Difference between revisions of "Team:SUSTech Shenzhen/Notebook/Molecular"

Line 5: Line 5:
 
url=wiki/images/e/e1/T--SUSTech_Shenzhen--Notebook.svg | size=70px | title=Molecular Experiment | subtitle=Notebook}}
 
url=wiki/images/e/e1/T--SUSTech_Shenzhen--Notebook.svg | size=70px | title=Molecular Experiment | subtitle=Notebook}}
 
{{:Team:SUSTech_Shenzhen/main-content-begin}}
 
{{:Team:SUSTech_Shenzhen/main-content-begin}}
−
 
 
= 2015 =
 
= 2015 =
  
−
== 12 ==
+
== Dec. ==
  
−
=== 13 ===
+
=== 13<sup>th</sup> ===
  
 
==== Geco plasmid construction ====
 
==== Geco plasmid construction ====
Line 40: Line 39:
 
[[File:media/image2.png|401x155px]]
 
[[File:media/image2.png|401x155px]]
  
−
{|
+
{|class="table table-striped"
 
| 98℃ || 10s || \ ||  
 
| 98℃ || 10s || \ ||  
 
|-
 
|-
Line 52: Line 51:
 
Primers: AgeI-Bla-S 0.3μM & E2A-HindIII-AS 0.3μM
 
Primers: AgeI-Bla-S 0.3μM & E2A-HindIII-AS 0.3μM
  
−
{|
+
{|class="table table-striped"
 
| 98℃ || 10s || \ ||
 
| 98℃ || 10s || \ ||
 
|-
 
|-
Line 62: Line 61:
 
4. PCR product cycle purification by using [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A.® Cycle Pure Kit | '''E.Z.N.A.® Cycle Pure Kit''']].
 
4. PCR product cycle purification by using [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A.® Cycle Pure Kit | '''E.Z.N.A.® Cycle Pure Kit''']].
  
−
=== 15 ===
+
----
 +
 
 +
=== 15<sup>th</sup> ===
  
 
==== Geco plasmid construction ====
 
==== Geco plasmid construction ====
Line 90: Line 91:
 
7. Gel running and Gel extraction to get the insert and vector fragments.[[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A.® Gel Extraction Kit - Spin Protocol|'''E.Z.N.A.® Gel Extraction Kit - Spin Protocol''']]
 
7. Gel running and Gel extraction to get the insert and vector fragments.[[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A.® Gel Extraction Kit - Spin Protocol|'''E.Z.N.A.® Gel Extraction Kit - Spin Protocol''']]
  
−
=== 16 ===
+
----
 +
 
 +
=== 16<sup>th</sup> ===
  
 
==== Geco plasmid construction ====
 
==== Geco plasmid construction ====
  
−
1. Geco,Vector,Bla+2A Ligation with [[Team:SUSTech_Shenzhen/Notebook/Protocol#T4_DNA_Ligase.28M0202.29|T4 DNA Ligase]](Vector:Insert=1:3).
+
1. Geco,Vector,Bla+2A Ligation with [[Team:SUSTech_Shenzhen/Notebook/Protocol#T4 DNA Ligase|'''T4 DNA Ligase''']](Vector:Insert=1:3).
  
 
Vector (5.8 kbp): 5.5ng/μl     
 
Vector (5.8 kbp): 5.5ng/μl     
Line 106: Line 109:
 
Room temperature for 10 minutes.
 
Room temperature for 10 minutes.
  
