycin-loxp is around 4, which was not good enough. The reason may be that the designed primer was not so satisfying. Also, the contamination during real-time PCR was hard to avoid. To get cells with single copy of Neomycin-loxp, we still need to design better primers as well as paying attention to the experiment operations.

3. Transfect the cells with mutated TRPC5 by Cre-loxp system

After we’ve selected the CHO-K1 cell transfected with single copy of NeoLoxp, we could transfect mutated TRPC5 into the cell’s genomic DNA using Cre-Loxp recombination system. Then we would use fluorescence activated cell sorting(FACS) to select the cells with high intensity of GFP after long term stimulation. To realize high-throughput screening, we designed a device as shown in the figure below. Cells are seeded at the larger area side of the bottle, and the bottle is fixed above vortex through a holder and foam. Then we are going to place this device in cell culture incubator with vortex running for 20 hours, to fulfill long term mechanical force stimulation.

Figure 21. Self-designed Device for Long Term Stimulation

After the first round of mutation and screening, we still need to continue mutation based on the previous result. We will extract genomic DNA of the screened-out CHO-K1 cell, performing polymerase chain reaction with the mutation primer and sending the PCR product for sequencing. Through alignment of the mutated TRPC5 with normal one, we could clearly see which base site has been mutated. Combing with the TRPC5 structure we’ve known, we may explain why the specific site mutation could induce channel’s greater sensitivity to mechanical force. Then we could specify the mutation region every time, repeating then huge-library mutation and high-throughout screening procedure, thus realizing directed evolution.

Ideally, we would like to screen out then mutated TRPC5 with high sensitivity to mechanical force. As for the audiogenetics, we hope to screen out cells which are able to response to specific sound frequency, achieving precise and orthogonal audio regulation.

References

1. ↑ Lu, X. and W. Huang, PiggyBac mediated multiplex gene transfer in mouse embryonic stem cell. PLoS One, 2014. 9(12): p. ell 5072