Team:Hamburg/Notebook

10 mL SOC Medium

  • 2 g Bacto-Tryptone
  • 0.019 g KCl
  • 0.5 g Bacto-Yeast extract
  • 0.05 g NaCl
  • 0.207 g MgCl2 · 6 H2O
  • 0.036 g Glucose

were dissolved in 10 mL H2O and stored at 4°C in 1 mL aliquots.

100 mL TB PIPES Buffer

  • 1.87 g KCl
  • 0.17 g CaCl2
  • 15.1 g PIPES

were dissolved in 100 mL H2O. NaOH was added to adjust the pH to 6.7.

1 L LB Medium

  • 20.3 g Bacto-Tryptone
  • 5 g Bacto-Yeast extract
  • 10.1 g NaCl

were dissolved in 1 L H2O and autoclaved for 20 min at 120°C 15 pound-force per square inch (psi), to neutralize any bacterial contaminants.

15 LB-Agar / CAmp Plates

  • 10 g Bacto-Tryptone
  • 10 g NaCl
  • 15 g Agar
  • 5 g Bacto-Yeast extract

Were dissolved in 950 mL H2O and autoclaved for 20 min at 120°C 15 psi.

  • 1 mL Chloramphenicol (25 mg/mL)

was added to the LB-Agar at 55°C and poured into 15 sterile petri dishes. The plates were stored at 4°C.

1 L 100 mM CaCl2 Buffer

  • 11.1 g CaCl2

was dissolved in 1 L H2O and autoclaved for 20 min at 120°C 15 psi.

100 mL 85 mM CaCl2, 15% Glycerol Buffer

  • 85 mL 100mM CaCl2
  • 15 mL Glycerol

were mixed and autoclaved for 20 min at 120°C 15 psi.

1 L 100 mM MgCl2

  • 20.33 g MgCl2 · 6 H2O

was dissolved in 1 L H2O and autoclaved for 20 min at 120°C 15 psi.

10 LB Agar / Kanamycin plates

  • 20 g LB-Agar

Was dissolved in 500 mL H2O and autoclaved at 120°C 15 psi.

  • 1 mL Kanamycin (25 mg/mL)

was added to the LB-Agar at 55°C and poured into 10 sterile petri dishes. The plates were stored at 4°C.

500 mL LB-Agar

  • 25.0 g, 25.1 g, 24.99 g and 25.13 g LB Medium

were dissolved in 4x 1 L H2O and autoclaved at 120°C 15 psi.

Transformation of pcDNA3 and pBAD/Rluc

150 µL competent JW 3367-3 cells were split into 3x50 µL. 57 ng pcDNA3 and 80 ng pBAD/Rluc were added to 1 competent cell tube each and mixed. The cells were incubated on ice for 1.5 h, heat shock at 42°C for 1 min and chilled on ice for 3 min. 950 µL pre-warmed LB medium was added and the cells were incubated at 37°C and 900 rpm for 1h.

The cells were harvested by centrifugation at 3000g for 1 min, resuspended in 50 µL LB medium and 40 µL were plated onto LB Agar/Amp plates. The remaining 10 µL were plated onto different plates. All plates were incubated overnight at 37°C.

Transformation Efficiency

plasmid number of colonies
pcDNA3 > 1000
pcDNA3 (1:5) 408
pBAD/Rluc 350
pBAD/Rluc 75

The negative controls did not show cell growth.

Preparation of 0.9 % NaCl Solution

  1. 1.8 g NaCl was solved in 200 mL water.
  2. NaCl solution was mixed with a magnetic stirrer.
  3. NaCl solution was filtrated over a 0.22 μm sterile filter into a glass flask.

Preparation of 2.5 % Alginate Solution

  1. 2.5 g Alginic Acid was slowly dissolved in 100 mL of the 0.9 % NaCl solution
  2. The solution was mixed with a magnetic stirrer.
  3. The solution was autoclaved for 20 min at 121 °C.

Preparation of a CaCl2 Solution (100 mM)

  1. 1.1098 g CaCl2 was solved in 100 mL water.
  2. CaCl2 solution was filtrated over a 0.22 μm sterile filter into a glass flask.

Preparation of a CaCl2 Solution (100 mM)

  1. 1.1098 g CaCl2 was solved in 100 mL water.
  2. CaCl2 solution was filtrated over a 0.22 μm sterile filter into a glass flask.

Transformation of JW 3367-3 (160427DW01) with fluorescence reporter systems: BBa_E0430, BBa_E0240, BBa_R0082

To 4 x 50 μL competent JW 3367-3 were added:

  • 0.5 μL Part BBa_E0430: enhanced yellow fluorescent protein derived from A. victoria GFP (160607DW02)
  • 0.5 μL Part BBa_E0240: GFP (160607DW02)
  • 0.5 μL Part BBa_R0082: Promoter OmpR (160505DC02) as positive control
  • nothing as negative control
The cells were incubated on ice for 45 min, heat shocked at 42 °C for 1 min and put on ice for 5 minutes. 950 μL LB media was added to each tube. The cells were incubated at 37 °C, 900 RPM for 1.5 h and brought out on LB-Agar/CAmp plates.
The plates contained:
LOT# plate # of colonies
160607DW03 Part:BBa_E0430 19
160607DW04 Part:BBa_E0240 154
160607DW05 Par:BBa_R0082 (positive control) 36
160607DW06 negative control 0

Fabrication of Alginate Beads

  1. 4 mL of 2.5 % Alginic Acid solution was dyed with 2 droplets of red food color.
  2. 50 mL of CaCl2 solution was filtrated over a 0.22 μm sterile filter into a beaker.
  3. Alginic Acid was pipetted into the CaCl2 solution.
  4. Alginate Beads formed.
  5. Different sized Alginate Beads were produced using 1000 μL, 200 μL and 10 μL Eppendorf pipettes.
  6. Polymerized alginate beads were separated with a coffee filter.

Preparation of a CaCl2 Solution (100 mM)

  1. 4.44 g CaCl2 was solved in 400 mL water.
  2. CaCl2 solution was filtrated over a 0.22 μm sterile filter into a glass flask

Fabrication of Alginate Beads

  1. 50 mL of CaCl2 solution was filtrated over a 0.22 μm sterile filter into a beaker.
  2. Alginic acid was pipetted into the CaCl2 solution.
  3. Alginate beads formed.
  4. Different sized alginate beads were produced using 1000 μL, 200 μL and 10 μL Eppendorf pipettes.
  5. Polymerized alginate beads were separated with a coffee filter.
  6. The beads were stored in different places and the stability was assessed.
    storage stability
    RT very stable
    fridge very stable
    freezer not stable (without glycerol)
  7. Images were captured with an optical muscope.
  8. Beads were put in the muwave to test stability: aliginate capsules were stable.

Minipreparation of BBa_E0240 and BBA_E0430

The overnight cultures from the day before were centrifuged for 3 min at 5000 x g. The supernatant was discarded. For the further steps see the protocol from the GeneJet Plasmid Miniprep Kit from Thermo Scientific. #K0503. All centrifugation steps were performed at 13000 x g. In the end the columns were eluted with 20 μL elution buffer twice. The dsDNA concentration was measured at the NanoDrop.

LOT# Part DNA concentration
160615CL01 BBA_E0430 159.66 ng/μL
160615PW01 BBA_E0240 145.56 ng/μL

Restriction of BBa_E0240 (GFP), BBA_E0430 (eYFP) and BBa_R0082 (OmpR)

BBa_E0240 BBa_E0430 BBa_R0082
Volume 3.44 μL 3.13 μL 1.37 μL
XbaI 1 μL 1 μL 1 μL
SpeI 1 μL 1 μL 1 μL
10x NEB 2.1 Buffer 5 μL 5 μL 5 μL
water 39.76 μL 39.87 μL 42.63 μL
LOT% 160615CL02 160615CL03 160615PW02
The restriction preparations were incubated at 37 °C for 10 min and afterwards heat-inactivated at 80 °C for 20 min.

Ligation of Restricted BBa_E0240 (GFP), BBA_E0430 (eYFP) with BBa_R0082 (OmpR)

BBa_E0240 with BBa_R0082 BBa_E0430 with BBa_R0082
Volume Reporters 2 μL BBa_E0240 restricted 2 μL BBa_E0430 restricted
Volume OmpR 2 μL 2 μL
10x T4 DNA Ligase Buffer 2 μL 2 μL
T4 DNA Ligase 1 μL 1 μL
water 13 μL 13 μL
LOT% 160615PW04 160615PW03
The ligation preparations were incubated at RT for 10 min and afterwards heat-inactivated at 80 °C for 20 min.

Transformation of JW 3367-3 with Ligation Preparations

14 μL BBa_E0240 ligated with OmpR was added to 150 μL competent JW 3367-3 cells and mixed. 14 μL BBa_E0430 ligated with OmpR was added to 150 μL competent JW 3367-3 cells and mixed. The cells were incubated on ice for 1.5 h, heat shocked at 42 °C for 1 min and chilled on ice for 3 min. 950 μL pre-warmed LB medium was added to each tube and the cells were incubated at 37 °C and 900 rpm for 1 h. The cells were brought onto LB Agar plates with Chloramphenicol (CAmp) as a selection antibiotic and stored at 37 °C overnight.

  • 160615PW05: LB-Agar CAmp plates with JW 3357-3 transformed with BBa_R0082/BBa_E0240
  • 160615CL04: LB-Agar CAmp plates with JW 3357-3 transformed with BBa_R0082/BBa_E0430

Fabrication of LB-Agar-Plates with Chloramphenicol

  1. 50 g  of LB-Agar (Lucia/Miller) was solved in 1000 mL water.
  2. Autoclaved for 1.5 h at 121 °C.
  3. Added 250 μL of chloramphenicol.
  4. LB-Agar solution was prepared under sterile conditions in petri dishes and after the cooling process was it stored at 4 °C in the fridge

Transformation of DH5α and BL21 Cells

  1. Competent cells were took from the -80 °C freezer onto ice for 30 min (JW 3367-3 / 160427DW01).
  2. 2.5 μL of plasmid pET_Duet_1 with a Hat t7 promoter and a yellow fluorescent protein (YFP) insert was prepared on ice for 1.5 h.
  3. Heat-shock at 42 °C for 45 s.
  4. Transformed cells chilled on ice for 3 min.
  5. 850 μL LB-Medium was warmed up to 37 °C.
  6. After the 3 min the LB-Medium was added to the transformed cells.
  7. Incubation of the cells at 37 °C, 900 rpm for 1 h.
  8. Centrifugation at 4500 rpm for 2 min, afterwards 950 μL were removed.
  9. The pelleted cells resuspended with the rest (~50 μL) of the LB-Medium.
  10. 50 μL of the cell solution on a LB-Agar-Plate with Ampicillin was plated out.
  11. Plates was stored overnight at 37 °C.
    • 160615ST01 => BL21 E. coli Strain
    • 160615ST02 => BL21 E. coli Strain
    • 160615ST03 => DH5α E. coli Strain

Preparation of Bacteria for Alginate Encapsulation

  1. Cultures (160615ST01, 160615ST02, 160615ST03) were picked from the incubator.
  2. 1 mL LB-Medium with bacteria was pipetted in a cuvette and OD600 was measured versus a blank measurement of LB-Medium.
    • OD600(DH5α)=2.422
    • OD600(BL21)=1.224
  4. Cells were pipetted from the liquid culture to 1 mL into 1.5 mL Eppendorf tubes.

Isolation of Plasmid pSB1C3-LacZα (160616DC01)

  1. Isolation using the Thermo Scientific Purification Kit.
  2. Measurement of plasmid concentrations.
    • 160620CSW01: 45,62 ng/μl
    • 160620CSW02: 63,97 ng/μl

Restriction of OmpR-ColA and BBa_I732018 (LacZα)

  1. Restriction of OmpR-ColA with SpeI and PstI.
  2. Restriction of BBa-I732018 with PstI and XbaI.
BBA_I732018 OmpR
Volume Plasmid DNA 7.8 μL 2.24 μL
XbaI 1 μL 1 μL
PstI 1 μL 1 μL
10x NEB 2.1 Buffer 5 μL 5 μL
water 35.2 μL 40.5 μL
The restriction preparations were incubated at 37 °C for 10 min and afterwards heat-inactivated at 80 °C for 20 min.

Purification of Restriction Reactions

Preparation of 1.75% agarose gel. 10 μL restriction reaction with 2 μL loading dye were added.

Lane 1 Lane 2 Lane 3
2 Log DNA Ladder BBa_I732018 (insert) OmpR (vector)
10 μL 12 μL 12 μL

Restriction of BBa_E0240 (GFP) and BBa_R0082 (OmpR)

BBa_E0240 BBa_R0082 Colony B
500 ng Plasmid 3.4 μL 3.2 μL
XbaI 1 μL -
SpeI 1 μL 1 μL
10X Cutsmart Buffer 5 μL 2 μL
water 19.6 μL 13.8 μL
The restriction preparations were incubated at 37 °C for 30 min and afterwards heat-inactivated at 80 °C for 20 min.

Restriction of BBa_R0082 (OmpR) with BcuI

In the end the plasmid with OmpR should be restricted with SpeI (or BcuI from Thermo Fisher) and PstI. Because the buffer from NEB and Thermo Fisher are not compatible we decided to first restrict the plasmid OmpR with BcuI and afterwards purify it to loose the buffer and enzymes. Then we would perform a second restriction.
There were three preparations of the OmpR restriction.

Plasmid 3 x 3.2 μL
BcuI (SpeI) 3 x 1 μL
10X FastDigest Buffer 3 x 2 μL
Water 3 x 13.8 μL
The restriction preparations were purified with the GeneJet PCR Purification Kit von Thermo Scientific. Centrifugations were carried out at 13000 x g and in the end just 20 μL elution buffer was added to the column. Afterwards the concentration were measured at the NanoDrop.
Preparation DNA concentration
I 85.44 ng/ μL
II 21.57 ng/ μL
III 23.97 ng/ μL

Restriction of BBa_I732018 (LacZ-160620CSW01) / BBa_E0430 (eYFP-160615CL01) / BBa_E0240 (GFP-160615PW01) / BBa_R0082 (OmpR-160511DC02)

LacZ eYFP GFP OmpR Prep. I-III OmpR Control 1 OmpR Control 2 OmpR Control 3 OmpR Control 4 OmpR Control 5
Plasmid 10.9 μL 3.1 μL 3.4 μL 3 x 20 μL 3.2 μL 3.2 μL 3.2 μL 3.2 μL 3.2 μL
XbaI 1 μL 1 μL 1 μL - - - - 1 μL -
PstI 1 μL 1 μL 1 μL 3 x 1 μL - - - - 1 μL
10X NEB 3.1 2.5 μL 2.5 μL 2.5 μL 3 x 2.5 μL - 2.5 μL 2.5 μL 2.5 μL 2.5 μL
10X NEB 2.1 - - - - 2.5 μL - - - -
water 9.6 μL 17.4 μL 17.5 μL 3 x 1.5 μL 18.3 μL 18.3 μL 19.3 μL 18.3 μL 18.3 μL
BcuI - - - - 1 μL 1 μL - - -
The restriction preparations were incubated at 37 °C for 30 min and afterwards heat-inactivated at 80 °C for 20 min.