 +
2. Mix&Go hyper-efficient competent cells [[Team:'''transformation'''|'''transformation''']].
 +
 +
:* Quickly thaw: remove "Mix&Go" hyper-efficient competent cells from -80℃ freezer  and water flow till 50% of the cells melt.
 +
:* Add DNA: DNA volume is less than 1/10 volume of competent cells. (blow and suck for mixing )
 +
:* Heat shock: heat shock at 42℃ water bath for 45s.
 +
:* Spread the plates: remove LB(Amp+) plates from 4℃refrigerator,and spread all the bacterial on the plates. Overnight culture at 37℃ incubator (12~16hours).
 +
 +
Vector+Bla 2A+Geco 3 μl + competent cells 30 μl
 +
 +
----
 +
 +
=== 17<sup>th</sup> ===
 +
 +
==== Geco plasmid construction ====
 +
 +
1. Vector+Bla 2A+Geco transformation results:
 +
 +
[[File:media/image8.png|358x439px]]
 +
 +
2. Pick single clones and overnight culture.
 +
 +
Pick 5 single clones and use 6 ml Amp<sup>+</sup> LB medium with 37℃ and 220 rpm shaker to overnight culture each clones.
 +
 +
----
 +
 +
=== 18<sup>th</sup> ===
 +
 +
==== Geco plasmid construction ====
 +
 +
1. Extraction of plasmid with [[Team:'''E.Z.N.A.® Plasmid DNA Mini Kit I Protocol'''|'''E.Z.N.A.® Plasmid DNA Mini Kit I Protocol''']].
 +
 +
[[File:media/image9.png|581x209px]]
 +
 +
2. Send 5 plasmids to sequence.
 +
 +
----
 +
 +
=== 29<sup>th</sup> ===
 +
 +
==== Piezo plasmid construction ====
 +
 +
1. Piezo backbone(PBX-123 plasmid from Prof.Huang’s lab) transformation.[[Team:'''Mix&amp;Go method.'''|'''Mix&amp;Go method.''']]
 +
 +
Piezo backbone plasmids 2μl + competent cells 20μl
 +
 +
----
 +
 +
=== 30<sup>th</sup> ===
 +
 +
==== Piezo plasmid construction ====
 +
 +
1. Piezo backbone transformation results:
 +
 +
[[File:media/image10.png|402x443px]]
 +
 +
2. Pick single clones and overnight culture.
 +
 +
Pick 3 single clones and use 6 ml Amp<sup>+</sup> LB medium with 37℃ and 220 rpm shaker to overnight culture each clones.
 +
 +
=== 31<sup>th</sup> ===
 +
 +
==== Piezo plasmid construction ====
 +
 +
1. Extraction of plasmid with [[Team:'''E.Z.N.A.® Plasmid DNA Mini Kit I Protocol'''|'''E.Z.N.A.® Plasmid DNA Mini Kit I Protocol''']].
 +
 +
[[File:media/image11.png|577x138px]]
 +
 +
2. Piezo GPA、pTRE-3G PCR.
 +
 +
Piezo: 310ng/μl GPA: 444bp pTRE-3G: 376bp
 +
 +
[[File:media/image12.png|584x232px]]
 +
 +
Program setting:
 +
 +
{|
 +
| 98℃ || 10s || \
 +
|-
 +
| 55℃ || 15s || X 35 cycles
 +
|-
 +
| 72℃ || 30s || /
 +
|}
 +
 +
3.Gel Running
 +
 +
[[File:media/image13.png|289x225px]]
 +
 +
4.PCR purification.
 +
 +
[[Team:'''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol'''|'''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol''']]
 +
 +
[[File:media/image14.png|583x107px]]
 +
 +
----
 +
 +
= 2016 =
 +
 +
== Jan. ==
 +
 +
=== 21<sup>th</sup> ===
 +
 +
==== Piezo plasmid construction ====
 +
 +
1. Piezo plasmid construction design:
 +
 +
[[File:media/image15.jpeg|552x496px]]
 +
 +
2. Piezo plasmid(original) RE digestion: 37℃ 2hours
 +
 +
[[File:media/image16.png|590x183px]]
 +
 +
3. Backbone PBX-123 plasmid RE digestion: 37℃ 2hours
 +
 +
[[File:media/image17.png|600x192px]]
 +
 +
4. Gel running and gel extraction.
 +
 +
[[File:media/image18.png|579x98px]]
 +
 +
[[Team:'''E.Z.N.A.® Gel Extraction Kit - Spin Protocol'''|'''E.Z.N.A.® Gel Extraction Kit - Spin Protocol''']]
 +
 +
5. Gibson assembly:
 +
 +
[[File:media/image19.png|573x251px]]
 +
 +
Incubate the mix for 1 hour at 50°C. ([[Team:'''Gibson Assembly® Master Mix – Assembly (E2611) Method'''|'''Gibson Assembly® Master Mix – Assembly (E2611) Method''']])
 +
 +
6. Gibson product transformation:
 +
 +
[[|'''Transformation &amp; Competent cell recovery''']
 +
 +
5μl gibson product + 50μl competent cells
 +
 +
Spread plates and overnight cultrue.
 +
 +
----
 +
 +
=== 22<<sup>th</sup> ===
 +
 +
==== Piezo plasmid construction ====
 +
 +
# Pick single colonies:
 +
#: pick 1 colony from control group, pick 5 colonies from piezo group.
 +
#: Add into 6ml Amp<sup>+</sup> LB, shake at 37℃ and 220 rpm.
 +
# Make Amp LB and agar.
 +
#: make two 500ml Amp<sup>+</sup> LB medium and one 500ml Amp<sup>+</sup> LB agar.
 +
#: pour 29 plates.
 +
# Sterilization.
 +
#: We put bunch of tips and tubes for sterilization.
 +
 +
==== Piezo plasmid construction ====
 +
 +
# Extract the plasmids from the single colonies (1 control group and 5 PIEZO group):[[File:media/image1.tiff|259x496px]]
 +
# Gel electrophoresis of the six plasmids:[[File:media/image20.png|400x229px]]
 +
 +
Sample 2 and Sample 4 have shown positive results, which should be tested further with PCR.
 +
 +
==== Materials sorting: ====
 +
 +
We sorted the material and put all of them into the lowermost layer of the -20℃ fridge.
 +
 +
[[File:media/image21.jpeg|314x176px]]
 +
Restriction enzyme and buffer ↑
 +
 +
[[File:media/image22.jpeg|317x178px]]
 +
PCR related materials ↑
 +
 +
[[File:media/image23.jpeg|277x155px]]
 +
Primer of our group ↑
 +
 +
[[File:media/image24.jpeg|281x157px]]
 +
Plasmid construction of our group ↑
 +
 +
[[File:media/image25.jpeg|281x265px]]
 +
Inner look of plasmid construction, left row is the final product. Right parts are materials from previous steps. ↑
 +
 +
[[File:media/image26.jpeg|396x222px]]
 +
Overall look ↑
 +
 +
----
 +
 +
=== 25<sup>th</sup> ===
 +
 +
==== Piezo plasmid construction ====
 +
 +
# Sterilization:
 +
#: We put a bottle of ddH2O and bunch of tips and tubes for sterilization.
 +
#PCR test for PIEZO group 2 and PIEZO group 4: [[Team:'''Premix TaqTM (RR902A)'''|'''Premix TaqTM (RR902A)''']]
 +
 +
For each system
 +
[[File:media/image27.png|433x209px]]
 +
 +
Program setting:
 +
{|
 +
| 95℃ || 5min ||  ||
 +
| 95℃ || 30s  || \ ||
 +
| 55℃ || 20s  ||  || x35 cycles
 +
| 72℃ || 40s  || / ||
 +
|}
 +
 +
3. Gel running:
 +
 +
[[File:media/image2.tiff|294x416px]]
 +
 +
The result showed that GpA had linked with backbone and piezo.
 +
 +
4. Pick up single colonies and colony PCR
 +
 +
As the result of gel electrophoresis of piezo Gibson group 2&amp;4(yesterday,2016.1.24) missed bands of 4000, we picked up 20 single colonies to test by colony PCR. (use primers of GpA and PTRE).
 +
 +
The system of colony PCR (total 20 μl): [[Team:'''Premix TaqTM (RR902A)'''|'''Premix TaqTM (RR902A)''']]
 +
 +
[[File:media/image28.png|386x220px]]
 +
 +
Program setting:
 +
{|
 +
| 95℃ || 5min ||  ||
 +
|-
 +
| 95℃ || 30s  || \ ||
 +
|-
 +
| 55℃ || 20s  ||  || x35 cycles
 +
|-
 +
| 72℃ || 40s  || / ||
 +
|}
 +
 +
Finally, we got 40 groups for PCR colonies (20 for GpA and 20 for PTRE).
 +
 +
5. Gel electrophoresis of 40 groups after PCR colonies.
 +
 +
[[File:media/image3.tiff|467x437px]]
 +
 +
6.TRPC5 &amp; TRPC6 &amp;PBX-090 [[Team:'''transformation'''|'''transformation''']].
 +
 +
We transformed these plasmids into competent cell and coated. After that, incubated at 37℃ for 16 hours.（5 plasmids onto 5 Amp plates）
 +
 +
----
 +
 +
=== 26<sup>th</sup> ===
 +
 +
==== Piezo plasmid construction ====
 +
 +
1. Pick up single colonies
 +
 +
After TRPC5, TRPC6 and PBX-090 transformation, we found that there are no colony growing on PBX-090 plate. Later we knew that PBX-090 is Kanamycin resistant. We pick 1 colony from other 4 plates. Add into 5ml Amp LB, shake at 37℃.
 +
 +
2.PCR test [[Team:'''Premix TaqTM (RR902A)''|'''Premix TaqTM (RR902A)'']]
 +
 +
For yesterday PIEZO group 2 and PIEZO group 4(GPA verified):
 +
[[File:media/image27.png|433x209px]]
 +
 +
Program setting:
 +
 +
{|
 +
| 95℃ || 5min ||  ||
 +
|-
 +
| 95℃ || 30s  || \ ||
 +
|-
 +
| 55℃ || 20s  ||  || x30 cycles
 +
|-
 +
| 72℃ || 40s  || / ||
 +
|}
 +
 +
For yesterday PIEZO colony PCR promoter(pTRE) group 9,11,15(pTRE verified):
 +
[[File:media/image27.png|433x209px]]
 +
 +
Program setting:
 +
 +
{|
 +
| 95℃ || 5min ||  ||
 +
|-
 +
| 95℃ || 30s  || \ ||
 +
|-
 +
| 55℃ || 20s  ||  || x30 cycles
 +
|-
 +
| 72℃ || 40s  || / ||
 +
|}
 +
 +
3.Gel running of PCR product
 +
[[File:media/image4.tiff|346x376px]]
 +
 +
4.Streak plate of colony PCR9&amp;11&amp;15
 +
 +
We streaked 3 Amp plates using tips.
 +
 +
5.RE Digestion of PIEZO(original plasmid), PIEZO group 2,and PIEZO group 4
 +
[[File:media/image29.png|478x208px]]PIEZO Total 20μl
 +
 +
PIEZO group 2(1) Total 20μl
 +
[[File:media/image30.png|450x196px]]
 +
 +
PIEZO group 2(2) Total 20μl
 +
[[File:media/image31.png|456x236px]]
 +
 +
PIEZO group 4(1) Total 20μl
 +
[[File:media/image32.png|458x201px]]
 +
 +
PIEZO group 4(2) Total 20μl
 +
[[File:media/image33.png|456x235px]]
 +
 +
Gel running results:
 +
[[File:media/image5.tiff|366x367px]]
 +
 +
Since the results out to be blurred, we decide to run gel again tomorrow.
 +
 +
----
 +
 +
=== 27<sup>th</sup> ===
 +
 +
==== Piezo plasmid construction ====
 +
 +
1.Plasmid purification [[Team:'''E.Z.N.A.® Plasmid DNA Mini Kit I Protocol - Spin Protocol'''|'''E.Z.N.A.® Plasmid DNA Mini Kit I Protocol - Spin Protocol''']]
 +
 +
Plasmid purification of TRPC5 and TRPC6 from the single colonies we picked yesterday
 +
 +
The concentration of the plasmids:
 +
[[File:media/image34.png|490x187px]]
 +
 +
2.Gel electrophoresis of Restriction Enzyme Digestion product:
 +
[[File:media/image6.tiff|369x336px]]
 +
 +
''Something must have been wrong!''
 +
 +
3.Pick single colonies
 +
After we strake plate of colony PCR9&amp;11&amp;15, we pick 1 colony from each plate. Add into 5ml Amp LB, shake at 37℃.
 +
 +
4. TRPC5 T5-GFP PCR [[Team:'''Q5® High-Fidelity 2X Master Mix(M0492S)'''|'''Q5® High-Fidelity 2X Master Mix(M0492S)''']]
 +
[[File:media/image35.png|455x215px]]
 +
 +
We make 2 groups of 50μL PCR solution.
 +
 +
5. PCR purification [[Team:'''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol'''|'''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol''']]
 +
 +
Accidentally make the centrifuge in step 8 30 seconds rather than 1 minute
 +
 +
Use 50μl ddH2O to elute DNA in the last process.
 +
 +
DNA concentration:
 +
 +
Group1: 21.8ng/μL
 +
 +
Group2: 31.6ng/μL
 +
 +
6. TRPC5 T5-GFP PCR(2nd) [[Team:'''Q5® High-Fidelity 2X Master Mix(M0492S)'''|'''Q5® High-Fidelity 2X Master Mix(M0492S)''']]
 +
 +
Because the DNA concentration in the last step was too low to conduct the following experiment, we did the TRPC5 T5-GFP PCR for the second time.
 +
 +
[[File:media/image36.png|459x212px]]
 +
 +
We make 5 groups of 50μL PCR solution, and run 40 cycles.
 +
 +
----
 +
 +
=== 28<sup>th</sup> ===
 +
 +
==== Piezo plasmid construction ====
 +
 +
1. Plasmid purification and maintenance breeding
 +
① Plasmid purification of colony PCR9&11&15 from the single colonies we picked yesterday
 +
 +
Use 50μL ddH2O to elute DNA in the last process.
 +
 +
[[Team:'''E.Z.N.A.® Plasmid DNA Mini Kit I Protocol - Spin Protocol'''|'''E.Z.N.A.® Plasmid DNA Mini Kit I Protocol - Spin Protocol''']]
 +
 +
The concentration of the plasmids:
 +
 +
Colony PCR9 463.6ng/μl
 +
 +
Colony PCR11 556.1ng/μl
 +
 +
Colony PCR15 474.4ng/μl
 +
 +
② Maintenance breeding
 +
 +
Mix 500μL bacterial liquid with 500μL (volume fraction:50%)glycerol, and then shore at -80℃.
 +
 +
2. PCR purification [[Team:'''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol'''|'''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol''']]
 +
 +
PCR purification of TPRC5 T5-GFP(2nd)
 +
 +
Use 80 <span id="OLE_LINK34" class="anchor"></span>μl Tris-HCl to elute DNA in the last process.
 +
 +
Finally, the concentration of DNA:
 +
 +
Group 1 55.8ng/μl
 +
 +
Group 2 68.7ng/μl
 +
 +
Group 3 69.2ng/μl
 +
 +
Group 4 71.6ng/μl
 +
 +
3. Mycoplasma detection
 +
 +
We did mycoplasma detection for the supernatant from the cell culture (step 4. Cell freezing) we collected yesterday.
 +
 +
a. PCR the supernatant by the primers of mycoplasma DNA.
 +
 +
The system of PCR (total 50μL): [[Team:'''Q5® High-Fidelity 2X Master Mix(M0492S)'''|'''Q5® High-Fidelity 2X Master Mix(M0492S)''']]
 +
 +
[[File:media/image37.png|504x213px]]
 +
 +
Program setting:
 +
 +
{|
 +
| 95℃ || 30s || ||
 +
|-
 +
| 98℃ || 20s || \ ||
 +
|-
 +
| 50℃ || 10s || || x35 cycles
 +
|-
 +
| 72℃ || 100s || / ||
 +
|-
 +
| 72℃  || 120s || ||
 +
|-
 +
| 4℃ || ∞ || ||
 +
|}
 +
 +
b. Gel electrophoresis of PCR product.
 +
 +
[[File:media/image7.tiff|264x301px]]
 +
Obviously, positive control turns out to be positive result, while negative control and the samples are negative results, so that our freezing cells are not polluted and we can store them into liquid nitrogen (big liquid nitrogen cell storage tank 3-4).
 +
 +
4.Restriction Enzyme Digestion(A)
 +
[[File:media/image38.png|547x142px]]
 +
 +
'''Digest the ends of TRPC5 for ligation.'''
 +
 +
Since we have the PBX123 with sticky ends of Age I and Bcl I, we should digest TRPC5 with Age I enzyme and Bcl I.
 +
 +
Firstly, we digest TRPC5 with Age I (activity:100%).The system (total 90μL):
 +
 +
Incubate at 37℃ for two hours.
 +
 +
Then, we digest TRPC5 with Bcl I (activity:75%).
 +
 +
We add Bcl I enzyme (1μL) into the final system of the first digestion.
 +
Incubate at 50℃ for six hours.
 +
 +
'''Digest the product of plasmid purification (step 1. today).'''
 +
 +
We digest the product of plasmid purification of pick up single colonies of streak plate of colony PCR group9&amp;11&amp;15 to test its linking.
 +
 +
The system (total 20μL):
 +
[[File:media/image39.png|447x201px]]
 +
 +
Incubate at 37℃ for two hours.
 +
 +
5. Gel electrophoresis of the digestion of plasmid purification product of colonies PCR 9&amp;11&amp;15
 +
[[File:media/image8.tiff|264x495px]]
 +
 +
As we digest the plasmid with only one enzyme, we only get linear 15k bp DNA.
 +
Obviously, group9&amp;15 are positive.
 +
 +
6. Restriction Enzyme Digestion(B) and gel electrophoresis
 +
 +
We decide to digest the product of plasmid purification of colony PCR group 9&amp;15 with Bam-HI and Bgl I to ensure they are exactly correct.
 +
 +
The system (total 20μL):
 +
 +
Bam HI-HF 0.2μL(activity:100%)
 +
 +
Bgl I 0.2μL(activity:100%)
 +
 +
DNA(~500ng/μL) 1.25μL
 +
 +
10×NEBuffer 2μL(3.1 buffer)
 +
 +
ddH2O 16.35μL
 +
 +
Incubate at 37℃ for two hours.
 +
 +
Gel electrophoresis of the product of digestion.
 +
 +
7. Restriction Enzyme Digestion purification