Control of the restriction of BBa_I732018, BBa_E0430, BBa_E0240, BBa_R0082 and controls

A 1.7 % agarose gel was prepared with 10 μL RedSafe and loaded using the following setup:
  1. 2-Log DNA Ladder (NEB)
  2. BBa_I732018
  3. BBa_E0430
  4. BBa_E0240
  5. BBa_R0082 1
  6. BBa_R0082 2
  7. BBa_R0082 3
  8. BBa_R0082 unrestricted
  9. BBa_R0082 Control XbaI
  10. BBa_R0082 Control PstI
  11. BBa_R0082 Control BcuI in 3.1 NEB
  12. BBa_R0082 Control BcuI in 2.1 NEB
Gel control of the restriction of BBa_I732018, BBa_E0430, BBa_E0240, BBa_R0082 and controls

The restriction was performed to receive the BBa_I732018, BBa_E0430 and BBa_E0240 genes as well as restricting the BBa_R0082 Plasmid to ligate the Plasmid with the restricted genes of BBa_I732018, BBa_E0430 and BBa_E0240. Therefore the lanes were cut out of the gel and afterwards purified with the GeneJet Gel Extraction Kit from Thermo Fisher Scientific. The centrifugation was performed at 13000 g for 1 min.

Afterwards the preparations were measured at the NanoDrop.

Concentration
BBa_I732018 22.24 ng/μL
BBa_E0430 22.40 ng/μL
BBa_E0240 23.57 ng/μL
BBa_R0082 1 25.42 ng/μL
BBa_R0082 2 32.28 ng/μL
BBa_R0082 3 24.33 ng/μL

Restriction of BBa_I732018 / BBa_E0430 / BBa_E0240 / BBa_R0082

BBa_I732018 BBa_E0430 BBa_E0240 Control BBa_R0082
Plasmid 10.9 μL 3.1 μL 3.4 μL 1.4 μL
XbaI 1 μL 1 μL 1 μL -
PstI 1 μL 1 μL 1 μL -
BcuI - - - 1 μL
10x NEB 3.1 2.5 μL 2.5 μL 2.5 μL 2.5 μL
H2O 9.6 μL 17.4 μL 17.1 μL 19.1 μL

Incubation for 1 h at 37 °C. Heat-inactivation for 20 min at 80 °C.

Control of the restriction of BBa_I732018, BBa_E0430, BBa_E0240, BBa_R0082 and controls

A 2.2 % agarose gel with 10 μL RedSafe was prepared and loaded using the following setup:

  1. 2-Log DNA Ladder (NEB)
  2. BBa_I732018
  3. BBa_E0430
  4. BBa_E0240
  5. Control BBa_R0082 with BcuI
Control of the restriction of BBa_I732018, BBa_E0430, BBa_E0240, BBa_R0082 and controls

The lanes were cut out of the gel and afterwards purified with the GeneJet Gel Extraction Kit from Thermo Fisher Scientific. The centrifugation was performed at 13000 g for 1 min.

Afterwards the preparations were measured at the NanoDrop.

BBa_I732018 c=100 ng/μL
BBa_E0430 c=160 ng/μL
BBa_E0240 c=160 ng/μL
Control with gel c=110 ng/μL

Ligation of restricted BBa_I732018, BBa_E0430, BBa_E0240-genes with BBa_R0082

Ligation mixtures consisted of the following components:

Amount [μ] BBa_E0430 BBa_E0240 BBa_I732018
V (Insert) 3.57 μL 3.39 μL 1.20 μL
V (Vektor) 2 μL 2 μL 2 μL
V (T4 Ligase) 1 μL 1 μL 1 μL
V (H20) 11.43 μL 11.61 μL 13.80 μL

The preparations were incubated at 16 °C overnight.

Transformation of JW3367-3 with the ligated plasmids

Competent cells were split into aliquots and incubated on ice with the following DNA samples:

Aliquot amount DNA DNA amount [μL]
150 μL BBa_R0082/BBa_I732018 ligation 10
150 μL BBa_R0082/BBa_E0430 ligation 10
150 μL BBa_R0082/BBa_E0240 ligation 10
50 μL pcDNA 0.5
50 μL pSB1C3/BBa_R0082 1
50 μL pSB1C3/BBa_E0430 1
50 μL pSB1C3/BBa_E0240 1
50 μL pSB1C3/BBa_I732018 1

The cells were incubated on ice for 1 h, heat-shocked at 42 °C for 1 min and put back on ice for another 5 min. Ad 1 mL pre-warmed LB medium was added and the cells were incubated at 37 °C / 900 rpm for 1 h on the ThermoMix. The cells were brought onto LB/Agar plates according to the resistances coded in the transformed plasmids in following order:

Plasmid Amount [μL]
pcDNA3 150
pSB1C3/BBa_R0082/BBa_E0240 100
50
pSB1C3/BBa_R0082/BBa_E0430 100
50
pSB1C3/BBa_R0082/BBa_I732018 100
50
pSB1C3/BBa_E0240 100
50
pSB1C3/BBa_E0430 100
50
pSB1C3/BBa_I732018 100
50
pSB1C3/BBa_R0082 100
50
negativ control 100
50

Colony PCR with pSB1C3/BBa_R0082/BBa_I732018, pSB1C3/BBa_R0082/BBa_E0430 and pSB1C3/BBa_R0082/BBa_E0240

(All of the transformed cells (except for the negative control preparations) formed single colonies on the according plates. There was not one cell colony on the negative control plates.)
The mixture of the Colony PCR tubes was done as follows:

BBa_E0240 BBa_E0430 BBa_I732018
V (DreamTaq-Buffer) 1.5 μL 1.5 μL 1.5 μL
V (dNTPs) 0.5 μL 0.5 μL 0.5 μL
V (H20) 5.9 μL 5.9 μL 5.9 μL
V (VF2) 1 μL 1 μL 1 μL
V (VR) 1 μL 1 μL 1 μL
Taq 0.1 μL 0.1 μL 0.1 μL

Assignment of the plates with the colonies that were picked for the PCR and the PCR tubes was as described in the following table:

Tubes Plate
1, 2, 3, 4 pSB1C3/BBa_R0082/BBa_E0240
5, 6, 7, 8 pSB1C3/BBa_R0082/BBa_E0430
9, 10, 11, 12 pSB1C3/BBa_R0082/BBa_I732018

Glycerol Stock of pSB1C3/BBa_R0082/BBa_E0430 and pSB1C3/BBa_R0082/BBa_E0240

Made a Glycerol Stock of the overnight cultures from the day before. Therefore mixed 250 μL Glycerol with 250 μL water and 500 μL culture. The stocks were stored at -80 °C.

  • Stock of BBa_R0082/BBa_E0240
  • Stock of BBa_R0082/BBa_E0430 A
  • Stock of BBa_R0082/BBa_E0430 B
  • Stock of BBa_R0082/BBa_E0430 C
  • Stock of BBa_R0082/BBa_E0430 D

Minipreparation of pSB1C3/BBa_R0082/BBa_E0430 and pSB1C3/BBa_R0082/BBa_E0240

The over night cultures from the day before were centrifuged for 3 min at 5000 g. The supernatant was discarded. For the further steps see the protocol from the GeneJet Plasmid Miniprep Kit from Thermo Scientific. #K0503. All centrifugation steps were performed at 13000 g. In the end the columns were eluted with 20 μL Elutionbuffer twice.

  • Miniprep of BBa_R0082/BBa_E0240
  • Miniprep of BBa_R0082/BBa_E0430 A
  • Miniprep of BBa_R0082/BBa_E0430 B
  • Miniprep of BBa_R0082/BBa_E0430 C
  • Miniprep of BBa_R0082/BBa_E0430 D

The dsDNA concentration was measured at the NanoDrop.

BBa_R0082/BBa_E0240 188.46 μL
BBa_R0082/BBa_E0430 A 219.83 μL
BBa_R0082/BBa_E0430 B 321.86 μL
BBa_R0082/BBa_E0430 C 223.68 μL
BBa_R0082/BBa_E0430 D 339.88 μL

Colony PCR with pSB1C3/BBa_R0082/BBa_I732018

The PCR was performed with 4 colonies. The mixture of the Colony PCR tubes was done as follows:

The PCR Program TAQSCREEN was used.

BBa_I732018
V (DreamTaq Buffer) 1.0 μL
V (dNTPs) 0.5 μL
V (H2O) 6.4 μL
V (VF2) 1.0 μL
V (VR) 1.0 μL
Taq 0.1 μL

Tubes Plates
1, 2 pSB1C3/BBa_R0082/BBa_I732018 (colonies 1 and 2)
3, 4 pSB1C3/BBa_R0082/BBa_I732018 (colonies 3 and 4)

Gel electrophoresis in 2.2 % agarose gel and 1:10000 RedSafe with the samples from the colony PCR

Potential difference: 100 V
Duration: ˜45 min

Control of the Colony PCR of pSB1C3/BBa_R0082/BBa_I732018

Sequencing ofpSB1C3/BBa_R0082/BBa_E0430 and pSB1C3/BBa_R0082/BBa_E0240

  • 2.4 μL of pSB1C3/BBa_R0082/BBa_E0240 once with 5 μL VF2 and once with 5 μL VR
  • 2.2 μL of pSB1C3/BBa_R0082/BBa_E0430 1 once with 5 μL VF2 and once with 5 μL VR
  • 1.6 μL of pSB1C3/BBa_R0082/BBa_E0430 2 once with 5 μL VF2 and once with 5 μL VR
  • 2.2 μL of pSB1C3/BBa_R0082/BBa_E0430 3 once with 5 μL VF2 and once with 5 μL VR
  • 1.5 μL of pSB1C3/BBa_R0082/BBa_E0430 4 once with 5 μL VF2 and once with 5 μL VR

Preparation of overnight cultures

Plates from the 5.07.2016 were picked and put into overnight culture

  • pcDNA
  • pSB1C3/BBa_E0240
  • pSB1C3/BBa_E0430
  • pSB1C3/BBa_I732018
  • pSB1C3/BBa_R0082

LB-Agar Plates

Each 35 CAmp and Amp plates were prepared, with 100 μL Ampicillin and 33 μg/L Chloramphenicol, using Roth: LB-Broth chemical mix.

Plates were stored in 4 °C freezer until needed.

1 L LB-Medium

Was prepared as well, using Roth: LB-medium chemical mix and stored in 4 °C freezer.

Miniprep of overnight cultures

Liquid culture from JW 3367-3
Colony of pSB1C3/BBa_E0240 GFP plate
Colony from pSB1C3/BBa_E0430 YFP plate
Colony from pSB1C3/BBa_I732018 LacZΑ plate
Colony from pSB1C3/BBa_I732018 LacZΑ plate
Colony from pSB1C3/BBa_R0082
Colony from pBAD/Rluc plate
Colony from pcDNA3 plate

Miniprep was performed according to the GeneJET Miniprep Kit Protocol by ThermoScientific. Storage of plasmid eluates at -20°C.

Restriction of EnvZ-LRR, pSB1C3, BBa_I732018 and pSB1C3/BBa_R0082

First restriction

EnvZ-LRR 3' EnvZ-LRR 5' pSB1C3 pSB1C3/BBa_R0082 pSB1C3/BBa_I732018
Plasmid/DNA 10  μL 10  μL 2  μL 20  μL 11  μL
PvuI 1  μL 1  μL - - -
BcuI 1  μL - 1  μL - -
XbaI - - - 1  μL 1  μL
Buffer 2  μL FastDigest 2  μL FastDigest 2  μL FastDigest 2  μL NEB2.1 Buffer 2  μL NEB2.1 Buffer
water 16  μL 17  μL 15  μL 6  μL 6  μL
Total 30  μL 30  μL 20  μL 30  μL 21  μL

Purification of restricted DNA EnvZ-LRR 5’ and pSB1C3

  • Protocol see manufacturer's instructions of Thermo Scientific Purification Kit

Restriction of EnvZ-LRR 5’ and pSB1C3 with EcoRI

Second restriction of the two samples was needed because EcoRI needs a different buffer than PvuI and BcuI.

EnvZ-LRR 5' pSB1C3
Plasmid/DNA 50  μL 50  μL
EcoRI 2  μL 2  μL
NEB2.1 Buffer 6  μL 6  μL
water 2  μL 2  μL
Total: 60  μL 60  μL

Ligation of pSB1C3 with EnvZ-LRR3’ and EnvZ-LRR5’

  • 1:10 (Vector:Insert) Ligation

Amount [ μL]
EnvZ-LRR3’ (Insert) 5.7
EnvZ-LRR5’ (Insert) 5.7
pSB1C3 (Vector) 5.7
T4 Ligase 1
DNA Ligase Buffer 2

  • 1:5 (Vector:Insert) Ligation

Amount [ μL]
EnvZ-LRR3’ (Insert) 4.25
EnvZ-LRR5’ (Insert) 4.25
pSB1C3 (Vector) 8.5
T4 Ligase 1
DNA Ligase Buffer 2

All samples were left for incubation at 12° C overnight.

Ligation of pSB1C3/BBa_R0082 with pSB1C3/BBa_I732018

  • 1:10 (Vector:Insert) Ligation

Amount [ μL]
pSB1C3/BBa_I732018 8.5
pSB1C3/BBa_R0082 8.5
T4 Ligase 1
DNA Ligase Buffer 2

All samples were left for incubation at 12° C overnight.

Transformation of competent JW-33673 cells with pSB1C3-EnvZ-LRR 1:10 and pSB1C3-EnvZ-LRR 1:5

Amount JW-33673 cells Plasmid Amount plasmid
150  μL pSB1C3-EnvZ-LRR 1:10 10  μL
150  μL pSB1C3-EnvZ-LRR 1:5 10  μL
75  μL pSB1C3 1:4 (positive control) 1  μL
75  μL - (negative control) -

All plates were put in incubator at 37° C overnight.