 +
[[Team:'''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol'''|'''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol''']]
 +
 +
Use 30μL ddH<sub>2</sub>O to elute DNA in the last process.
 +
 +
TRPC5 T5-GFP 1 72.6ng/Μl
 +
 +
TRPC5 T5-GFP 2 71.3ng/μL
 +
 +
8. Restriction Enzyme Digestion [[Team:'''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol'''|'''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol''']]
 +
 +
We digest PBX-123 with Age I to get the sticky end which can connected with TPRC5.
 +
 +
The system (total 50μL):
 +
 +
Age I-HF 2μL
 +
 +
DNA(~300ng/μL) 20μL(actually, we use PBX group 3.)
 +
 +
10×NEBuffer 5μL(CutSmart buffer)
 +
 +
ddH2O 23μL
 +
 +
Incubate at 37℃ for two hours.
 +
 +
9. Ligation (TRPC5 and PBX-123)
 +
 +
The system (total 20μL):
 +
 +
10×T4 DNA buffer 2μL
 +
 +
Vector(PBX123) 10μL(43.26ng)
 +
 +
TRPC5 1μL(55.26ng)
 +
 +
ddH<sub>2</sub>O 6μL
 +
 +
T4 DNA ligase 1μL
 +
 +
10. Transformation:
 +
 +
We transform the plasmid which we get in the step 9. Ligation into 25μL competent cell.
 +
 +
We also help Dr. Huang (our mentor) transform 3 plasmids into competent cell (each 25μL).
 +
 +
Then, we coat and incubate at 37℃for 16 hours.
 +
 +
----
 +
 +
=== 29 <sup>th</sup> ===
 +
 +
==== Piezo plasmid construction ====
 +
 +
# Restriction Enzyme Digestion(PBX-123, Age I&amp; Bcl I)
 +
 +
We digested PBX-123 with Age I to get the sticky end which can connected with TPRC5.
 +
 +
Then we use Bcl1 to digest.
 +
 +
The system (total 50μL):
 +
 +
Bcl I 2μL
 +
 +
DNA(~300ng/μL) 20μL (actually, we use PBX group 3.)
 +
 +
10×NEBuffer 5μL(CutSmart buffer)
 +
 +
ddH2O 23μL
 +
 +
Incubate at 50℃ for two hours.
 +
 +
[[File:media/image40.jpeg|179x358px]]
 +
 +
The result is strange. The brightest band is larger than 10000.
 +
 +
Still, we extract the plasmid from the brightest band. Concentration:61.8ng/μl
 +
 +
Gel running of restriction enzyme digestion (PIEZO Gibson Ligation from colony PCR group 9&amp;15, BamHI Bgl II)
 +
[[File:media/image9.tiff|270x467px]]
 +
 +
<blockquote>The undigested ones showed more bands while digested one only showed one band which is really strange.
 +
 +
We ran the gel for two times and still got the same results.
 +
 +
3.Colony PCR (5 PIEZO Gibson colony &amp;2 PIEZO Gibson control colony&amp;Negative control ddH2O, PCR for GpA&amp; PTRE)<br />
 +
Total 20μl
 +
 +
2xTaq 10μl
 +
 +
Template 5μl
 +
 +
Primer 1 1μl
 +
 +
Primer 2 1μl
 +
 +
DdH2O 3μl
 +
 +
*Primers: GpA primers/PTRE primers
 +
 +
[[File:media/image10.tiff|389x546px]]
 +
 +
From the results, GpA can still be seen in ddH2O. The result is so strange. We don’t know how to explain.
 +
 +
4.Colony PCR (12 TRPC5 Ligation colonies&amp;dd H2O)
 +
 +
Total 20μl
 +
 +
2xTaq 10μl
 +
 +
Template 5μl
 +
 +
TRPC5 Primer 1 1μl
 +
 +
TRPC5 Primer 2 1μl
 +
 +
ddH2O 3μl
 +
 +
[[File:media/image11.tiff|438x377px]]
 +
 +
The PCR results showed no correct one. We can’t see TRPC5 band.
 +
 +
*The rightmost one: Digested PBX123 backbone for TRPC5 is the gel extraction from step 1(Conc. 61.8ng/μl).The band should be around 8000bp. While the result is larger than 10000bp. This indicates that the extracted plasmid is not right.
 +
</blockquote>
 +
5. Restriction enzyme digest(PBX123 backbone for PIEZO, PIEZO, both MfeI&amp;BamHI&amp;PmeI)
 +
 +
*PBX123 backbone for PIEZO
 +
 +
Total 50μl
 +
 +
PBX123(~300ng/μl) 35 μl
 +
 +
10x Buffer 5 μl
 +
 +
DdH2O 7 μl
 +
 +
MfeI 1μl
 +
 +
BamHI 1μl
 +
 +
PmeI 1μl
 +
 +
*PIEZO
 +
 +
Total 50μl
 +
 +
PBX123(~570ng/μl) 20μl
 +
 +
10x Buffer 5 μl
 +
 +
DdH2O 22 μl
 +
 +
MfeI 1μl
 +
 +
BamHI 1μl
 +
 +
PmeI 1μl
 +
 +
6. Pick up single colonies
 +
 +
Since the results from the Colony PCR of TRPC5 ligation was not very promising, we pick up 6 colony from the plate. Add into 5ml Amp LB, shake at 37℃.
 +
 +
The signal colonies are picked for the PCR process to make sure that Colony PCR it self have nothing to do with the failure.
 +
 +
2016-1-30
 +
 +
Piezo plasmid construction
 +
 +
# Enzyme digestion of PBX123(Age I and Bcl I for TRPC5)
 +
 +
PBX123(~300ng/μL) 30μL
 +
 +
<blockquote>Age I 1μL
 +
 +
CutSmart 5μL
 +
 +
ddH<sub>2</sub>O 14μL
 +
 +
Incubate in 37℃ for a whole night.
 +
 +
Add in Bcl I at 11:00, and move to 50℃.
 +
 +
Bcl I 1μL
 +
 +
Incubate in 50℃ for a 4 hours.
 +
</blockquote>
 +
# Gel electrophoresis of PBX123(Mfe I, BamH I and Pme I for piezo), PBX123(Age I and Bcl I for TRPC5) and Piezo
 +
 +
<blockquote>[[File:media/image12.tiff|266x528px]]
 +
 +
The PBX123(MfeI BamHI PmeI for piezo) and Piezo(digested) on the other gel was cut off for gel extraction
 +
 +
The concentration of the extraction:
 +
 +
PBX-123 40.8ng/μL
 +
 +
Piezo 28.4ng/μL
 +
</blockquote>
 +
# Plasmid extraction ''E.Z.N.A.® Plasmid DNA Mini Kit I Protocol - Spin Protocol''
 +
 +
<blockquote>Plasmid extraction from the single colonies we picked up yesterday.
 +
 +
The concentration of the plasmids:
 +
 +
TRPC5 ligation 1 378.2ng/μL
 +
 +
TRPC5 ligation 2 347.8ng/μL
 +
 +
TRPC5 ligation 3 343.3ng/μL
 +
 +
TRPC5 ligation 4 441.5ng/μL
 +
 +
TRPC5 ligation 5 438.0ng/μL
 +
 +
TRPC5 ligation 6 431.0ng/μL
 +
</blockquote>
 +
# TRPC5 PCR
 +
 +
<blockquote>We add in the primer of TRPC5 and try to make TRPC5 PCR from the ligation plasmid we extracted from the single colonies.
 +
 +
We also make two control groups, positive control group from the original TRPC5 T5-GFP plasmid we got, and negative control group from ddH<sub>2</sub>O.
 +
 +
rTaq premix 5μL
 +
 +
Templet 1μL
 +
 +
Primer1 0.5μL
 +
 +
Primer2 0.5μL
 +
 +
ddH<sub>2</sub>O 3μL
 +
</blockquote>
 +
# Gel electrophoresis of the PCR products and the gel extraction products.
 +
 +
<blockquote>[[File:media/image13.tiff|365x381px]]
 +
 +
Nothing, even with the positive control group from the original TRPC5 T5-GFP plasmid we got, have shown the right result (some brightness around 3000bp).
 +
</blockquote>
 +
# Gibson assembly of Piezo and PBX123
 +
 +
''Gibson Assembly® Master Mix – Assembly (E2611)''
 +
 +
[[File:media/image41.png|528x232px]]
 +
 +
# Enzyme digestion of PBX123(Age I and Bcl I for TRPC5)(2nd)
 +
 +
<blockquote>PBX123(~300ng/μL) 30μL
 +
 +
Bcl I 1μL
 +
 +
3.1 5μL
 +
 +
ddH<sub>2</sub>O 14μL
 +
 +
Incubate in 50℃ for a 4 hours.
 +
 +
Conduct DNA extraction with Cycle-Pure Kit, use 45μL ddH<sub>2</sub>O to elute the DNA.
 +
 +
The DNA concentration was 92.5ng/μL.
 +
 +
DNA extraction 45μL
 +
 +
Age I 1μL
 +
 +
CutSmart 5μL
 +
 +
Incubate in 37℃ overnight.
 +
</blockquote>
 +
# ''Transformation''
 +
 +
<blockquote>We transform the plasmids which we get in Gibson assembly into 33μL competent cell(1 gibson system and 4 control systems).
 +
 +
We also transform PBX090 and PBX123 to get more plasmid for further use.
 +
</blockquote>
 +
2016-1-31
 +
 +
Piezo plasmid construction
 +
 +
# [[File:media/image14.tiff|251x437px]]Gel electrophoresis of digested PBX123(Age I and Bcl I for TRPC5)(2nd)
 +
# Colony PCR
 +
 +
<blockquote>Before colony PCR, we remove the plate of PBX123 from incubator to cold room.