Colony PCR of pSB1C3/EnvZ-LRR 3’

The ligation preparations of EnvZ-LRR and pSB1C3 were amplified by colony PCR after preparing the following master mix:

1x 7x
Dreamtaq-Buffer 1  μL 7  μL
dNTPs (10 mM) 0.5  μL 3.5  μL
water 6.4  μL 44.8  μL
VF2 primer (10 mM) 1  μL 7  μL
VR primer (10 mM) 1  μL 7  μL
DreamTaq-Polymerase 0.1  μL 0.7  μL

4 colonies from the 1:10 and 2 colonies from the 1:5 ligation were picked and LB cultures were prepared in parallel.

The following PCR setup was used:

1. 98° C 2:00
2. 98° C 0:10
3. 55° C 0:45
4. 72° C 3:15
5. GOTO 2 repeat 34x
6. HOLD at 4° C

Restriction of BBa_R0082 and BBa_I732018

Because of buffer difficulties, Omp had to be restricked sequentielly with two restriction enzyms BcuI (ThermoF.) and PstI (NEB). After the first restriction, the restricted vector was purified via the PCR Purification Kit, following the respective protocol. Pippeting of the samples was done, as described in the following table:

  • 1. Restriction of BBa_R0082
Intredient Volume
1:10 diluted pSB1C3/BBa_R0082 (363.67 ng/μL) 1.3 μL
BcuI 1.0 μL
Fast Digest Buffer (T.F.) 5.0 μL
H2O 42.8 μL
  • 2. Restriction of BBa_I732018
Intredient Volume
BBa_I732018 (33.89 ng/μL) 8.0 μL
XbaI 1.0 μL
PstI 1.0 μL
NEBuffer 3.1 5.0 μL
H2O 35.0 μL
  • 3. Second Restriction of BBa_R0082
Ingredient Volume
BBa_R0082 (Restricded with BcuI) 10 μL
PstI 1.0 μL
NEBuffer 3.1 5.0 μL
H2O 34.0 μL

Minipreparation of the Over-Night-Cultures from pSB1C3-EnvZ-LRR

From each sample a cryostock was prepared, following the respective protocol.

The rest of the samples were miniprapareted, following the respective protocol.

Gel control of the mini-prep, the restriction products BBa_R0082 and BBa_I732018

200 mL gel with 2.0 μL redsafe at 150 V, t:0.75 h

  1. Ladder
  2. Mini-prep product 1
  3. Mini-prep product 2
  4. Mini-prep product 3
  5. Mini-prep product 4
  6. Mini-prep product 5
  7. Mini-prep product 6
  8. Mini-prep product 7
  9. Restrection product BBa_R0082
  10. Restricton product BBa_I732018
Control of the mini-prep, the restriction products BBa_R0082 and BBa_I732018

Restriction of BBa_I732018 and pSB1A3 and sequential restriction of BBa_R0082 with BcuI and EcoRI

The BBa_I732018 and BBa_R0082 genes should be inserted into pSB1A3. Therefore BBa_I732018 and pSB1A3 were restricted like shown in the table below:

BBa_I732018 BBa_R0082
Plasmid DNA 2.0 μL (700 ng) 4.0 μL (100 ng)
XbaI 1.0 μL 0.5 μL
PstI 1.0 μL 0.5 μL
10x NEB 2.1 Buffer 2.0 μL 2.0 μL
H2O 14.0 μL 13.0 μL

The Plasmid with BBa_R0082 should be restricted with SpeI (or BcuI from Thermo Fisher) and EcoRI. Because the buffer from NEB and Thermo Fisher are not compatible. The BBa_R0082 plasmid is first restricted with BcuI and afterwards purify it to loose the Buffer and Enzyme. Only then the second restriction.

First restriction:

BBa_R0082
Plasmid DNA 2.0 μL (720 ng)
BcuI 1.0 μL
10x Fast Digest Buffer 2.0 μL
H2O 15 μL

There were two preparations of the BBa_R0082 restriction.

The restriction products were purified with the GeneJet PCR Purification Kit, following the respective protocol. Centrifugations were carried out at 12000 g. For preperation I 50 μL of Elutions buffer was added to the column. For Preperation II 15 μL of Elutions buffer was added to the column. Afterwards the concentration was measured at the NanoDrop.

Preparation I 8.34 ng/μL
Preparation II 23.61 ng/μL

Second Restriction

Preparation I Preparatin II
Plasmid DNA 29 μL 29 μL
EcoRI 1 μL 1 μL
10x NEBuffer 2.1 2.0 μL 2.0 μL
H2O 18 μL 32 μL

Heat-inactivation: 80 °C, 20 min

Sequential restriction of BBa_R0082 with BcuI and PstI

The Plasmid with BBa_R0082 should be restricted with SpeI (or BcuI from Thermo Fisher) and PstI. Because the buffer from NEB and Thermo Fisher are not compatible we decided to first restrict the Plasmid BBa_R0082 with BcuI and afterwards purify it to loose the Buffer and Enzyme. Then we would perform a second restriction.

First restriction:

BBa_R0082
Plasmid DNA 4.0 μL
BcuI 1.0 μL
10x Fast Digest Buffer 2.0 μL
H2O 13 μL

The restriction product was purified with the GeneJet PCR Purification Kit von Thermo Scientific, following the respective protocol. Centrifugations were carried out at 12000 g. Washing was performed with using only 50 μL Wash buffer and for elution only 50 μL of Elutions buffer was added to the column. The concentration was measured at the NanoDrop.
Purified extract (BBa_R0082) are c=15.62 ng/μL

Second Restriction:

Purified extract (BBa_R0082)
Plasmid DNA 40.0 μL
PstI 1.0 μL
10x NEBuffer 2.1 5.0 μL
H2O 4.0 μL

Heat-inactivation: 80 °C, 20 min

Ligation of restricted BBa_I732018-gene with BBa_R0082

Ligation mixtures consisted of the following components:

Preparation I Preparation II Praparation III
BBa_I732018 2.74 μL
(Insert:Vector=3:1) 		3.706 μL
(Insert:Vector=5:1) 		5.78 μL
(Insert:Vector=7:1)
BBa_R0082 2.0 μL (31.24 ng) 2.0 μL (31.24 ng) 2.0 μL (31.24 ng)
T4 Ligase 1.0 μL (31.24 ng) 1.0 μL (31.24 ng) 1.0 μL (31.24 ng)
H2O 12.26 μL 11.29 μL (31.24 ng) 9.22 μL (31.24 ng)

The preparations were incubated at 16 °C overnight.

Transformation of the Ligation preparations of pSB1C3/BBa_R0082/BBa_I732018 and the Parts BBa_K081005, BBa_K608006 and BBa_K608007

The parts BBa_K608006 (Plate 1, 5E), BBa_K081005 (Plate 3, 16E) and BBa_K608007 (Plate 1, EG) were resuspended in 10 μL dest. H2O (DNAse free).

10 μL of the Ligation Preparations pSB1C3/BBa_R0082/BBa_I732018 with Insert:Vector of 3:1, 5:1 and 7:1 were added to 150 μL competent cells and mixed. 150 μL competent JW3367-3 cells were split into 3x 50 μL. 1 μL of the resuspended Parts were added to 1 competent cell tube each and mixed. The cells were incubated on ice for 1 h, heat shock at 42 °C for 1 min and chilled on ice for 3 min. 850 μL pre-warmed LB medium was added and the cells were incubated at 37 °C 900 rpm for 1 h.

The cells were harvested by centrifugation at 4500 rpm for 1 min, resuspended in 50 μL LB medium and 50 μL were plated onto LB Agar/Camp plates. All plates were incubated over night at 37 °C.

Transformation following the respective protocol

Transformation of DH5a and JW 3367-3 with pSB1C3/EnvZ-NOD1 and pSB1C3/BBa_R0082/BBa_I732018

Competent DH5a and JW 3367-3 were thawed at 4° C, split and inoculated with DNA as following:

Volume of cells Cell line Transfected with Amount of DNA
50 µL DH5α pSB1C3/BBa_R0082/BBa_I732018 50 ng
50 µL JW 3367-3 pSB1C3/BBa_R0082/BBa_I732018 50 ng
50 µL JW 3367-3 pSB1C3/BBa_R0082/BBa_I732018 50 ng
150 µL JW 3367-3 pSB1C3/EnvZ-NOD1 1:10 10 µL
150 µL JW 3367-3 pSB1C3/EnvZ-NOD1 1:5 10 µL
150 µL JW 3367-3 pSB1C3/EnvZ-NOD1 1:5 2 µL
50 µL DH5α none none
50 µL JW3367-3 none none
50 µL JW3367-3 none none

Cells and DNA were incubated at 4° C for 1 h, heat shocked at 42 ° C for 1 minute and put on ice at 4°C for 5 more minutes. Add 1 mL of 37° C pre-warmed.

Transformation of DH5α with eYFP (pSB1C3/BBa_R0082/BBa_E0430) and GFP (pSB1C3/BBa_R0082/BBa_E0240) reporter constructs

150 µL competent DH5ɑ cells were thawed at 4°C split into three 50 µL tubes. Plasmids were added:

cells Plasmid amount
DH5α pSB1C3/BBa_R0082/BBa_E0430 50 ng
DH5α pSB1C3/BBa_R0082/BBa_E0240 50 ng
DH5α (negative control) none none

The cells were incubated at 4°C for 1h, heat shocked at 42°C for 1 min and put back on ice at 4°C for 5 minutes. 950 µL 37°C warm LB broth was added to each tube and the cells were incubated at 37°C / 900 RPM on the thermomix for 1 h.

Cells were centrifuged, resuspended in 50 µL LB broth, brought onto LB-Agar/CAmp Plates and incubated at 37°C overnight.

Fabrication of ED01 SU-8 Master (1st attempt)

  • A 4-inch Si-wafer was used to fabricate a master(stamp) for polydimethylsiloxane (PDMS) printing. Channels of the final microfluidic (MF) chip have 125 μm width according to CAD file.
  • SU-8 photoresist was chosen to serve as the imprinting material
  • To acquire square sections of the MF-chip channels, the Master was processed according to the datasheet for typical processes with 100 μm resist thickness
  • The 4-inch Si-wafer was baked in an oven at 130 °C for 10 minutes
  • SU-8 (Gersteltec GM1075) was spin coated on the Si-wafer directly after baking using the following parameters:
      1) 100 rpm/second acceleration to 1700 rpm (for 17 seconds)
      2) 100 seconds spinning at 1700 rpm
      3) spin peak with 400 rpm/second acceleration to 2100 rpm (for 1 second)
      4) -100 rpm/second deceleration to 0 rpm (for 21 seconds)
  • The Si-wafer was kept at 40 °C for 30 minutes to allow for relaxation of the resis edges
  • appearing gas bubbles in the resist were popped with a sterile syringe tip
  • The wafer was soft baked for 2 minutes at 120 °C with temperature ramps of 4 °C/minute up and down
  • The wafer was illuminated for 16 seconds with an exposure dose of 13 mW/cm2 (208 mJ/cm2 - instead of recommended 200 mJ/cm2)
  • After exposure the wafer was stored for a delay time of 1 hour to let the created initiator molecules diffuse until homogeneity was reached
  • The wafer was PEBd for 30 minutes at 95 °C with 4 °C/minute temperature ramps up and down from room temperature
  • After RT was reached, the wafer was put into used propylene glycol methyl ether acetate (PGMEA) for 3 minutes for development of the SU-8 resist. Slight detachment of the SU-8 from the Si-wafer was observed
  • Development was cancelled by rinsing with isopropanol after removing the wafer from PGMEA. Strong white liquid formation occurred whilst rinsing with isopropanol
  • SU-8 was undeveloped
  • The wafer was kept in isopropanol for about 1 hour
  • After removal from the isopropanol bath the wafer remained underdeveloped
  • The wafer was put back in used PGMEA for 3 minutes. Partial detachment of the remaining structures after completed development became clearly visible. The structures remained intact.
  • Rinsing with isopropanol showed slight to no white traces, indicating completed development
  • The imprint structures were clearly visible
  • The smallest features of the SU-8 Master detached completely and eventually rested randomly across the Master’s Si-wafer surface
  • Examination of the shape of the structures with a profilometer (DektakXT; Bruker) showed a SU-8 thickness of 65 +/- 1 μm (as opposed to 100 μm according to the datasheet)
  • SU-8 Master for the Encapsulation Device (ED01-Master01) was not suitable for channel formation with square-like sections

Fabrication of ED01 SU-8 Master (2nd attempt)

  • A 4-inch Si-wafer was put in an oven at 130 °C overnight from the seventh to the eighth of August
  • GM1060 photoresist (SU-8 thin application; Gersteltec) was used as a base adhesion layer for the GM1075 photoresist (SU-8 thick application; Gersteltec) to increase structure layer attachment to the substrate
  • The parameters used for the GM1060-SU-8 base layer were derived from the GM1060 datasheet typical processes for 6 μm layer thickness except for an adjusted spin speed of 6000 rpm and the cancellation of the process after the post-exposure bake (PEB) due to the lack of need for structuring
  • After dehydration of the Si-wafer in the oven the base layer was spinned on the Si-wafer with the following parameters:
    Spinning:
    • 100 rpm/second to 6000 rpm (for 60 seconds)
    • 6000 rpm for 40 seconds
    • -100 rpm/second to 0 rpm (for 60 seconds)
    Relaxation:
    • 5 minutes at RT
    Soft bake:
    • 2 °C/minute from RT to 65 °C
    • 5 minutes at 65 °C
    • 2 °C/minute from 65 °C to 95 °C
    • 5 minutes at 95 °C
    • coli down to 50 °C
    Exposure:
    • 20 seconds with 13 mW/cm2 (260 mJ/cm2 instead of recommended 200 mJ/cm2) on i-line (365 nm)
    Delay:
    • 10 minutes
    PEB:
    • Same as soft bake except 15 minutes at 95 °C
  • After the soft bake small white dots (bubbles) were visible in or on the SU-8 layer, but they were too small to pop open, as well was too many; temperature profile may be irrelevant or relaxation time should be longer to allow for more gentle solvent evaporation
  • After the PEB the structural GM1075-SU-8 layer was applied and processed
  • The fabrication of the structural layer of ED01-Master02 was performed similiar to ED01-Master01, but according to the datasheet parameters for the typical process for 150 μm layer thickness with slight modifications to reach the desired 100 μm thickness. Following parameters were used:
    Spinning:
    1. 100 rpm/second to 1200 rpm (for 12 seconds)
    2. 1200 rpm for 100 seconds
    3. 400 rpm/second to 1600 rpm (for 1 second)
    4. -100 rpm/second to 0 rpm (for 16 seconds)
    Relaxation:
    1. 30 minutes at 40 °C
      2. Soft bake:
    2. 4 °C/minute from 40 to 120 °C
    3. 5 minutes at 120 °C
    4. -4 °C/minute from 120 °C to RT
      5. Exposure:
    5. 20 seconds with 13 mW/cm2 (260 mJ/cm2 instead of recommended 200 mJ/cm2 for 100 μm) on i-line (365 nm)
      6. Delay:
    6. 1 hour
      7. PEB:
    7. 4 °C/minute from 40 to 95 °C
    8. 40 minutes at 95 °C; instead of 30 minutes recommended for 100 μm
    9. -4 °C/minute from 95 °C to RT
  • Slight to no white traces were observed during post-development isopropanol rinse; structures remained attached and intact remaining clear
  • Examination of ED01-Master02 and the shape of the structures with a profilometer (DektakXT; Bruker) showed a SU-8 thickness of 87 +/- 1 μm (as opposed to 150 μm according to the datasheet); structures appeared clear and the edges sharp; the measured properties are sufficient to serve as a stamp for the ED01-chips
  • To create castings of PDMS from the ED01-Master02 72.37 g of PDMS oligomer (Sylgard 184 silicone elastomer base) and 7.26 g of initiator (Sylgard 184 elastomer curing agent) were thoroughly mixed
  • The ED01-Master02 was put into a glass petri dish which was covered with aluminium foil
  • The PDMS mixture was poured over the ED01-Master02 and the dish was put into a desiccator to remove air bubbles from inside the PDMS
  • Subsequently the dish including the mixture was covered to prevent dust from entering and incubated in an oven at 65 °C overnight to allow it to polymerize completely

LB - medium

  • 25 g LB - medium
  • add to 1 L H2O
  • -> autoclave

LB - agar

  • 10 g LB - agar
  • add 250 mL H2O
  • -> autoclave

LB agar plates

  • heat 250 mL LB - agar (is hot from the autoclave)
  • Cool down to approx. 50 °C
  • add 250 µL chloramphenicol
  • Preparation of 13 plates under steril conditions
  • -> store at 4 °C
  • Mark as LB CAmp Plates 160809

Plating of JW 3367-3 and DH5α with fluorescence reporters

To use

  • 3 plates (LB CAmp Plates iGEM 09.08.2015)
  • Cells LOT# 190707CL03 (JW 3367-3 with pSB1C3/BBa_R0082/BBa_E0430) (Omp/eYFP)
  • Cells LOT# 160803KP03 (DH5&alpha with pSB1C3/BBa_R082/BBa_E0240) (Omp/GFP)
  • Cells LOT# 160803KP02 (DH5&alpha with pSB1C3/BBa_R082/BBa_E0430) (Omp/eYFP)

Now work under sterile conditions:

  • For DH5α/eYFP: pick one colony from the plate 160803KP02, put it in 50 µL LB medium, put the 50 µL LB medium with cells on the LB - Agar Plate and grease it -> stored at 37 °C overnight
  • For DH5α/GFP: the same as the DH5α/eYFP
  • For JW 3367-3/eYFP: warm up the cryostock, than pick 5 µL up and put it on 45 µL LB medium, put the 50 µL to the plate and grease it -> stored at 37 °C overnight

Fabrication of ED01 MF-Chips

  • Petri dish with cured PDMS on ED01-Master02 was removed from the oven (65 °C) after overnight incubation
  • PDMS was removed from the Master by fragile pulling
  • PDMS was cut with scalpel and broken by hand to retrieve three replicated channel systems in one PDMS piece
  • Access channels for syringe tubes (input and output) were cut with a biopsy cutter / hole punch (0.75 mm diameter) and rinsed with isopropanol and dried with a N2-gun
  • 3 glass object slides and 3 triple-device PDMS pieces were plasma treated in 02-plasma for 100 seconds at approx. 10 W and 0.38 mbar
  • The glass object slides and PDMS pieces were brought into contact with their plasma treated surfaces by pressing them together by hand, forming the ED01 MF-Chips
  • The ED01 MF-chips were kept still for 3 hours until stable binding of glass and PDMS was tested
  • One of the three created ED01 MF-chips bonded completely with all three devices appearing intact

Fluorescence microscopy of plates

Fluorescence microscopy of bacteria on plates:

DH5α/pSB1C3/BBa_R0082/BBa_E0240 (Omp/GFP). Magnification factor: 40x; exposure: 75,31 ms.

JW3367-3/pSB1C3/BBa_R0082/BBa_E0240 (Omp/GFP). Magnification factor: 40x; exposure: 75,31 ms.

JW3367-3/pSB1C3/BBa_R0082/BBa_E0240 (Omp/GFP). Magnification factor: 40x; exposure: 1 s.

Note: As expected, DH5α cells showed higher fluorescence than JW3367-3, which are lacking the EnvZ receptor required for activation of ompR.

FACS

Following cell lines were measured with FACS:

  • DH5α/pSB1C3/BBa_R0082/BBa_E0240 (Omp/GFP)
  • DH5α/pSB1C3/BBa_R0082/BBa_E0430 (Omp/eYFP)
  • JW3367-3/pSB1C3/BBa_R0082/BBa_E0240 (Omp/GFP)
  • JW3367-3/pSB1C3/BBa_R0082/BBa_E0430 (Omp/eYFP)
  • DH5α (negative control)
  • JW3367-3 (negative control)
As buffer 100 mM MgCL2 was used and the cells were diluted 1:100.

Setup: Cytometry was conducted with the FACSCalibur System configured as follows.

Detector Voltage Mode
FSC E02 Lin
SSC 628 Lin
FL1 705 Log
Threshold FSC: 0 Mode: Hi

Preparation of Alginic Acid Solution

  • Second creation of alginate solution 2.5 % ; soluted for about 12 hours

Preparation encapsulated JW cells from 22.08.16

  • The OD600 of the overnight culture was measured and amounts to 4.770
  • Due to the encapsulation protocol which requires an OD of about 1.5, 2 mL of the main culture were diluted with 4 mL of fresh LB medium without any antibiotics
  • OD600 of the diluted culture equaled to 2.00
  • The 6 mL of bacterial solution were centrifuged in 2 mL tubes separately for 5 minutes at 4500 rpm. Due to unexpected waiting time the mixtures were centrifuged for another 2 minutes before separating the pellet from the fluid
  • The 3 tubes with bacterial pellets were resuspended with 333 μL 0.9 % NaCl each and thereafter reunited
  • 1 mL of diluted bacteria were mixed with 2 mL of 2.5 % alginate solution
  • Encapsulation was managed through pipetting the alginate-bacteria solution in 100 mL BaCl2
  • The BaCl2 was sterile filtered for reuse
  • The capsules were washed with 100 mL dist. water
  • About 10 capsules were crushed immediately and set into culture with 5 mL LB cAmp
  • Mistake: JW do not have cAmp resistance, therefore no growth was possible
  • Mistake was identified after first measurement (1.5 hours)
  • Measurements of the intact capsules in LB cAmp as well did not show any growth after 1.5 hours and 2 hours
  • Analogous to the BaCl2 encapsulation, CaCl2 encapsulation was performed; a bacterial solution of OD600 = 1.83 was used
  • Incubation with LB medium (antibiotics free) did not show growth
  • Encapsulated bacteria could be seen using a light microscope; bacteria supposedly strongly bound; new dilution/capsule-crushing methods needed
  • Overnight culture of crushed parts was fixed

OD600 Measurement of Overnight Cultures from 23.08.16

  • No visible indication for bacterial growth were observed in the overnight cultures

Restriction of BBa_C0082 and the Anderson Promoters for 3A Assembly

Part BBa_C0082 BBa_K081005 BBa_K081006 BBa_K081007
DNA 48 µL 16 µL 10.3 µL 14.1 µL
NEB Buffer 2.1 6 µL 2 µL 2 µL 2 µL
XbaI 2 µL - - -
PstI 2 µL 1 µL 1 µL 1 µL
H2O 2 µL 1 µL 6.7 µL 2.9 µL
Total 60 µL 20 µL 20 µL 20 µL

The DNA was restricted at 37 °C for 45 minutes. Enzymes were heat-inactivated at 65 °C for 20 minutes. DNA was purified using the GeneJET PCR Purification Kit, eluting the DNA with 8 µL elution buffer for the promoters and 27 µL for the BBa_C0082.

A second restriction was prepared:

Part BBa_K081005 BBa_K081006 BBa_K081007
DNA 8 µL 8 µL 8 µL
FastDigest Buffer 1 µL 1 µL 1 µL
BcuI 1 µL 1 µL 1 µL
Total 10 µL 10 µL 10 µL

The DNA was restricted at 37 °C for 30 minutes and purified using the GeneJET PCR Purification Kit, eluting with 8 µL.

Ligation of BBa_C0082 with the Anderson Promoters

Three ligation reactions were set up as following:

Part BBa_K081005 BBa_K081006 BBa_K081007
Anderson Promoter 8 µL 8 µL 8 µL
BBa_C0082 9 µL 9 µL 9 µL
T4 DNA Ligase 1 µL 1 µL 1 µL
Ligation Buffer 2 µL 2 µL 2 µL
Total 20 µL 20 µL 20 µL

The ligation was conducted overnight at 16 °C.

Transformation of JW3367-3 with BBa_C0082/Anderson Promotor ligation product and BBa_B0015

Transformation was conducted according to the Zhang Gong Protocol for Transformation. 2  µL of DNA were added to the competent cells of each BBa_B0015 and BBa_C0082/Anderson plasmid transformation.

New colony PCRs of Anderson Promoters

All Colony PCRs of the Anderson promoters were negative. Screen of 15 colonies from each plate.

  • A: pSB1C3/BBa_K081005 → Colony  1 - 15
  • B: pSB1C3/BBa_K608006 → Colony 16 - 30
  • C: pSB1C3/BBa_K608007 → Colony 31 - 45

TAQSCREEN:

  1. 98 °C → 5 min
  2. 98 °C → 10 s
  3. 56 °C → 30 s
  4. 72 °C → 2:15 min

Miniprep of Terminator (BBa_B0015)

The overnight culture of JW 3367-3 cells containing pSB1C3/BBa_B0015 was prepared and prepped using the ThermoScientific GeneJET Plasmid Miniprep Kit, following the respective protocol, eluting with 100 μL each. The resulting sample contained:

Plasmid DNA concentration [ng/μL]
pSB1C3/BBa_B0015 46.42

Gel electrophoresis of colony PCR of BBa_K081005, BBa_K608006 and BBa_K608007

Control of the colony PCR of BBa_K081005, BBa_K608006 and BBa_K608007

Positive results for A16, B16, C9, C10, C11

Overnight cultures for positive colonies were produced and incubated overnight at 37 °C.

Restriction of pSB1C3/BBa_R0082/BBa_I732018 and BBa_B0015

First restriction

Components Volume [μL]
BBa_R0082/BBa_I732018 14.5
PstI 1.0
NEB Buffer 3.1 5.0
water 29.5
Total: 50.0

Second restriction

Components Volume [μL]
BBa_B0015 21.5
PstI 1.0
XbaI 1.0
NEB 3.1 Buffer 5.0
water 21.5
Total: 50.0

Incubation for 10 minutes at 37 °C each and heat inactivation of the first restriction at 80 °C for 20 minutes. Purification of BBa_B0015 fragment using the GeneJET Gel Extraction Kit, with concentrations of 89.55 ng/µL and 91.46 ng/μL. A cryostock of JW3367-3/pSB1C3/BBa_B0015 was prepared.

Encapsulation of JW cells in alginate

  • Preparations:
    1. -Sodium citrate 55 mM
    2. -JW cell culture
  • Encapsulation:
    1. -OD600 = 1.6 of JW cell culture
    2. -3 tubes with each 1 mL of culture centrifuged 5 minutes at 4500 rpm
    3. -Pellet was resuspended with 1 mL 0.9 % NaCl each
    4. -Encapsulation was performed by pipetting of 1 mL NaCl-cells suspension with 2 mL alginate into 100 mL CaCl2
  • Solution of Beads:
    1. -10 mL Na-citrate were incubated with beads for approx. 1 hour
    2. -Na-citrate-beads sliution was centrifuged for 5 minutes at 4500 rpm
    3. -Pellet was resuspended in LB / NaCl medium (several tubes - several pellets)
  • Cultivation:
    1. -beads were cultivated and thereafter lysed in Na-citrate (up) - cultivated again (37 °C LB/CaCl2)
    2. -OD measurement revealed growth in the JWs cultivated in LB medium
    3. -One culture was cultivated overnight. Another one was lysed overnight

Evaluation of Encapsulated JW cells from 06.09.16

  • OD6600 measurement:
    1. -LB-JW (marked red): OD600 = 4.918
    2. -LB-JW (marked green) diluted ½ : OD600 = 3.550; undiluted around 7
    3. -Na-citrate-JW (marked red): OD600 = 0.002
    4. -Na-citrate-JW (marked green): OD600 = 0.006
  • The vitality of the cells in the mixture with sodium citrate and LB has been confirmed via microscopy

Miniprep of BBa_K081007/BBa_C0082

The overnight culture of JW3367-3 cells containing pSB1C3/BBa_K081007/BBa_C0082 was prepared and prepped using the ThermoScientific GeneJET Plasmid Miniprep Kit, following the respective protocol, eluting two times.

Colony Concentration of first elution [ng/μL] Concentration of second elution [ng/μL]
9c 148.73 22.79
10c 185.27 13.55
11c 161.75 23.91

Restriction of pSB1C3/BBa_K081007/BBa_C0082

Restriction following the respective protocol.

pSB1C3/BBa_K081007/BBa_C0082
Colony 9c 		pSB1C3/BBa_K081007/BBa_C0082
Colony 10c 		pSB1C3/BBa_K081007/BBa_C0082
Colony 11c
Plasmid [in μL] 13.5 10.8 12.4
EcoRI [in μL] 2.0 2.0 2.0
10x CutSmart [in μL] 5.0 5.0 5.0
H2O [in μL] 29.5 32.2 28.6

Incubation was performed at 37 °C for 15 minutes and then loaded on an agarose gel (1 %) for 1 hour at 120 V.