 +
 +
We pick up 20 single colonies from the plate of Gibson group, 2 colonies from both control group 1 and 2. There are no colonies on plates of control group 3 and PBX090.
 +
 +
The system of colony PCR(use primers of poly A and pTRE):
 +
 +
Primer1 0.5μL
 +
</blockquote>
 +
Primer2 0.5μL
 +
 +
<blockquote>Bacterial liquid 5μL
 +
 +
rTaq premix 6μL
 +
 +
We use original PBX123 to substitute the Bacterial liquid in positive control group 1.
 +
 +
We use poly A or pTRE that we get from the original PBX123 by PCR process to substitute the Bacterial liquid in positive control group 2.
 +
 +
We use ddH<sub>2</sub>O to substitute the Bacterial liquid in negative control group.
 +
 +
95℃ 30s
 +
 +
98℃ 10s
 +
 +
50℃ 10s x30 cycles
 +
 +
72℃ 100s
 +
 +
72℃ 120s
 +
 +
16℃ ∞
 +
</blockquote>
 +
# Gel electrophoresis of colony PCR (step 2.)
 +
 +
<blockquote>[[File:media/image15.tiff|497x449px]]
 +
 +
[[File:media/image16.tiff|503x479px]]
 +
 +
Obviously, every Gibson group are negative.
 +
</blockquote>
 +
# Enzyme digestion of PBX133(Bcl I and Age I, Nhe I, Xba I )
 +
 +
<blockquote>We suspect the availability of our Bcl I enzyme, so we digest this new backbone with another tube of Bcl I, and set a group digested by our enzyme to test its availability.
 +
 +
The system of digestion (by Bcl I of HW) (total 100μL):
 +
 +
Template(~200ng/μL) 50μL
 +
 +
Bcl I 5μL
 +
 +
NEBuffer(3.1) 10μL
 +
 +
ddH<sub>2</sub>O 35μL
 +
 +
Incubate in 50℃ for 1 hour.
 +
 +
The system of digestion (by Bcl I of IGEM)(total 10μL):
 +
 +
Template(~200ng/μL) 2.5μL
 +
 +
Bcl I(IGEM) 0.25μL
 +
 +
NEBuffer(3.1) 1μL
 +
 +
ddH<sub>2</sub>O 6.25μL
 +
 +
Incubate in 50℃ for 3.5 hours.
 +
 +
Conduct DNA extraction with ''Cycle-Pure Kit'', use 50μL ddH<sub>2</sub>O to elute the DNA.
 +
 +
The DNA concentration was ng/μL.
 +
 +
The system of digestion (by Age I, Nhe I, Xba I )(total 50μL):
 +
 +
DNA extraction 42μL
 +
 +
Age I 1μL
 +
 +
Nhe I 1μL
 +
 +
Xba I 1μL
 +
 +
NEBuffer(CutSmart) 5μL
 +
 +
Incubate in 37℃ overnight.
 +
</blockquote>
 +
# Gel electrophoresis of PBX133 digested by Bcl I(after incubating for 1 hour) (step 4.)
 +
 +
<blockquote>[[File:media/image17.tiff|229x496px]]From the result we can ensure our enzyme is available.
 +
</blockquote>
 +
2016-2-1
 +
 +
Piezo plasmid construction
 +
 +
# Gel running of 4 enzymes digestion
 +
 +
[[File:media/image42.png|193x529px]] [[File:media/image43.png|139x528px]]
 +
 +
For verification For gel extraction
 +
 +
[[File:media/image44.png|574x410px]]It’s easy to observe small fragments which is about 100-200bp. This indicates that the PBX133 backbone was cut.
 +
 +
Digestion sites: Bcl I,Age I,Nhe I,Xba I
 +
 +
# Gel Extraction ''E.Z.N.A.® Gel Extraction Kit - Spin Protocol''
 +
 +
<blockquote>We use the rest digested product to do gel extraction of cut PBX133(After 4 enzymes digested) Concentration:39.7 ng/μl
 +
</blockquote>
 +
# ''Transformation'' of enzyme digested products
 +
 +
<blockquote>[[File:media/image45.jpeg|360x406px]]2.5μl PBX133 digested by 4 enzymes, 2.5μl PBX133 digested by BclI(iGEM), 1μl PBX133 original, 2.5μl PBX133 digested by BclI(HW) with 25μl competent cells each.
 +
</blockquote>
 +
<span id="OLE_LINK36" class="anchor"></span>2016-2-14
 +
 +
TRPC5 plasmid construction
 +
 +
[[File:media/image46.png|476x194px]]1. Enzyme digestion of TRPC5(T5-GFP and IRES-GPF)
 +
 +
<blockquote>Incubate in 37℃ for 3 hours.
 +
</blockquote>
 +
2. TRPC5 PCR(T5-GFP and IRES-GPF)
 +
 +
<blockquote>[[File:media/image47.png|476x195px]]
 +
</blockquote>
 +
40 cycles
 +
 +
3. Make petro dishes.
 +
 +
<blockquote>We make 10 LB K+ petro dishes,75 Amp+ petro dishes and 14 LB petro dishes while waiting.
 +
</blockquote>
 +
4. Gel electrophoresis of TRPC5
 +
 +
<blockquote>[[File:media/image18.tiff|269x481px]]
 +
 +
The expected brightness (~3k bp) appeared with TRPC5 T5-GFP PCR.
 +
 +
But TRPC5 PCR purification group 4, which we did with the same process as TRPC5 T5-GFP PCR. Did not have the same brightness. So we decided to do another Gel electrophoresis process tomorrow.
 +
</blockquote>
 +
# PCR purification of TRPC5 PCR products (T5-GFP and IRES-GPF)
 +
 +
''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol''
 +
 +
<blockquote>The concentration of the products (diluted with 40μL ddH<sub>2</sub>O):
 +
 +
TRPC5 T5-GFP 105.2ng/μL
 +
 +
TRPC5 IRES-GPF 38.8ng/μL
 +
</blockquote>
 +
# Enzyme digestion of TRPC5 T5-GFP PCR purification product
 +
 +
<blockquote>Since we have the expected brightness (~3k bp) appeared with TRPC5 T5-GFP PCR, we carry on with the experiment. And started the enzyme digestion. Because Bcl I only have 75% activity in CutSmart buffer. So we decided to leave it overnight.
 +
 +
[[File:media/image48.png|459x196px]]
 +
 +
Incubate in 50℃ for overnight.
 +
</blockquote>
 +
2016-2-15
 +
 +
TRPC5 plasmid construction
 +
 +
# Enzyme digestion of TRPC5(T5-GFP-Age 1)
 +
 +
<blockquote>Add 2 μL Age 1 into the system of last-night enzyme digestion.
 +
 +
Incubate in 37℃ for 2 hours.
 +
</blockquote>
 +
# Enzyme digested product purification of TRPC5
 +
 +
''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol''
 +
 +
<blockquote>The concentration of the products (diluted with 30μL ddH<sub>2</sub>O):
 +
 +
TRPC5 T5-GFP 58.8 ng/μl
 +
</blockquote>
 +
# Gel electrophoresis of used TRPC5
 +
 +
[[File:media/image19.tiff|283x461px]]
 +
 +
As we can see, the expected brightness (~3k bp) also appeared. It means that our TRPC5 PCR purification product is no problem, while the other four T5 products which were did before all have problem. So the four can’t be used, we will go deep by using the new TRPC5 PCR purification product.
 +
 +
# [[File:media/image49.png|569x173px]]Ligation of TRPC5 and PBX133 backbone ''T4 DNA Ligase(M0202)''
 +
 +
<blockquote>Gently mix and let it in room temperature for 20 minutes.
 +
 +
Heat inactive at 65℃ for 10 minutes and put it in -20℃ for<span id="OLE_LINK38" class="anchor"></span> 4 hours.
 +
</blockquote>
 +
# ''Transformation'' of TRPC5 plasmid
 +
 +
[[File:media/image50.png|596x122px]]
 +
 +
Results :
 +
 +
[[File:media/image51.jpeg|236x236px]] [[File:media/image52.jpeg|237x247px]]
 +
 +
TRPC5-PBX133 Ligation 2 TRPC5-PBX133 Ligation 1
 +
 +
[[File:media/image53.jpeg|227x227px]]
 +
 +
PBX133 backbone
 +
 +
The results are not so good. There are many kinds of passible reasons which we will go to confirm one by one tomorrow.
 +
 +
2016-2-16
 +
 +
TRPC5 plasmid construction
 +
 +
# Learn to design primer from Prof. Huang.
 +
# Make new Amp+ agar plate.
 +
 +
Spread 12μl 50mg/ml Amp+ (sodium salt) to the plate made in Feb.24
 +
 +
Put the plate to 25℃ for 3 hours
 +
 +
# Examination of experiment and propagation of 090
 +
 +
'''Amp+ New plate(2016.2.16):'''
 +
 +
[[File:media/image54.png|601x146px]]'''Amp+ Old plate(2016.2.14):'''
 +
 +
[[File:media/image55.png|588x121px]]'''Amp+ Former plate(2015):'''
 +
 +
[[File:media/image56.png|578x54px]]'''K+ plate(2016.2.14):'''
 +
 +
[[File:media/image57.png|574x77px]]'''Results:'''
 +