Control of the restriction of BBa_K608007/BBa_C0082

Upper and two of the lower bands were cut out and extracted, using the GeneJET Gel Extraction Kit, following the respective protocol.

Restriction of pSB1C3/BBa_R0082/BBa_1732018

Restriction following the respective protocol.

pSB1C3/BBa_R0082/BBa_I732018
Plasmid 15.0 μL
EcoRI 1.0 μL
10x CutSmart 5.0 L
H2O 29.0 μL

Heat inactivation for 20 min (65 °C).

+ 1 μL BcuI

PCR Purification with the ThermoScientific GeneJET PCR Purification Kit, following the respective protocol

Restriction of pSB1C3/BBa_B0015

Restriction following the respective protocol.

pSB1C3/BBa_B0015
Plasmid 11.2 μL
EcoRI 1.0 μL
XbaI 1.0 μL
10x CutSmart 5.0 μL
H2O 31.8 μL

Heat inactivation for 20 min (65 °C).

Ligation

The consolidated extracted bands of plasmid pSB1C3/BBa_K081007/BBa_C0082 were self-ligated with the following reaction:

Components Volume [μL]
pSB1C3/BBa_K081007/BBa_C0082 15.0 μL (100 ng)
Ligase T4 1.0 μL
Ligase Buffer 2.0 μL
H2O Add 20μL

Incubation at RT for 25 minutes. Heat inactivation at 65 °C for 10 minutes. Storage at -20 °C over weekend.

Cryostock and Miniprep of pSB2K3/BBa_C0082

Cryostock: 500 μL of the ONC and 500 μL of 1:1 Glycerol-water mixture. Storage at -80 °C.
Miniprep was conducted according to the GeneJET Miniprep Kit Protocol, following the respective protocol.
Concentrations in first elution 156.66 ng/μL and 26.15 ng/μL.

Restriction of Anderson Promoters (BBa_K081005, BBa_K081006, BBa_K081007) with Taz (BBa_C0082)

Part BBa_C0082 BBa_K081005 BBa_K081006 BBa_K081007
Concentration [ng/µL] 156.66 73.35 112.41 81.74
Volume [µL for 500 ng] 3.6 6.9 4.5 6.2
NEB Buffer 3.1 [µL] 6 2 2 2
XbaI [µL] 2 - - -
PstI [µL] 2 1 1 1
H2O [µL] 40.4 10.1 12.5 10.8
Total [µL] 60 20 20 20

The DNA was restricted for 1 h for the Anderson promoters and 1 hour and 15 minutes for Taz at 37 °C. Enzymes were heat-inactivated for 20 minutes at 65 °C. The restrictions of the three Anderson promotors were purified using the GeneJET PCR Purification Kit. DNA was eluted with 9 µL. A second restriction was set up:

Part BBa_K081005 BBa_K081006 BBa_K081007
Volume [µL] 17 17 17
FastDigest Buffer [µL] 2 2 2
BcuI [µL] 1 1 1
Total: [µL] 20 20 20

The DNA was restricted at 37 °C for 30 minutes. The DNA was purified using the GeneJET PCR Purification Kit and eluted with 10 µL. The concentration was measured at the Nanodrop.

Part BBa_K081005 BBa_K081006 BBa_K081007
Concentration [ng/µL] 10.53 7.67 7.34

Gel electrophoresis of BBa_C0082 (restricted with XbaI and PstI)

A 2% gel was run for 45 minutes at 130 V. The lower band at 1.5 kb was cut out and the DNA was extracted from the gel with the GeneJET Gel Extraction Kit. DNA was eluted with 32 µL. The DNA-concentration of Taz was 181 ng/µL.

Ligation of BBa_R0082/BBa_I732018 with Terminator BBa_B0015

Components Volume [µL]
BBa_R0082/BBa_I732018 (Insert) 15
BBa_B0015 0.5
T4 Ligase 1
T4 DNA Ligase Buffer 2
water 1
Total: 20

Ligation of Anderson Promoters with Taz

BBa_K081005 BBa_K6081006 BBa_K6081007
Vector (Anderson) [µL] 9 9 9
Insert (BBa_C0082) [µL] 2 2 2
T4 Ligase [µL] 1 1 1
T4 DNA Ligase Buffer [µL] 2 2 2
H2O [µL] 6 6 6
Total: [µL] 20 20 20

Incubation for 15 minutes at RT and heat-inactivation for 10 minutes at 65 °C.

Fabrication of DD01-Chamber-Mask01

Cultivation of Frozen Capsules

  • Light microscopy of the capsule rest/remains and the lysed capsules showed high viability
  • Encapsulation with glycerol-alginate mix does not work, capsules get fragile and start releasing bacteria
  • New encapsulation of bacteria in three different approaches:
      1) Regular encapsulation; frozen on pure glycerol
      2) Regular encapsulation; frozen on glycerol / LB
      3) Encapsulation with alginate-glycerol mix; frozen on 0.9 % NaCl

Production of 50 mL 1 M Tris-HCL Buffer

  • 6.057 g TRIS
  • Adjust to pH 8 with HCl
  • Fill up to 50 µL with water

Production of 0.5 L TE Buffer

  • 5 mL 1M TRIS-HCl at pH 8
  • 2 mL 0.5 M EDTA(Na2) also at pH 8
  • Add 494 mL water

PCR of mTaz and NOD1/EnvZ 3’/5’ OEPCR fragments

mTaz NOD1/EnvZ 5’ OEPCR NOD1/EnvZ 3’ OEPCR
Q5 2x Mastermix (Anderson) [µL] 25
Template [µL] 2.5 1.5 1.5
T4 Ligase [µL] 1 1 1
2.5 µL fw primer (10 mM) GCAAAAAGAATTCGCGG GCAAAAAGAATTCGCGG GGCAGAATCGATCAATAAAGA
2.5 µL rev primer (10 mM) GCTTTTCTGCAGCGG ATATCTTTATTGATCGATTCTGCC GCTTTTCTGCAGCGG
H2O [µL] Add to 50 µL

The following PCR setup was used:

1. 98° C 0:30
2. 98° C 0:10
3. 47° C 0:20
4. 72° C 1:00
5. GOTO 2 repeat 28x
6. 72 °C 2:00
7. HOLD at 4° C

Gel electrophoresis of the recombinant PCR of NOD1/EnvZ 3'5' and PCR of mTaz

10 µL of PCR product was mixed with 2 µL of 6x loading dye and run on an 1% agarose gel at 130 V for 40 minutes.

>

Bands confirmed presence of RPCR 5’ and 3’ fragment as well as mTaz. However, a second band in mTaz (~600 bp) could be observed. The PCR reaction solutions were purified using the PCR Purification Kit. Elution in 35 µL.

  • mTaz concentration: 73.64 ng/µL
  • 5’ RPCR concentration: 69.92 ng/µL
  • 3’ RPCR concentration: 77.95 ng/µL

All PCR products were stored at -20 °C.

Cryostock of the overnight culture

  • DH5α, Anderson 05
  • DH5α, Anderson 06
  • DH5α, Anderson 07

The cryostocks were stored at -80 °C.

Miniprep of the overnight culture

GeneJET Miniprep Kit Protocol was used to the letter, and elution volume was 35 µL.

Construct Concentration [ng/µL]
DH5α, Anderson 05 28.01
DH5α, Anderson 05 30.27
DH5α, Anderson 05 42.99
DH5α, Anderson 06 67.88
DH5α, Anderson 06 41.91
DH5α, Anderson 06 38.04
DH5α, Anderson 07 41.34
DH5α, Anderson 07 72.14
DH5α, Anderson 07 30.26
BBa_I732018/BBa_R0082/BBa_B0015 29.99
BBa_I732018/BBa_R0082/BBa_B0015 55.97
BBa_I732018/BBa_R0082/BBa_B0015 31.69

Sequential Restriction of OmpR/GFP and OmpR/YFP

First the DNA concentrations of the plasmids were measured.

Construct DNA Concentration [ng/µL]
BBa_R0082/BBa_E0240 90.63
BBa_R0082/BBa_E0430 143.74

First restriction with EcoRI

BBa_R0082/BBa_E0240 BBa_R0082/BBa_E0430
Plasmid (1 µg) [µL] 11 7
EcoRI [µL] 1 1
10x CutSmart [µL] 2 2
H2O [µL] 2 2

The restriction preparations were incubated at 37 °C for 15 min and then heat-inactivated at 65 °C for 20 min. The restriction preparations were purified using the GeneJET PCR Purification Kit. DNA was eluted with 20 µL Elution Buffer. Afterwards DNA concentration was measured at the NanoDrop.

DNA concentration [ng/µL]
Purified BBa_R0082/BBa_E0240 90.39
Purified BBa_R0082/BBa_E0430 81.81

Second restriction with Bcu I

Purified OmpR/GFP Purified OmpR/YFP
Plasmid (1 µg) [µL] 12 13
BcuI [µL] 1 1
FD Buffer [µL] 2 2
ddH2O[µL] 5 4

The restriction preparations were incubated at 37 °C for 10 min. The restriction preparations were purified using the GeneJET PCR Purification Kit. DNA was eluted with 20 µL Elution Buffer. Afterwards DNA concentration was measured at the NanoDrop.

DNA concentration [ng/µL] 260/230 280/260
Purified BBa_R0082/BBa_E0240 90.39 0.76 1.77
Purified BBa_R0082/BBa_E0430 34.25 1.96 1.79

Ligation of BBa_R0082/BBa_E0430 and BBa_R0082/BBa_E0240 with BBa_B0015 (Terminator)

A 3:1 (insert:vector) ligation was performed:

OmpR/GFP OmpR/YFP
Vector: restricted BBa_B0015 ( 160909DK05) [µL] 1 1
Insert (71 ng) [µL] 3 2
T4 Ligase [µL] 1 1
T4 Ligase Buffer [µL] 2 2
ddH2O[µL] 13 14

The ligation preparations were incubated at RT for 50 min and then heat-inactivated at 65 °C for 10 min.

Measurement of cultivated frozen capsules

  • OD600 measurements were performed on all three defrosted setups from 13th September
    1. OD600 = 2.346
    2. OD600 = 2.406
    3. OD600 = 2.458

Chloramphenicol Stock Solution

A Chloramphenicol (CAmp) stock solution was prepared following the respective protocol.

LB-Agar Plates

LB-Agar plates were prepared following the respective protocol.

Transformation of JW 3367-3 with Fluorescence Reporters and B0015 - Quantification

Average amount of colonies for C2987/BBa_E0240/B0015

1 μL DNA, 30 μL Trafovolume 1 μL DNA, 60 μL Trafovolume 1 μL DNA, 90 μL Trafovolume
~100 colonies ~200 colonies ~250 colonies

Average amount of colonies for JW3367-3 BBa_E0430/B0015

1 μL DNA 2 μL DNA 5 μL DNA
50 μL Trafovolume 20 colonies not done 33 colonies
65 μL Trafovolume not done 21 colonies not done
90 μL Trafovolume 25 colonies ~35 colonies ~50 colonies

LB-Agar Plates

LB-Agar plates were prepared following the respective protocol.

Vitality examination of encapsulated frozen bacteria via light microscopy

  • Bacteria from the setups from the 13th September were examined via light microscopy
      1) E. coli vital
      2) E. coli vital
      3) alive but slightly lower activity

Validation of LacZα Reporter System by β-Galactosidase Activity

20 μL of JW3367-3 cell transformed with pSB1C3/BBa_R0082/BBa_I732018 were plated onto a LB-Agar/CAmp plate containing 10 μL 10 mg/mL X-Gal and incubated one night at 37°C.

Transformation of JW 3367-3 with pSB1C3/BBa_I732020 (lacZα/Terminator)

150 μL competent JW 3367-3 cells were split into 3 x 50 μL and inoculated with DNA:

  • (+) postive control: 1 μL pSB1C3/BBa_R0082/BBa_I732018
  • (-) negative control: no addition of DNA
  • 1 μL pSB1C3/BBa_I732020, resuspended from iGEM Distribution Kit Plate 3, 2F
Transformation was carried out using the respective protocol.

PCR purification of the linearized plasmids pSB1C3, pSB1A3, pSB1T3

A PCR was performed following the GeneJet PCR Purification Kit Protocoll. The following concentrations were measured with Nanodrop

Plasmid Concentration [ng/µL]
pSB1C3 a 158.77
b 184.20
c 132.83
pSB1A3 189.96
pSB1T3 145.48

PCR amplification of EnvZ Fusionprotein_Tai/RFC25, EnvZ_First_Transmembrane and NOD_1LRRRFC25

Volume [µL]
Q5 2x Mastermix 25
EnvZ 5' fw 2.5
Biobrick 3' 2.5
Template 1
H2O 19

The PCR preparations were mixed according to scheme above. As a template the EnvZ Fusionsprotein_TailRFC25 was used in preparation A. In preparation B the EnvZ_First_Transmembrane and in C the NOD_LRR_RFC25 were used.

The following PCR setup was used:

1. 98° C 0:30
2. 98° C 0:10
3. 47° C 0:20
4. 72° C 1:00
5. GOTO 2 repeat 30x
6. 72 °C 3:00
7. HOLD at 4° C

Analysis of the PCR via gel electrophoresis (plasmid pSB1C3, pSB1A3, pSB1T3)

An agarosegel (1%) was used to analyze the PCR reaction of the plasmids pSB1C3, pSB1A3 and pSB1T3. The first lane contained pSB1C3 a, the second pSB1C3 b,the third pSB1C3 c, the fourth pSB1A3 and the fifth pSB1T3. The gel was incubated with ethidiumbromide for 30 minutes before running it at 150 V for 30 minutes. All preparations contained DNA fragments contained DNA fragments with the expected length.

Analysis of the PCR via gel electrophoresis (EnvZ Fusionprotein_Tail RFC25, EnvZ_First Transmembrane and NOD1_LRR RFC25)

A Agarosegel (1%) was used to analyze the PCR reaction. The first lane contained the EnvZ Fusionprotein_TailRFC25, the second EnvZ First Transmembrane and the third lane NOD1_LRR RFC25. The gel was incubated with ethidiumbromide for 30 minutes before running it at 150 V for 30 minutes. All preparations contained DNA fragments contained DNA fragments with the expected length.

Restriction of pSB1A3, mTaz, EnvZ, pSB1C3 and Reporter Systems

Following scheme was used:

Part pSB1C3 pSB1A3 mTaz EnvZSH EmvZFH NOD1LRR pSB1C3/BBa_R0082 pSB1C3/BBa_I532020 pSB1C3/BBa_K081005 pSB1C3/BBa_K608006 pSB1C3/BBa_E0430 pSB1C3/BBa_E0240
Volume [μL] 17 14.1 13.3 7.9 7.7 13.8 5.0 25.8 18 18 2.9 4.7
Buffer 5 μL NEB Buffer 2.1 5 μL NEB Buffer 2.1 5 μL NEB Buffer 2.1 5 μL NEB Buffer 2.1 5 μL NEB Buffer 2.1 5 μL NEB Buffer 2.1 5 μL Thermo FD 5 μL NEB Buffer 2.1 5 μL Thermo FD 5 μL Thermo FD 5 μL NEB Buffer 2.1 5 μL NEB Buffer 2.1
EcoRI [μL] 1 1 1 1 1 1 - - - - - -
XbaI [μL] - - - - 1 1 - - - - - -
BcuI [μL] - - - - - - 1 - 1 1 - -
PstI [μL] 1 1 1 1 1 1 - 1 - - 1 1
H2O [μL] 26 28.9 29.7 35.1 35.3 29.2 39 17.2 26 26 40.1 38.3

A second restriction was set up:

Part pSB1C3/BBa_R0082 restricted with BcuI pSB1C3/BBa_I532020 restricted with XbaI and PstI pSB1C3/BBa_K081005 restricted with BcuI pSB1C3/BBa_K608006 restricted with BcuI
Volume [μL] 50 25.8 50 50
NEB 2.1 Buffer [μL] 6 6 6 6
EcoRI [μL] 2 - 1.2 1.2
PstI [μL] - 1 - -
XbaI [μL] - 1 - -
H2O [μL] 2.8 17.2 2.8 2.8

Ligation of pSB1A3 and pSB1C3 with the Part Precursors and Fluorescence Reporters as well as pSB1C3 with BBa_R0082 and BBa_I732020

Part 1 5 μL pSB1C3 5 μLpSB1C3 5 μLpSB1C3 5 μLpSB1C3 5 μLpSB1A3 5 μLpSB1A3 5 μLpSB1A3
Part 2 10 μ mTaz 25 μ EnvZ SH 25 μ EnvZ FH 25 μ NOD1-LRR 20 μ BBa_E0430 20 μ BBa_E0240 30 μ BBa_R0082
Part 3 - - - - - - BBa_I732020
T4 Ligase Buffer [μL] 5 5 5 5 5 5 25
T4 Ligase[μL] 2.5 2.5 2.5 2.5 2.5 2.5 10
H2O [μL] 27.5 12.5 12.5 12.5 17.5 17.5 25

Transformation of JW3367-3 with the Ligation Preparations

Competent JW 3367-3 cells were thawed on ice at 4°C and inoculated with the ligation preparations. For each ligation preparation 150 μL competent cells were used, for the positive control (transformed with pcDNA3) and negative control 75 μL were used. Transformation was carried out using the respective protocol.

Fabrication of Diagnostic Device DD01 (SU-8) Master02 continued

  • Continuation after application of base / adhesion layer from the 27th of September
  • Structural layer of SU-8 (GM1075)
    -Spin coating:
      1) 0 - 1000 rpm (100 rpm/second acceleration) in 10 s
      2) 1000 rpm for 100 seconds
      3) 1000 - 1400 rpm (400 rpm/second acceleration) in 1 s
      4) 1400 - 0 rpm (-100 rpm/second acceleration) in 14 seconds

    -30 minutes relaxation time on hotplate at 40 °C:
      The wafer was covered with a crystallization dish, but allowed for breathing due to evaporating SU-8 solvent (PGMEA), otherwise condensation occurs on covering dish and curing during prebake would be insufficient due to excessive vapour pressure

    -Soft bake:
      1) 40 - 120 °°C in about 10 minutes (avg +8 °C/minute)
      2) 120 °C for 12 minutes
      3) 120 °C - 40 °C in about 20 minutes (avg -4 °C/minute)

    -i-line exposure 3) 120 °C - 40 °C in about 20 °minutes (avg -4 °C/minute)
    -1 hour delay time at RT in wafer box before PEB
    -PEB:
      1) RT - 120 °C in about 11 minutes (avg 9 °C/minute); accidentally - 2 bubbles created on structure-free space
      2) 120 °C - 95 °C in about 3 minutes (avg -8 °C/minute)
      3) 95 °C for 50 minutes
      4) 95 °C - 36 °C in about 25 minutes (avg -2.4 °C/minute)

    -Develop:
      -In PGMEA (used) for about 8 minutes while constantly agitating the PGMEA and the wafer in the beaker
      -Wafer was rinsed with isopropanol to stop the development which caused white traces on wafer
      -Isopropanol-rinsed wafer was washed the with new, used PGMEA and subsequently rinsed with isopropanol which caused the previous white traces to vanish, however, lines of residue from isopropanol evaporation remained
      -Examination of the profile (using the DektakXT; Bruker) showed a thickness of approx. 110 μm; comparison between the depth of the large filter structure holes and the fine filter structure holes (as visible in the live video in the DektakXT using a ruler) showed similar depth (7 mm at 100x magnification) and can be checked in the captured images

Bonding of Diagnostic Chip (Channel and Chamber) PDMS Components (PDMS batch from the 24th of September on DD01-Master01)

  • Holes were drilled with 0.75 hole punch through the channel component
  • Droplets of isopropanol were dripped on both components and gently rubbed with the fingertips to clean the PDMS components bonding surface; PDMS was subsequently dried using a N2-gun and leaving it at ambient air
  • Effects of cleaning were examined under a light microscope:
      1) 40 μm square-shaped filter structures (of about 100 μm height) sticked onto each other with the side walls; therefore the filter structure’s columns were bent which resulted in increased filter size due to locally increased width of the filter channels
      2) Touching the filter structures with a sharp metal syringe tip causes unsticking of the filter structures from one another
      3) Wetting with isopropanol caused resticking and resticking persisted upon drying; after completed drying and touching unsticking recurred
  • Both components bonding surfaces were O2-plasma treated simultaneously using the parameters: 100 seconds; about 25 W; 0,4 mbar O2
  • Surfaces were examined using a light microscope; filter structures still remained largely intact and in the same state as before the O2-plasma
  • Wetting of complete bonding surface of chamber component with H2O (demineralised) droplets(5 - 10 droplets)
  • Surfaces were once again examined using a light microscope: filter structures still intact
  • PDMS component’s bonding surfaces were brought together with remaining intermediate H2O layer
  • Channel and chamber components were aligned under a light microscope using tweezers to align; used too much water - too slippery, next time use 1 - 2 droplets (formed by a syringe tip with diameter of about 0.6 mm); alignment markers / triangles do not lock into one another because the PDMS is too rigid and does not bent enough to compensate the 100 μm height difference (10:1 oligomer:initiator ratio used)
  • The chips were put into an oven overnight at 40 °C to cure and bond without further touching or pressing

Preparation of LB-Agar

  1. 1 x 40 g LB-agar were put in 1 L H2O.
  2. The suspension was autoclaved.

Preparation of LB-Agar/Tetracycline-Plates

  1. 1 mL of tetracycline stock solution were added into 1 L liquid LB-agar.
  2. The solution was poured into petri dishes under sterile conditions.
  3. Plates were stored at 4°C.

Preparation of Tetracycline Stock Solution

  1. 3 x 10 mg tetracycline were solved in 1 mL H2O.
  2. Steril filtered with a 0.22 μm filter.
  3. Stored at -20°C.

Preparation of LB-Medium

  1. 2 x 25 g LB-medium were put in 1 L H2O.
  2. The suspension was autoclaved.
  3. Stored at 4°C.

PCR of EnvZ RFC25

Following scheme was used for the different preparations.

Template 1 μL
Primer fw 2.5 μL 
Primer rv 2.5 μL 
10 x Dream Taq buffer 5 μL
dNTPs (10 mM) 1 μL
Taq polymerase 0.1 μL
H2O 39.5 μL
50 μL
There were three preparations:
Template Primer fw Primer rv
EnvZ RFC25 TM1 RFC23 TMFirst fw RFC23 TMFirst rv
Nod1/EnvZ RFC25 Tail RFC23 EnvZ Tail fw RFC23 EnvZ Tail rv
Nod1/LRR RFC25 RFC23 NOD1-LRR fw RFC23 NOD1-LRR rv

Preparations of Competent Cells DH5α

  1. Overnight cultures of the DH5α were splitted into two 1000 mL Erlenmeyer flask in 500 mL LB-medium and grown at 37°C, 250 rpm.
  2. The OD was checked till it reached 0.4
    Time after incubation start [min] OD (1.=flask 1; 2.=flask 2 )
    20 1. 0.044; 2. 0.026
    50 1. 0.053; 2. 0.030
    80 1. 0.055; 2. 0.026
    120 1. 0.278; 2. 0.144
    2. 0.352
    2. 0.420 -> done
  3. Cells were chilled on ice for at least 5 min.
  4. Cells were centrifuged at 5000 rpm for 10 min at 4°C.
  5. Flow-through was discarded.
  6. Cells were resuspended in 40 mL cold Ca/glycerol buffer on ice.
  7. Cells were chilled on ice for at least 30 min.
  8. Cells were centrifuged at 4000 rpm for 10 min at 4°C.
  9. Flow-through was discarded.
  10. Cells were resuspended in 40 mL cold Ca/glycerol buffer and chilled on ice for 90 min.
  11. Cells were collected by centrifugation (5000 rpm, 15 min, 4°C)
  12. Cells were resuspended in 6 mL cold Ca/glycerol buffer on ice.
  13. Aliquots of 150 μL each were made.
  14. Aliquoted competent cells were frozen in liquid N2 and stored at -80°C.

PCR of EnvZ RFC25

Following scheme was used for the different preparations.

Template 1 μL
Primer fw 2.5 μL 
Primer rv 2.5 μL 
10 x Dream Taq buffer 5 μL
dNTPs (10 mM) 1 μL
Taq polymerase 0.1 μL
H2O 39.5 μL
50 μL
There were three preparations:
Template Primer fw Primer rv
EnvZ RFC25 TM1 RFC23 TMFirst fw RFC23 TMFirst rv
Nod1/EnvZ RFC25 Tail RFC23 EnvZ Tail fw RFC23 EnvZ Tail rv
Nod1/LRR RFC25 RFC23 NOD1-LRR fw RFC23 NOD1-LRR rv

PCR Purification of ENvZ/LRR

The PCR products were purified using the respective protocol. DNA concentrations were measured:

DNA DNA concentration [ng/μL]
EnvZ RFC25 TM1 36.36
Nod1/EnvZ RFC25 Tail 97.89
Nod1/LRR RFC25 33.72

PCR of mTaz

Following scheme was used:

Template 1 μL
Primer EnvZ 5' fw 2.5 μL 
Primer EnvZ 3' rv 2.5 μL 
Q5 Master Mix 2x 25 μL
H2O 19 μL
50 μL
Following programme was used for the PCR:
1. 98 °C 30 sec
2. 98 °C 10 sec
3. 47 °C 20 sec
3. 72 °C 1.5 min
4. GOTO 2. Repeat 34x
5. 72 °C 3 min
4 °C ∞

PCR Purification of mTaz

The PCR product was purified using the respective protocol. DNA concentration was measured:

DNA DNA concentration [ng/μL]
mTaz 104.36

PCR of mTaz

Following scheme was used:

Template 1 μL
Primer EnvZ 5' fw 2.5 μL 
Primer EnvZ 3' rv 2.5 μL 
Q5 Master Mix 2x 25 μL
H2O 19 μL
50 μL
Following programme was used for the PCR:
1. 98 °C 30 sec
2. 98 °C 10 sec
3. 47 °C 20 sec
3. 72 °C 1.5 min
4. GOTO 2. Repeat 34x
5. 72 °C 3 min
4 °C ∞
The PCR products were loaded onto a 1%-gel. There was one band at the expected size 1.500 bp along with four other bands, that weren't the expected size.

PCR of mTaz

Following scheme was used:

Template 1 μL
Primer EnvZ 5' fw 2.5 μL 
Primer EnvZ 3' rv 2.5 μL 
10 Pfu buffer 5 μL
dNTPs (10 mM each) 1.5 μL
Pfu polymerase 1 μL
H2O 36.5 μL
50 μL
Following programme was used for the PCR:
1. 98 °C 30 sec
2. 98 °C 10 sec
3. 47 °C 20 sec
3. 72 °C 4 min
4. GOTO 2. Repeat 34x
5. 72 °C 3 min
4 °C ∞

Restriction of pSB1C3, pSB1A3, mTaz and Taz

Part EnvZ TM first NOD1-LRR EnvZ Tail
Volume [μL] 3.8 8.4 2.8
NEB Buffer 2.1 [μL] 2 2 2
EcoRI [μL] 0.5 0.5 0.5
PstI [μL] 1 1 1 1 1 1
H2O [μL] 3 3 9.5 31.8 13 20.1
Total [μL] 50 50 50 50 50 50

The DNA was restricted for 1 h at 37 °C. Enzymes were heat-inactivated for 20 minutes at 80°C.

Ligation

Part 1 pSB1C3 pSB1C3 pSB1A3 pSB1A3 pSB1A3 pSB1A3 pSB1A3 pSB1A3
Part 2 mTaz (IDT) mTaz aliquot 2 BBa_K081005 BBa_K608006 BBa_K608007 BBa_K081005 BBa_K608006 BBa_K608007
Part 3 - - mTaz mTaz mTaz Taz Taz Taz
T4 Ligase Buffer [μL] 6 6 6 6 6 6 6 6
T4 [μL] 1.2 1.2 1.2 1.2 1.2 1.2 1.2 1.2
H2O [μL] 2.1 38.3 7.6 7.6 7.6 7.6 7.6 7.6

Restriction of pSB1C3, pSB1A3, mTaz and Taz

Part pSB1C3 pSB1A3 mTaz aliquot 1 mTaz aliquot 2 mTaz (IDT) mTaz
Volume [μL] 40 40 33.5 11.2 30 22.9
NEB Buffer 2.1 [μL] 5 5 5 5 5 5
EcoRI [μL] 1 1 - 1 1 -
XbaI [μL] - - 1 - - 1
PstI [μL] 1 1 1 1 1 1
H2O [μL] 3 3 9.5 31.8 13 20.1
Total [μL] 50 50 50 50 50 50

The DNA was restricted for 1 h at 37 °C. Enzymes were heat-inactivated for 20 minutes at 80°C.