 +
'''Amp+ New plate(2016.2.16):'''
 +
 +
[[File:media/image58.jpeg|251x245px]][[File:media/image59.jpeg|247x244px]]
 +
 +
TRPC5-PBX133 Ligation 1 TRPC5-PBX133 Ligation 2
 +
 +
[[File:media/image60.jpeg|249x248px]] [[File:media/image61.jpeg|249x246px]]
 +
 +
PBX133 backbone 1 PBX133 backbone 2
 +
 +
[[File:media/image62.jpeg|249x254px]]
 +
 +
Control
 +
 +
'''Amp+ Old plate(2016.2.14):'''
 +
 +
[[File:media/image63.jpeg|248x244px]] [[File:media/image64.jpeg|246x246px]]
 +
 +
TRPC5-PBX133 Ligation 1 PBX133 backbone 1
 +
 +
[[File:media/image65.jpeg|252x257px]] [[File:media/image66.jpeg|271x256px]]
 +
 +
PBX133 backbone 2 Control
 +
 +
'''Amp+ Former plate(2015):'''
 +
 +
[[File:media/image67.jpeg|250x252px]]
 +
 +
TRPC5-PBX133 Ligation 1
 +
 +
'''K+ plate(2016.2.14):'''
 +
 +
[[File:media/image68.jpeg|253x254px]] [[File:media/image69.jpeg|260x256px]]
 +
 +
Control 090
 +
 +
Discussion:
 +
 +
Compare new and old plate, it comes out that some is wrong with the plate for its antibiotic function.
 +
 +
We thinks there may be two reason for this:
 +
 +
1.the antibiotics is inactived.
 +
 +
2.there is some distribution problem in the production of plate.
 +
 +
3.there is some concentration issue with the antibiotic.
 +
 +
There is also some problem with the ligation of TPRC6 and PBX133 backbone.
 +
 +
<span id="OLE_LINK37" class="anchor"></span>2016-2-17
 +
 +
TRPC5 plasmid construction
 +
 +
# To check whether Ampicillin and Kanamycin are effective
 +
 +
# Add 1 μl Ampicillin solution to each LB agar plate and spread.
 +
 +
Add 1 <span id="OLE_LINK39" class="anchor"></span>μl Kanamycin solution to each LB agar plate and spread.
 +
 +
# 2 Let them stay for 3 hours.
 +
# 3 Add 25 μl competent cell to each plate. Incubate for 16 hours in 37 ℃
 +
 +
Result：There is no any colony in each plate. So Ampicillin and Kanamycin are effective.
 +
 +
# TRPC5 primer design
 +
 +
[[File:media/image70.jpeg|398x501px]]
 +
 +
start="3" style="list-style-type: decimal;">
 +
Make Amp<sup>+</sup> and K<sup>+</sup> LB agar plates.
 +
 +
<blockquote>We made 2*500ml LB agar. Add 500μl 1000x Amp<sup>+</sup> in one and add 500 μl 1000x K<sup>+</sup> in the other. We poured 15 K<sup>+</sup> plates and 13 Amp<sup>+</sup> plates.
 +
</blockquote>
 +
2016-2-18
 +
 +
TRPC5 plasmid construction
 +
 +
style="list-style-type: decimal;">
 +
Modify the previous designed primers,based on following defects
 +
①Protection bases are too short,should be 4~6 bases.
 +
②The temperature of matching pieces is too low,should be 55~65℃,and
 +
the Tm of primer should be 75~85℃.
 +
③The number of bases between start codon and stop codon of final
 +
ligation product should be the fold of 3.
 +
Modified primers:
 +
①J23100-sfgfp-pBX123-piezo-primer
 +
primer1:5'-AGAC ACCGGT TCTAGA CTAGAGTCGCGGCCGCTTTACTTGTA- 3'
 +
AgeI XbaI Tm 62.6
 +
primer2:5'-TACG GGATCC TTA T GGCGCGCC TTGATATCGAGCTCTTGACGGCTAGC- 3' BamHI AscI Tm 60.9
 +
②J23100-sfgfp-pBX123-TRPC5-primer
 +
primer1: 5'-AGAC ACCGGT GAATTC CTAGAGTCGCGGCCGCTTTACTTGTA- 3'
 +
AgeI EcoRI Tm 62.6
 +
primer2: 5'-TACG GGATCC TTA T GCGGCCGC TTGATATCGAGCTCTTGACGGCTAGC- 3' BamHI NotI Tm 60.9
 +
Amplify PBX-123 backbone
 +
Backbone 1μL+competent cell 33μL (3 tubes)
 +
Results:All 3 culture dishes don’t grow colony.
 +
Discussion:Maybe the concentration of PBX-123 backbone is too low,so
 +
we increase the concentration.(2016.02.19)
 +
Enzyme digestion of PBX-123 backbone(previous extracted PBX-123)
 +
[[File:media/image71.png|414x154px]] 2 tubes,each 3μL
 +
Purification of PBX-123(30μL system,2 tubes)
 +
Results: ①13.7ng/μL A260/280: 1.6
 +
②20.6ng/μL A260/280: 1.4
 +
Add Klenow Fragment to create blunt ends(2 tubes)
 +
Klenow Fragment: 5units/μL
 +
 +
''DNA Polymerase I, Large (Klenow) Fragment(M0210S)''
 +
 +
Protocol(combine the NEB and Chinese protocol):
 +
 +
[[File:media/image72.png|569x172px]] ①
 +
 +
②Incubate 15min at 25℃
 +
 +
③Incubate 30min at 75℃
 +
 +
style="list-style-type: decimal;">
 +
Gel electrophoresis of 2 tubes blunt-ended PBX-123
 +
Marker: DL10000
 +
Results: Both 2 bands are near 10000bp and at the same site,which means
 +
the two bands are both blunt ends or sticky ends,we need to confirm
 +
after extracting the plasmid.
 +
(We forgot to take a picture of the gel)
 +
2016-2-19
 +
TRPC5 plasmid construction
 +
 +
style="list-style-type: decimal;">
 +
Gel cutting and extraction of PBX-123 Klenow Fragment products
 +
(30μL system)
 +
Concentration:7.6ng/μL, A260/280: 1.55
 +
[[File:media/image73.png|341x141px]]Ligation of PBX-123 blunt end ''T4 DNA Ligase(M0202)''
 +
Amplify PBX-123 backbone,transform,select single colony and shake
 +
colony(4 tubes)
 +
Results:
 +
 +
{|
 +
| '''PBX-123/ μl'''
 +
| '''Competent cell/ μl'''
 +
| '''Colonies'''
 +
|-
 +
| 0
 +
| 25
 +
| 0
 +
|-
 +
| 5
 +
| 25
 +
| 10+
 +
|-
 +
| 15
 +
| 25
 +
| 2
 +
|-
 +
| 25
 +
| 25
 +
| 1
 +
|}
 +
 +
[[File:media/image74.jpeg|333x249px]][[File:media/image75.jpeg|264x302px]] Fig.1 PBX-123 0 μl control Fig.2 PBX-123 5 μl
 +
 +
[[File:media/image76.jpeg|337x252px]][[File:media/image77.jpeg|340x255px]]
 +
 +
Fig.3 PBX-123 15 μl Fig.4 PBX-123 25 μl
 +
 +
Discussion:
 +
 +
The number of colonies decreases as the concentration of PBX-123
 +
 +
backbone increases,which is strange,so we need to do a gel running after
 +
 +
extracting the plasmid to confirm whether the PBX-123 has problem.
 +
 +
start="4" style="list-style-type: decimal;">
 +
Ligation product transform,select single colony and shake colony (1 tubes)
 +
Results: only one culture dish grows 1 colony
 +
[[File:media/image78.jpeg|326x356px]]
 +
PBX-123 Not I-cut ligation 3
 +
2016-2-20
 +
TRPC5 plasmid construction
 +
 +
# PBX123 and PBX123(NotI-cut ligation) plasmid extraction
 +
 +
''AxyPrep Plasmid Miniprep Spin Protocol''
 +
 +
Final volume: 70 ul each tube
 +
 +
[[File:media/image79.png|554x128px]]
 +
 +
# Breed preservation :
 +
 +
500ul bacterial : 500ul glycerol each tube
 +
 +
[[File:media/image80.png|546x112px]]
 +
 +
# NotI digest and transform (2 tubes)
 +
 +
[[File:media/image81.png|299x188px]]
 +
 +
Purification: 40 ul system
 +
 +
Results: ① 18.1 ng/μL A260/280: 1.64
 +
 +
Transform 3 plates (Amp+)
 +
 +
# He Yuhao repeats PBX123 NotI-cut:
 +
 +
NotI digest: 2 tubes
 +
 +
[[File:media/image81.png|328x206px]]
 +
 +
Purification: 30 ul system each
 +
 +
Results: ① 25 ng/μL A260/280: 1.70
 +
 +
② 23 ng/μL A260/280: 1.66
 +
 +
2016-2-21
 +
 +
TRPC5 plasmid construction
 +
 +
1.Select single colony
 +
 +
All 3 culture dishes grow many colonies,but we still need to do colony
 +
 +
PCR to confirm they are blunt-ended.Ling Shaohua has designed the primer
 +
 +
for colony PCR,we need to ask Pro.Huang whether it’s right.
 +
 +
So we select 10 colonies,each with 10ul Amp+ LB broth and store at cold
 +
 +
room.When the primer is verified and synthesized,we will do colony PCR
 +
 +
and extract plasmid from those colonies which are confirmed to be right.
 +
 +
[[File:media/image82.jpeg|245x258px]]
 +
 +
[[File:media/image83.jpeg|248x256px]]
 +