Transformation of JW3367-3 and NEB competent E. coli with ligations

Following plasmids were transformed into following cells:

cells Plasmids
NEB cc pSB1C3/mTaz(IDT)
NEB cc pSB1A3/BBa_K081005/mTaz
NEB cc pSB1A3/BBa_K608006/mTaz
NEB cc pSB1A3/BBa_K608007/mTaz
JW3367-3 pSB1C3/mTaz
JW3367-3 pSB1A3/BBa_K081005/mTaz
JW3367-3 pSB1A3/BBa_K608006/mTaz
JW3367-3 pSB1A3/BBa_K608007/mTaz
JW3367-3 pSB1A3/BBa_K081005/BBa_C0082
JW3367-3 pSB1A3/BBa_K608006/BBa_C0082
JW3367-3 pSB1A3/BBa_K608007/BBa_C0082
JW3367-3 (+) positive control: pcDNA (1:20)
JW3367-3 (-) negative control: - (plated onto CAmp plate)
JW3367-3 (-) negative control: - (plated onto Amp plate)
DH5α competent cell control: pcDNA (1:20)
Transformation was carried out using the respective protocol. At the end cells were spun down, resuspended in 50 μL LB-medium and plated onto LB-agar plates with the suitable antibiotic.

Colony PCRs of cells transformed with pSB1C3/mTaz

Following mastermix for 30 PCR reactions was set up:

VF2 Primer fw 15 μL 
VR Primer rv 15 μL 
10 x Dream Taq buffer 30 μL
dNTPs (10 mM) 6 μL
Dream Taq polymerase 7.5 μL
H2O 226.5 μL
total 300 μL
28 x 10 μL of the mastermix was pipetted into PCR tubes, which were inoculated with:
Colony numbering Content
1 - 2 old mTaz from 27.09.
3 - 28 different colonies from the transformations from 03.10.
Positive results (bands with expected sizes) for 4 - 6, 10, 13, 15, 20, 24 and 26.

Colony PCRs of cells transformed with pSB1C3/mTaz

Following mastermix for 90 PCR reactions was set up:

VF2 Primer fw 45 μL 
VR Primer rv 45 μL 
10 x Dream Taq buffer 90 μL
dNTPs (10 mM) 18 μL
Dream Taq polymerase 22.5 μL
H2O 679.5 μL
total 900 μL
80 x 10 μL of the mastermix was pipetted into PCR tubes, which were inoculated with:
Colony numbering Content
29 NEB cc pSB1C3/mTaz (IDT)
30 - 31 NEB cc pSB1A3/BBa_K608007/mTaz 2
32 - 36 NEB cc pSB1A3/BBa_K081005/mTaz 2
37 - 44 NEB cc pSB1A3/BBa_K608007/mTaz 1
45 - 52 NEB cc pSB1A3/BBa_K608006/mTaz 1
53 - 60 NEB cc pSB1A3/BBa_K608007/mTaz 1
61 - 68 JW3367-3 pSB1A3/BBa_K081005/mTaz
69-76 JW3367-3 pSB1A3/BBa_K608006/mTaz
77 - 84 JW3367-3 pSB1A3/BBa_K608007/mTaz
85 - 92 JW3367-3 pSB1A3/BBa_K081005/BBa_C0082
93-100 JW3367-3 pSB1A3/BBa_K608006/BBa_C0082
101 - 108 JW3367-3 pSB1A3/BBa_K608007/BBa_C0082
Positive results (bands with expected sizes) for 29, 31, 37, 55, 68.

Minipreparation of Overnight Cultures

The minipreparation was carried out following the instructions of the GeneJET Plasmid Miniprep Kit.

Plasmid DNA concentration
pSB1C3/mTaz colony 4 158.29 ng/μL
pSB1C3/mTaz colony 5 143.37 ng/μL
pSB1C3/mTaz colony 6 141.55 ng/μL
pSB1C3/mTaz colony 10 98.89 ng/μL
pSB1C3/mTaz colony 13 134.68 ng/μL
pSB1C3/mTaz colony 15 188.91 ng/μL
pSB1C3/mTaz colony 20 176.11 ng/μL
pSB1C3/mTaz colony 24 165.42 ng/μL

Restriction of EnvZ TM first, NOD1-LRR and EnvZ Tail for RFC23 Assembly

Part EnvZ TM first NOD1-LRR EnvZ Tail
Volume [μL] 3.8 8.4 2.8
NEB Buffer 2.1 [μL] 2 2 2
EcoRI [μL] 0.5 0.5 0.5
PstI [μL] 0.5 0.5 0.5
H2O [μL] 13.2 8.6 14.2
Total [μL] 20 20 20

The DNA was restricted for 20  at 37°C. Enzymes were heat-inactivated for 30 minutes at 80°C.

Ligation of pSB1C3 with the EnvZ Parts

Three ligations were set up using restricted, dephosphorylated linear pSB1C3 and the restricted EnvZ parts.

Part 1 10.5 μL pSB1C3 4.6 μL pSB1C3 4.9 μL pSB1C3
Part 2 10 μL EnvZ TM first 10 μL NOD1-LRR 10 μL EnvZ Tail
T4 Ligase Buffer [μL] 2.5 2 2
T4 Ligase [μL] 0.5 0.5 0.5
H2O [μL] 1.5 2.9 2.6
Ligations were incubated at 22°C for 1 h. Ligase was heat inactivated at 80°C for 20 min.

Transformation of JW3367-3 with pSB1C3/EnvZ-parts

8 x 150 μL competent JW 3367-3 cells were thawed on ice at 4°C and inoculated with DNA as following:

cell amount [μL] DNA DNA amount [ng]
150 pSB1C3/EnvZ TM first ligation 200
150 pSB1C3/NOD1-LRR ligation 200
150 pSB1C3/EnvZ Tail ligation 200
50 pSB1C3/BBa_B0015 50 ng
50 - (negative control) -
Transformation was carried out using the respective protocol. At the end cells were spun down, resuspended in 50 μL LB-medium and plated onto LB-agar/CAmp-plates.

Colony PCRs

Following mastermix for 40 PCR reactions was set up:

VF2 Primer fw 20 μL 
VR Primer rv 20 μL 
10 x Dream Taq buffer 40 μL
dNTPs (10 mM) 8 μL
Dream Taq polymerase 2 μL
H2O 310 μL
total 400 μL
33 x 10 μL of the mastermix was pipetted into PCR tubes, which were inoculated with:
Colony numbering Content
1 - 3 NEB cc pSB1A3/BBa_K081005/mTaz 2
4 - 6 NEB cc pSB1A3/BBa_K081005/mTaz 1
7 - 9 NEB cc pSB1A3/BBa_K608006/mTaz
10 - 12 NEB cc pSB1A3/BBa_K608007/mTaz 1
13 - 15 JW3367-3 pSB1A3/BBa_K081005/mTaz
16 - 18 JW3367-3 pSB1A3/BBa_K608006/mTaz
19 - 21 JW3367-3 pSB1A3/BBa_K608007/mTaz
22 - 24 JW3367-3 pSB1A3/BBa_K081005/BBa_C0082
25 - 27 JW3367-3 pSB1A3/BBa_K608006/BBa_C0082
28 - 30 JW3367-3 pSB1A3/BBa_K608007/BBa_C0082
31 NEB cc pSB1A3/BBa_K608007/mTaz 2
32 NEB cc pSB1A3/BBa_K608007/mTaz
33 JW3367-3 pSB1C3/BBa_R0082/BBa_I7302020
Positive results (bands with expected sizes) for 12, 22, 25, 26, 31 and 32.

LB-Agar Plates with antibodies

  1. CAmp/Amp
    700&nbp;mL LB-agar were mixed with 700&nbp;μL CAmp and 700&nbp;μAmp. The solution was distributed onto petri dishes.
  2. Amp
    700&nbp;mL LB-agar were mixed with 700&nbp;μAmp. The solution was distributed onto petri dishes.
  3. CAmp
    600&nbp;mL LB-agar were mixed with 600&nbp;μL CAmp The solution was distributed onto petri dishes.

Transformation of JW3367-3 with the (m)Taz ligations and pSB1C3/OmpR/GFP

8 x 150 μL competent JW 3367-3 cells were thawed on ice at 4°C and inoculated with DNA as following:

cell amount [μL] DNA DNA amount [μL/100 ng]
150 pSB1A3/BBa_K081005/mTaz + pSB1C3/BBa_R0082/BBa_E0240 1.16 + 1.16
150 pSB1A3/BBa_K081005/BBa_C0082 + pSB1C3/BBa_R0082/BBa_E0240 1.39 + 1.16
150 pSB1A3/BBa_K608006/BBa_C0082 + pSB1C3/BBa_R0082/BBa_E0240 0.77 + 1.16
150 pSB1A3/BBa_K608007/BBa_C0082 + pSB1C3/BBa_R0082/BBa_E0240 1.58 + 1.16
negative control: 150 - -
negative control: 150 pSB1A3/BBa_K608006/BBa_C0082 1.54/200 ng
negative control: 150 pSB1C3/BBa_R0082/BBa_E0240 2.32/200 ng
positive control: 150 pSB1A3/BBa_K608006/BBa_C0082 (plated onto LB-agar/Amp plates) 1.54/200 ng
positive control: 150 pSB1C3/BBa_R0082/BBa_E0240 (plated onto LB-agar/CAmp plates) 2.32/200 ng
Transformation was carried out using the respective protocol. At the end cells were spun down, resuspended in 50 μL LB-medium and plated onto LB-agar/CAmp/Amp plates (if not stated otherwise).

Colony PCRs of cells transformed with pSB1C3/mTaz

Following mastermix for 20 PCR reactions was set up:

VF2 Primer fw 10 μL 
VR Primer rv 10 μL 
10 x Dream Taq buffer 20 μL
dNTPs (10 mM) 4 μL
Dream Taq polymerase 1 μL
H2O 155 μL
total 200 μL
18 x 10 μL of the mastermix was pipetted into PCR tubes, which were inoculated with:
Colony numbering Content
1 - 6 JW3367-3/pSB1C3/NOD1-LRR
7 - 12 JW3367-3/pSB1C3/EnzZ Tail
13 - 18 JW3367-3/pSB1C3/EnvZ TM first
Positive results (bands with expected sizes) for 6, 7, 10, 14 and 15.

Minipreparation of Overnight Cultures from the PCRs from 05.10. and 06.10

The minipreparation was carried out following the instructions of the GeneJET Plasmid Miniprep Kit.

Plasmid DNA concentration
pSB1A3/BBa_K608006/BBa_C0082 93.04 ng/μL
pSB1A3/BBa_K608006/BBa_C0082 129.88 ng/μL
pSB1A3/BBa_K608007/mTaz 98.40 ng/μL
pSB1A3/BBa_K608007/mTaz 63.21 ng/μL
pSB1A3/BBa_K081005/mTaz 86.03 ng/μL
pSB1A3/BBa_K081005/mTaz 90.59 ng/μL
pSB1A3/BBa_K081005/BBa_C0082 71.80 ng/μL

Preparation of Aspartate Solution

2.5 g in 100 mL H2O

Measurement of Aspartate sensor (BBa_C0082)

16 samples JW 3367-3 cells with pSB1A3/BBa_K608006/BBa_C0082 and pSB1C3/BBa_R0082/BBa_E0240 were inoculated in 5 mL LB-medium with CAmp/Amp resistance and grown until OD600=0.178.
Incremental Aspartate concentrations were given for pairs of three, leading to concentrations of 0.0, 0.001, 0.005, 0.01, 0.025 [g/mL].
Incubation was performed for 30, 60, 120 minutes after which 10.000  cells werde measured on the FAC.

Making BBa_K081005/mTaz, BBa_K608006/mTaz and BBa_K608007/mTaz competent cells

  1. JW 3367-3/pSB1A3/BBa_K081005/mTaz (colony 68)
  2. NEB competent cells/pSB1A3/BBa_K608007/mTaz (colony 55)
  3. NEB competent cells/pSB1A3/BBa_K081005/mTaz (colony 37)
  4. NEB competent cells/pSB1A3/BBa_K608007/mTaz (colony 31)

This samples were incolated overnight in LB/Amp-medium. Cryostocks were produced, following the respective protocol and the cells were incolated in 50 mL LB/Amp-medium flasks until OD600=0.27. The cultered were chilled on ice for 5 min and collected after centrifugation at 5000 rpm, 10 min, 4 °C.
The cells were gently resuspended in 4 mL cold Ca/Glycerol Buffer, as desribed in the Zang Gong Competent Cell Protocol, and chilled on ice for 20 minutes.
Afterwards they were centrifuged at 4500 rpm, 4 °C, 10 min.
The add Ca/Glycerol Buffer was discarded and new 4 mL Buffer were added. The cells were then incubated for 60 minutes and the centrifuged at 5000 rpm, 4 °C, 10 min. The Buffer was discarded and 600 μL Ca/Glycerol Buffer was added per 50 mL falcon.
The competent cells were stored in 150 μL aliquots.

Transformation

according to Zang Gong Competent Cell Protocol

cell amount [μL] DNA DNA amount[μL;ng]
NEB competent cells/pSB1A3/BBa_K608007/mTaz (colony 31) 50.0 pSB1C3/BBa_R0082/BBa_E0240 0.58;50
NEB competent cells/pSB1A3/BBa_K081005/mTaz (colony 37) 50.0 pSB1C3/BBa_R0082/BBa_E0240 0.58;50
NEB competent cells/pSB1A3/BBa_K608007/mTaz (colony 55) 50.0 pSB1C3/BBa_R0082/BBa_E0240 0.58;50
JW 3367-3/pSB1A3/BBa_K081005/mTaz (colony 68) 100.0 pSB1C3/BBa_R0082/BBa_E0240 2.32;200
NEB competent cells/pSB1A3/BBa_K608007/mTaz (colony 31) 50.0 - -
NEB competent cells/pSB1A3/BBa_K081005/mTaz (colony 37) 50.0 - -
JW 3367-3 50.0 pSB1A3/BBa_K608007/mTaz
pSB1C3/BBa_R0082/BBa_E0240 		0.79; 50
0.58; 50
JW 3367-3 50.0 pSB1A3/BBa_K081005/mTaz
pSB1C3/BBa_R0082/BBa_E0240 		0.59; 50
0.58; 50
JW 3367-3 50.0 pSB1A3/BBa_K081005/BBa_C0082
pSB1C3/BBa_R0082/BBa_E0240 		0.70; 50
0.58; 50
JW 3367-3 50.0 pSB1A3/BBa_K608006/BBa_C0082
pSB1C3/BBa_R0082/BBa_E0240 		0.39; 50
0.58; 50
JW 3367-3 50.0 - -
JW 3367-3 (negativ) 50.0 pSB1A3/BBa_K608006/BBa_C0082 0.39; 50
JW 3367-3 (negativ) 50.0 pSB1C3/BBa_R0082/BBa_E0240 0.58; 50
JW 3367-3 (positiv) 50.0 pSB1A3/BBa_K608006/BBa_C0082 0.39; 50
JW 3367-3 (positiv) 50.0 pSB1C3/BBa_R0082/BBa_E0240 0.58; 50

The CAmp/Amp plates are preparated with 20 μL (40 %) Amp, the same for the Amp-plates for positiv and negativ control.
Plates incubated at 37 °C

Colony PCR I

PCR reaction Master Mix (20x)

amount [μL]
10x DreamTaq Buffer 40.0
dNTPs, 10 mM 8.0
VF2 Primer, 10 μM 20.0
VR Primer, 10 μM 20.0
DreamTaq 2.0
H2O 310.0
400.0
Colony cell with plasmids
1 NEB Competent Cells with pSB1A3/BBa_K081005/mTaz and pSB1C3/BBa_R0082/BBa_E0240
2 NEB Competent Cells with pSB1A3/BBa_K081005/mTaz and pSB1C3/BBa_R0082/BBa_E0240
3 NEB Competent Cells with pSB1A3/BBa_K081005/mTaz and pSB1C3/BBa_R0082/BBa_E0240
4 NEB Competent Cells with pSB1A3/BBa_K081005/mTaz and pSB1C3/BBa_R0082/BBa_E0240
5 JW 3367-3 with pSB1A3/BBa_K081005/mTaz and pSB1C3/BBa_R0082/BBa_E0240
6 JW 3367-3 with pSB1A3/BBa_K081005/mTaz and pSB1C3/BBa_R0082/BBa_E0240
7 JW 3367-3 with pSB1A3/BBa_K081005/mTaz and pSB1C3/BBa_R0082/BBa_E0240
8 JW 3367-3 with pSB1A3/BBa_K081005/mTaz and pSB1C3/BBa_R0082/BBa_E0240
9 JW 3367-3 with pSB1A3/BBa_K081005/mTaz and pSB1C3/BBa_R0082/BBa_E0240
10 JW 3367-3 with pSB1A3/BBa_K608006/BBa_C0082 and pSB1C3/BBa_R0082/BBa_E0240
11 JW 3367-3 with pSB1A3/BBa_K608006/BBa_C0082 and pSB1C3/BBa_R0082/BBa_E0240
12 JW 3367-3 with pSB1A3/BBa_K608006/BBa_C0082 and pSB1C3/BBa_R0082/BBa_E0240
13 JW 3367-3 with pSB1A3/BBa_K608006/BBa_C0082 and pSB1C3/BBa_R0082/BBa_E0240
14 JW 3367-3 with pSB1A3/BBa_K608006/BBa_C0082 and pSB1C3/BBa_R0082/BBa_E0240
15 JW 3367-3 with pSB1A3/BBa_K608006/BBa_C0082

Colonies were picked and resuspended in 4 μL H2O
3 μL H2O were transformed into 5 mL LB/CAmp/Amp-medium, the rest was used as template for the PCR.
Program: TAQSCREEN

result: all samples are positiv!

Colony PCR II

PCR reaction Master Mix (20x)

amount [μL]
10x DreamTaq Buffer 40.0
dNTPs, 10 mM 8.0
VF2 Primer, 10 μM 20.0
VR Primer, 10 μM 20.0
DreamTaq 2.0
H2O 310.0
400.0
Colony cell with plasmids
1 NEB Competent Cells with pSB1A3/BBa_K608007/mTaz and pSB1C3/BBa_R0082/BBa_E0240
2 NEB Competent Cells with pSB1A3/BBa_K608007/mTaz and pSB1C3/BBa_R0082/BBa_E0240
3 NEB Competent Cells with pSB1A3/BBa_K608007/mTaz and pSB1C3/BBa_R0082/BBa_E0240
4 NEB Competent Cells with pSB1A3/BBa_K608007/mTaz and pSB1C3/BBa_R0082/BBa_E0240
5 JW 3367-3 with pSB1A3/BBa_K608007/mTaz and pSB1C3/BBa_R0082/BBa_E0240
6 JW 3367-3 with pSB1A3/BBa_K081005/mTaz and pSB1C3/BBa_R0082/BBa_E0240
7 JW 3367-3 with pSB1A3/BBa_K081005/mTaz and pSB1C3/BBa_R0082/BBa_E0240
8 JW 3367-3 with pSB1A3/BBa_K081005/mTaz and pSB1C3/BBa_R0082/BBa_E0240
9 JW 3367-3 with pSB1A3/BBa_K081005/mTaz and pSB1C3/BBa_R0082/BBa_E0240
10 JW 3367-3 with pSB1A3/BBa_K081005/mTaz and pSB1C3/BBa_R0082/BBa_E0240
11 JW 3367-3 with pSB1A3/BBa_K081005/BBa_C0082 and pSB1C3/BBa_R0082/BBa_E0240
12 JW 3367-3 with pSB1A3/BBa_K081005/BBa_C0082 and pSB1C3/BBa_R0082/BBa_E0240
13 JW 3367-3 with pSB1A3/BBa_K081005/BBa_C0082 and pSB1C3/BBa_R0082/BBa_E0240
14 JW 3367-3 with pSB1A3/BBa_K081005/BBa_C0082 and pSB1C3/BBa_R0082/BBa_E0240
15 JW 3367-3 with pSB1A3/BBa_K081005/BBa_C0082 and pSB1C3/BBa_R0082/BBa_E0240

Colonies were picked and resuspended in 4 μL H2O
3 μL H2O were transformed into 5 mL LB/CAmp/Amp-medium, the rest was used as template for the PCR.
Program: TAQSCREEN

Inoculate for FACS

  1. 2x 50 μL JW 3367-3 with pSB1A3/BBa_K081005/mTaz and pSB1C3/BBa_R0082/BBa_E0240
  2. 2x 50 μL JW 3367-3 with pSB1A3/BBa_K608006/BBa_C0082 and pSB1C3/BBa_R0082/BBa_E0240
  3. 2x 50 μL JW 3367-3 with pSB1A3/BBa_K608007/BBa_C0082 and pSB1C3/BBa_R0082/BBa_E0240

negative controls

  1. 20x 50 μL in 45 mL JW 3367-3/pSB1C3/BBa_R0082/BBa_E0240
  2. 20x 500 ΜL in 45 mL JW 3367-3/pSB1A3/BBa_K081005/mTaz

Preparation of DAP solutions

DAP solution was prepared in a 1 g/ 100 mL concentration on a 40 mL volumina with autoclaved water.

FACs

Since ONCs failed to grow (fast enough) the following cultures were prepared for FACs measurement.

  1. NEB Competent Cells with pSB1A3/BBa_K081005/mTaz and pSB1C3/BBa_R0082/BBa_E0240
  2. JW 3367-3 with pSB1C3/BBa_K608007/mTaz and pSB1C3/BBa_R0082/BBa_E0240
  3. JW 3367-3 with pSB1C3/BBa_K608007/mTaz and pSB1C3/BBa_R0082/BBa_E0240
  4. JW 3367-3 with pSB1C3/BBa_K608006/mTaz and pSB1C3/BBa_R0082/BBa_E0240

Preparation included centrifugation, resuspended in new LB-medium, splitting the culture into nine samples and treating them with:
0; 0.1; 1.0; 5.0; 10.0 [mmol/L] of DAP and Aspartate.

At timepoints of 0, 30, 90 minutes 1 mL culture was centrifuged at 3000 rpm for 15 minutes to get cell pellett. The supernatant was discarted and the cells werde resuspended in 1 mL PBS.
The cells were centrifuged at 13400 rpm for 1 minuts.
The supernatant were discarded and the cells resuspended in 1 mL PBS for FACs analysis.

Preparations of FACs Samples

  1. JW 3367-3 cells
  2. DH5α cells
  3. JW 3367-3/pSB1C3/BBa_R0082/BBa_E0240
  4. DH5α/pSB1C3/BBa_R0082/BBa_E0240

Cells were splitted in nine 5 mL cultures after centrifugation and resuspention in 45 mL LB-medium.
Cell cultures 3 and 4 were treated with CAmp.
At timepoints of 0, 30, 90 minutes 1 mL culture was centrifuged at 3000 rpm for 15 minutes to get cell pellett. The supernatant was discarted and the cells werde resuspended in 1 mL PBS.
The cells were centrifuged at 13400 rpm for 1 minuts.
The supernatant were discarded and the cells resuspended in 1 mL PBS for FACs analysis.

Get constructs from pSB1K3 into pSB1C3

mTaz and BBa_C0082 with Anderson Promoters [BBa_K081005, BBa_K608006, BBa_K608007] (respectivly)

Restriction

  • 5 μL pSB1C3 (50 ng/μL)
  • 3.4 μL pSB1A3/BBa_K608007/mTaz
  • 2.3 μL pSB1A3/BBa_K081005/mTaz
  • 2.8 μL pSB1A3/BBa_K081007/BBa_C0082
  • 2.1 μL pSB1A3/BBa_K608006/BBa_C0082

Add 0.5 μL PstI and EcoRI and 2 μL 2.1NEB Buffer for each reaction, add H2O to 20 μL
Incubate for 20 min (37 °C); heat inactivate for 20 min (80 °C)

Dephosphorylation of Vector

Add 0.5 μL FastAP and 2 μL AP Buffer
Incubate for 10 min (37 μC), heat inactivation 5 min (75 °C)

Ligation

  • Vektor and Insert (1:5)
  • 4.5 μL pSB1C3 (50 ng)
  • 20.0 μL of each BBa_C0082 and mTaz Restriction sample
  • 1.0 μL T4 Ligase
  • 3.0 μL T4 Buffer
  • 1.5 μL H2O

Incubation for 1 h (22 °C), heat inactivation for 10 min (65 °C)

Transformation

Transformation following the Zhang Gongs Transformation protocol
25.0 μL of each ligation product.

Colony PCR and Over Night Cultures

Master Mix

10x DreamTaq Buffer 35.0 μL
dNTPs, 10 mM 7.0 μL
VF2 Primer, 10 μM 5.0 μL
VR Primer, 10 μM 5.0 μL
DreamTaq 2.0 μL
H2O 331.0 μL
to 350 μL

Eight colonies of each construct were picked.
positiv bands

  1. pSB1C3/BBa_K081005/mTaz colonies 1, 2, 4, 6 and 7
  2. pSB1C3/BBa_K608006/BBa_C0082 colonies 10, 11, 12, 13, 14, 15 and 16
  3. pSB1C3/BBa_K081005/BBa_C0082 colonies 17, 18, 19, 20, 21, 22 and 24
  4. pSB1C3/BBa_K608007/mTaz colonies 25, 28, 29, 30, 31 and 32

first three of each sample there minipreped, following the respective protocol
of each cryostock were generated, following the respective protocol

Fabrication of ED02 (SU-8) Master01

  • 4-inch Si-wafer was dehydrated for 20 minutes at 130 °C in oven
  • Base / adhesion layer of SU-8 (GM1060):
    -Spin coating:
      1) 0 - 4000 rpm (100 rpm/second acceleration) in 40 s
      2) 4000 rpm for 40 seconds
      3) 4000 - 0 rpm (-100 rpm/second acceleration) in 40 seconds

    -30 minutes relaxation time at RT
    -Soft bake:
      1) 37 °C - 65 °C in about 5 minutes (avg +6 °C/minute)
      2) 65 °C for 5 minutes
      3) 65 °C - 95 °C in about 5 minutes (avg +5 °C/minute)
      4) 95 °C for 5 minutes
      5) 95 °C - 49 °C in about 13 minutes (avg -3.5 °C/minute)

    i-line exposure (13 mW/cm2) for 30 seconds without mask (complete exposure)
    -10 minutes delay time before PEB
    -PEB:
      1) 36 °C - 65 °C in about 5 minutes (avg +6 °C/minute)
      2) 65 °C for 5 minutes
      3) 65 °C - 95 °C in about 5 minutes (avg +6 °C/minute)
      4) 95 °C for 15 minutes
      5) 95 °C - 45 °C in about 15 minutes (avg -3.3 °C/minute)
  • Structural layer of SU-8 (GM1075):
    -Spin coating:
      1) 0 - 1000 rpm (100 rpm/second acceleration) in 10 s
      2) 1000 rpm for 100 seconds
      3) 1000 - 1400 rpm (10000 rpm/second acceleration) in 1 s
      4) 1400 - 0 rpm (-100 rpm/second acceleration) in 14 seconds

    -30 minutes relaxation time on hotplate at 40 °C; covered with glass dish
    -Soft bake:
      1) 40 - 120 °C in about 9 minutes (avg +9 °C/minute)
      2) 120 °C for 5 minutes
      3) 120 °C - 37 °C in about 25 minutes (avg -3.3 °C/minute)

    -i-line exposure (13 mW/cm2 at 365 nm) for 30 seconds (corresponding 390 mJ/cm2 instead of recommended 350 mJ/cm2) using the ED02-Mask01
    -1 hour delay time at RT in wafer box before PEB
    -PEB:
      1) 28 °C- 95 °C in about 7 minutes (avg 9.5 °C/minute);
      2) 95 °C for 30 minutes
      3) 95 °C - 41 °C in about 16 minutes (avg -2.4 °C/minute)

    -Develop:
      -In PGMEA (new) for about 8 minutes while constantly agitating the PGMEA and the wafer in the beaker
      -Wafer was rinsed with isopropanol to stop the development which caused white traces on wafer
      -Isopropanol-rinsed wafer was washed the with new, used PGMEA and subsequently rinsed with isopropanol which caused the previous white traces to vanish, however, lines of residue from isopropanol evaporation remained
      -Examination of the profile (using the DektakXT; Bruker) showed a thickness of approx. 110 μm; comparison between the depth of the large filter structure holes and the fine filter structure holes (as visible in the live video in the DektakXT using a ruler) showed similar depth (7 mm at 100x magnification) and can be checked in the captured images