 +
PBX-123 Not I cut 2.20 ① PBX-123 Not I cut 2.20 ②
 +
 +
[[File:media/image84.jpeg|247x268px]]
 +
 +
PBX-123 Not I cut 2.20 ③
 +
 +
2016-2-22
 +
 +
TRPC5 plasmid construction
 +
 +
1.Enzyme double digestion of HindIII-HF，Not I-HF. 37 ℃, 3hrs
 +
 +
[[File:media/image85.png|507x166px]]
 +
 +
[[File:media/image86.png|510x170px]]
 +
 +
[[File:media/image87.png|567x436px]] Fig.1 PBX-123 plasmid pattern
 +
 +
2.Gel running, proof:
 +
 +
[[File:media/image88.png|318x606px]] This shows we have successfully delete the Not-I RE site.
 +
 +
2016-2-24
 +
 +
TRPC5 plasmid construction
 +
 +
# TRPC5 enzyme digestion
 +
 +
<blockquote>We cut the TRPC5 PCR gel extraction from day 2.16 to give it a shot.
 +
 +
Only 23μL DNA left inside the tube.
 +
 +
[[File:media/image89.png|523x162px]]
 +
</blockquote>
 +
# ''Transformation''：
 +
 +
<blockquote>We transform PBX133 PBX090 and Piezo to propagate them for further use.
 +
 +
We use the micropipette to inhale and blow the liquid inside Piezo for the plasmid sample, and add it to 33μL competent cells.
 +
 +
We add 2.5μL PBX133 and 2.5μL PBX090 to 33μL competent cells.
 +
 +
We coat and incubate at 37℃for 16 hours.
 +
</blockquote>
 +
04.13~04.24 087&amp;NFAT Plasmid Construction
 +
 +
'''Restriction Enzyme Digestion for Verification'''
 +
 +
[[File:media/image90.png|553x237px]]
 +
 +
'''Gel Extraction'''
 +
 +
[[File:media/image20.tiff|433x288px]]
 +
 +
'''Sequencing Result''':
 +
 +
Correct
 +
 +
'''04.24~05.06 TRPC5 Plasmid Construction '''
 +
 +
'''06.15~06.30 Restriction Enzyme,Ligase and Transformation Efficiency Test sfgfp PCR and Gel Extraction'''
 +
 +
[[File:media/image91.png|368x530px]]
 +
 +
'''Transformation Result'''
 +
 +
[[File:media/image92.jpeg|319x292px]][[File:media/image93.jpeg|326x311px]]
 +
 +
7.1
 +
 +
'''Efficiency Tests'''
 +
 +
Transformation efficiency (3 groups)
 +
 +
[[File:media/image94.png|422x77px]]
 +
 +
Enzyme digestion efficiency (3 groups)
 +
 +
[[File:media/image95.png|553x79px]]
 +
 +
1&gt;Prepare digestion system:
 +
 +
[[File:media/image96.png|193x175px]]
 +
 +
Incubate at 37℃,6hrs.
 +
 +
Ligation efficiency (3 groups)
 +
 +
[[File:media/image97.png|553x79px]]
 +
 +
1&gt; Prepare ligation system ''T4 DNA Ligase(M0202)''
 +
 +
[[File:media/image98.png|250x162px]]
 +
 +
Incubate at room temperature for 20mins
 +
 +
''Transformation &amp; Competent cell recovery''
 +
 +
1. Get competent cell (DH5α) from -80℃，lay on ice for 15mins till melted.
 +
 +
2. Add plasmids according to the table above, gently blow to mix well.
 +
 +
3. Incubate on ice for 30mins.
 +
 +
4. Incubate in 42℃ water bath for 90s.
 +
 +
5. Lay on ice for 5mins.
 +
 +
6. Add 300μl LB, 37℃, 220rpm for 20mins.
 +
 +
7. Add 300μl Amp+ LB, 37℃, 220rpm for 20mins.
 +
 +
8. Centrifuge at 5000rpm, 1min. Drop 400μl suspension.
 +
 +
9. Mix the left 200μl gently, spread plate.
 +
 +
'''NOTE:'''
 +
 +
# For ligation products, subpackage of competent cell may decrease the final efficiency.
 +
# During transformation, after heat shock, competent cell should be spread on preheated agar plate (37℃) to reach a higher transformation efficiency.
 +
 +
7.2
 +
 +
'''Efficiency tests results:'''
 +
 +
[[File:media/image99.png|509x337px]]
 +
 +
NOTE:
 +
 +
Too many non-target bacterial colonies(non-green).
 +
 +
Efficiency tests failed.
 +
 +
'''Non-green colony test (I)'''
 +
 +
style="list-style-type: decimal;">
 +
Pick 1 non-green colony on each plate.
 +
Mix with 20μl ddH<sub>2</sub>O
 +
Get 10μl add into 5ml Amp+ LB to incubate at 37℃, 220rpm for &lt;16hrs.
 +
Get 10μl to do colony PCR:
 +
1&gt; Primer
 +
 +
<ul>
 +
Forward -- AACGTATAAGCTTTAGGCGTGTACG
 +
Reverse -- TTGTGCACCAGTCATAGCCGAATAG
 +
2&gt; Polymerase Chain Reaction (PCR)system</ul>
 +
 +
''Q5® High-Fidelity 2X Master Mix(M0492S)''
 +
 +
[[File:media/image100.png|220x192px]]
 +
 +
3&gt; PCR setting
 +
 +
[[File:media/image101.png|424x181px]]
 +
 +
4&gt; Gel electrophoresis
 +
 +
[[File:media/image102.png|362x394px]]
 +
 +
7.3
 +
 +
'''Non-green colony test (II)'''
 +
 +
style="list-style-type: decimal;">
 +
Use E.Z.N.A.<sup>TM</sup> Plasmid Mini Kit(Omega D6942-02) to purified plasmids. According to ''spin protocol.''
 +
Test the concentration ( Eppendorf BioSpectrometer)
 +
Use another pairs of primers to do PCR
 +
Primer Forward -- CTAGAGTCGCGGCCGCTTTACTT
 +
Primer Reverse -- TCGAGCTCTTGACAGCTAGCTCA
 +
4.Double-enzyme digestion
 +
[[File:media/image103.png|297x192px]]
 +
5. Gel electrophoresis
 +
[[File:media/image21.tiff|593x238px]]
 +
7.4
 +
'''Non-green colony test (III)'''
 +
1.Enzyme digestion
 +
[[File:media/image104.png|280x151px]]
 +
2. Gel electrophoresis
 +
[[File:media/image105.png|375x276px]]
 +
 +
7.6
 +
 +
1.Enzyme digestion
 +
 +
[[File:media/image106.png|301x161px]]
 +
 +
2. Gel electrophoresis
 +
 +
[[File:media/image22.tiff|557x341px]]
 +
 +
7.7-7.10
 +
 +
'''New plasmids design:'''
 +
 +
* TRPC5-Loxp
 +
* Sfgfp-pBX123
 +
* pBX097-neoloxp
 +
 +
7.11
 +
 +
'''TRPC5-Loxp Plasmid Construction(I)'''
 +
 +
1. TRPC5-R plasmid enzyme digestion
 +
 +
[[File:media/image107.png|276x148px]]
 +
 +
start="2" style="list-style-type: decimal;">
 +
Gel electrophoresis for gel extraction
 +
[[File:media/image23.tiff|238x228px]] [[File:media/image108.png|254x235px]]
 +
NOTE: Wrong length and faint bands
 +
DraIII digestion site:
 +
[[File:media/image109.png|202x45px]]
 +
7.12
 +
 +
'''TRPC5-Loxp Plasmid Construction(II)'''
 +
 +
1.TRPC5-L and TRPC5-R PCR
 +
 +
Primer F -- TTGGCAAAGAATTCCTCGAGG
 +
 +
Primer R -- GCCGATCATGCTGATATTGAGT
 +
 +
2.Gel electrophoresis for gel extraction
 +
 +
[[File:media/image24.tiff|280x278px]]
 +
 +
3.Gel Extraction (According to ''Gel Extraction protocol'' )
 +
 +
4.TRPC5-L plasmid re-synthesis
 +
 +
7.13
 +
 +
'''pBX097-neoloxp construction(I)'''
 +
 +
style="list-style-type: decimal;">
 +
Neoloxp PCR from pBX123 plasmid
 +
[[File:media/image24.tiff|253x292px]]
 +
''Gel extraction''
 +
Test product’s concentration
 +
4.Double-enzyme digestion and pBX097 plasmid enzyme digestion
 +
[[File:media/image110.png|278x181px]]
 +
5.Gel electrophoresis
 +
 +
[[File:media/image111.png|363x359px]]
 +
 +
7.16 - 7.21
 +
 +
'''pBX097-neoloxp construction(II) '''
 +
 +
1.Ligate the pBX097 and neoloxp with ''T4 DNA ligase and Quick Ligase (NEB) ''
 +
 +
2.DNA ''transformation''
 +
 +
Result: None colony
 +
 +
'''TRPC5-Loxp Plasmid Construction(III)'''
 +
 +
style="list-style-type: decimal;">
 +
TRPC5-R PCR product double-enzyme digestion (AflII; KpnI) overnight
 +
TRPC5-L synthesis products transformation
 +
TRPC5-L plasmid purification
 +
TRPC5-L plasmid enzyme digestion (AflII; KpnI) overnight
 +
Ligation of TRPC5 left and right (T4 DNA ligase)
 +
Spread plate, incubate at 37℃ for &lt;16hrs
 +
Pick single colony, incubate in 15ml Amp+ LB for 16hrs at 37℃
 +
Separate the culture into 5ml(to prove); 9.5ml(for endofree); 0.5ml (for preservation in -80℃)
 +
Single-enzyme digestion (PvuI; BamHI) and gel electrophoresis
 +
[[File:media/image25.tiff|426x271px]]
 +
Correct
 +
 +
'''pBX123-sfGFP construction'''
 +
 +
# sfGFP PCR
 +
# Pbx123 double-enzyme digestion
 +
 +
3. Double-enzyme digestion ( AgeI; BamHI ) of sfGFP Overnight
 +
 +
4.''Gel Extraction'' and ''Cycle pure''
 +
 +
5. Ligation of sfGFP and pBX123 backbone
 +
 +
6. Spread plate incubate at 37℃, &lt;16hrs
 +
 +
7. Pick 8 colonies incubated in 5ml Amp+ LB each, at 37℃ 220rpm for &lt;16hrs
 +
 +
8. Plasmid purification
 +
 +
''E.Z.N.A.® Plasmid DNA Mini Kit I Protocol - Spin Protocol''
 +
 +
9. Double enzyme digestion for proof (AflII; EcoRI)
 +
 +
10.Gel electrophoresis
 +
 +
[[File:media/image26.tiff|589x231px]]
 +
 +
7.22-7.23
 +
 +
'''pBX097-neoloxp construction(II) '''
 +
 +
1.Ligate the pBX097 and neoloxp with ''T4 DNA ligase and Quick Ligase (NEB)''
 +
 +
2.DNA transformation
 +
 +
Result: 7 colonies
 +
 +
3. Pick colonies to 5ml Amp+ LB, incubate at 37℃, 220rpm for &lt;16hrs.
 +
 +
4. Plasmid extraction with Plasmid Mini Kit (Omega)
 +
 +
5.Single-enzyme digestion
 +
 +
[[File:media/image112.png|283x184px]]
 +
 +
Incubate at 37℃, overnight.
 +
 +
7.24-7.25
 +
 +
'''pBX097-neoloxp construction(II) '''
 +
 +
1.Gel electrophoresis
 +
 +
[[File:media/image27.tiff|610x227px]]
 +
 +
Result: pBX097-neoloxp successfully constructed.
 +
 +
7.26-7.30
 +
 +
'''TRPC5-Loxp Plasmid Construction(IV)'''
 +
 +
1.TRPC5-Loxp ''endofree plasmid purification.''
 +
 +
2.pBX097-neoloxp and TRPC5 sequencing
 +
 +
Primer for TRPC5---GCCGATCATGCTGATATTGAGT
 +
 +
Primer for pBX097-neoloxp---GGCAACGTGCTGGTTATTGTGC
 +
 +
8.1-8.2
 +
 +
'''pBX123-sfGFP Efficiency test'''
 +
 +
[[File:media/image113.png|388x104px]]
 +
 +
Repeat the experiments steps mentioned in 7.1
 +
 +
8.3-8.4
 +
 +
'''pBX123-sfGFP enzymes’ digestion sites ligation ability'''
 +
 +
[[File:media/image114.png|396x73px]][[File:media/image115.png|302x171px]]
 +
 +
1&gt; Prepare digestion system, incubate overnight
 +
 +
2&gt; ''Gel extraction'' to get different fragments
 +
 +
3&gt; Ligation of ''T4 DNA ligase/Quick ligase''
 +
 +
4&gt; Transformation
 +
 +
Results:
 +
 +
[[File:media/image116.png|320x181px]]
 +
 +
8.5
 +
 +
'''TRPC5-loxp sequencing results:'''
 +
 +
[[File:media/image117.png|232x139px]]
 +
 +
'''pBX097-neoloxp sequencing results:'''
 +
 +
[[File:media/image118.png|273x110px]]
 +
 +
8.6-8.7
 +
 +
Non-green colony PCR
 +
 +
[[File:media/image119.png|553x408px]]
 +
 +
8.9
 +
 +
'''Change NFAT-YFP to NFAT-EGFP(I)'''
 +
 +
style="list-style-type: decimal;">
 +
Double enzyme digestion (AgeI, BamHI) pBX123 to get EGFP fragment
 +
Double enzyme digestion (AgeI, BamHI) NFAT-YFP to get backbone
 +
Overnight
 +
8.10
 +
 +
'''Change NFAT-YFP to NFAT-EGFP(II)'''
 +
 +
style="list-style-type: decimal;">
 +
''Gel extraction'' for EGFP and NFAT backbone
 +
Ligation by ''T4 DNA ligase''
 +
Transformation
 +
8.11-8.13
 +
 +
'''Change NFAT-YFP to NFAT-EGFP(II)'''
 +
 +
# Pick single colony to culture in 15ml Amp+ LB for 16hrs
 +
# ''Plasmid mini kit'' to get purified plasmid
 +
# Enzyme digestion to prove
 +
# Send to sequencing
 +
 +
8.22
 +
 +
'''TRPC5 Random mutagenesis(I)'''
 +
 +
[[File:media/image120.png|355x96px]]
 +
 +
style="list-style-type: decimal;">
 +
'''Megaprimer PCR'''
 +
1&gt; Pre-experiments: T5 exonuclease digestion level according to time.
 +
a. Use PrimerStar to do PCR of TRPC5 mutation region (~640bp)
 +
b. Gel extraction to get TRPC5 mutation region
 +
c. Set a series gradients of T5 digestion time: 0, 5, 10, 20mins
 +
[[File:media/image121.png|290x160px]]
 +
d. EDTA preparation
 +
To get EDTA solution with final concentration of 11mM (Planing to add 1μl solution into
 +
50μl to stop reaction). We should get 540mM stock solution.
 +
*Weigh 1.08g EDTA powder add into 5ml ddH<sub>2</sub>O
 +
**Use magnetic stirring bar to help dissolve
 +
***Add NaOH powder to adjust solution’s PH until dissolved completely
 +
****Use 0.22μm filter to filtrate the solution
 +
*****store in -20℃
 +
Note: To keep T5 exonuclease digestion time as precise as possible, according to its
 +
protocol, we use EDTA to stop the digestion.
 +
e. T5 digestion (according to ''T5 exonuclease protocol'')
 +
[[File:media/image122.png|262x163px]]
 +
f. Take group①②③for gel extraction; ④⑤⑥for cycle pure.
 +
[[File:media/image123.jpeg|562x245px]]
 +
8.23
 +
'''Megaprimer PCR'''
 +
1&gt; Send ④⑤⑥ to sequence
 +
Primer F:ATCCGAATTCCCCTCCAAATC
 +
Primer R:TATGTTAAGTTCCCAGCCCAG
 +
2&gt; Megaprimer PCR:
 +
* Use ''Q5® High-Fidelity 2X Master Mix(M0492S)'', System 50μl, Tm=65℃
 +
** ''Cycle pure'' to get purified PCR products.
 +
*** Use DpnI to digest plasmids that come from bacteria (methylated sites)
 +
[[File:media/image124.png|318x146px]] **** Transformation of digested products.
 +
8.24
 +
Megaprimer PCR results of different digestion time and ratios of templet and primer:
 +
[[File:media/image125.jpeg|497x611px]]
 +
8.24
 +
 +
style="list-style-type: decimal;">
 +
TRPC5 mutation region PCR
 +
TPRC5 preserved bacteria plate streaking
 +
DpnI digestion time experiment: “Whether 100ng plasmid can be digested completely by 1μl DpnI in 25μl, for 1h”
 +
Result:
 +
[[File:media/image126.png|334x292px]]
 +
8.25
 +
'''Megaprimer PCR'''
 +
 +
# To find out the best annealing temperature for megaprimer. Set a series of annealing temperatures: 55, 60,65,70℃
 +
# Repeat PCR
 +
# ''Cycle pure'' to get purified PCR products.
 +
# DpnI digestion
 +
# ''Transformation''
 +
 +
8.26
 +
 +
Megaprimer PCR results of different digestion time;PCR annealing temperatures and ratios of templet and primer:
 +
 +
[[File:media/image127.jpeg|530x304px]]
 +
 +
Colony number according to different annealing temperatures and ratios of templet and primer:
 +
 +
[[File:media/image128.png|540x174px]]
 +
 +
Sequencing results of T5 exonuclease digestion level according to time:
 +
 +
[[File:media/image129.png|527x169px]]
 +
 +
style="list-style-type: decimal;">
 +
Repea''t T5 exonuclease'' digestion level according to time:
 +
Set series of time gradients: 0, 5, 7.5, 10mins
 +
a. T5 digestion (according to T5 exonuclease protocol)
 +
[[File:media/image122.png|262x163px]]
 +
b. Take each group for Gel electrophoresis
 +
[[File:media/image130.jpeg|332x257px]]
 +
c. Send each group to sequence
 +
Primer F:ATCCGAATTCCCCTCCAAATC
 +
Primer R:TATGTTAAGTTCCCAGCCCAG
 +
8.28
 +
 +
Sequencing results of T5 exonuclease digestion level according to time:
 +
 +
[[File:media/image131.png|559x244px]]
 +
 +
8.29
 +
 +
'''Culture medium Pollution proving:'''
 +
 +
Set 4 groups of experiments (use sfGFP plasmid):
 +
 +
[[File:media/image132.png|338x110px]]
 +
 +
8.30
 +
 +
Culture medium Pollution proving results:
 +
 +
style="list-style-type: lower-alpha;">
 +
Group 3 number &gt; Group 1 number ; with lots of non-green bacteria
 +
Group 4 has &gt;100 colonies of non-green bacteria
 +
Group 2 has no colony
 +
Conclusion: Culture medium has been polluted.
 +
'''Gibson assembly (pre-experiment)'''
 +
1&gt; Directly cut the mutation region by AflII and EcoRI for 8hrs
 +
2&gt; Gel extraction to get the 640bp fragment
 +
[[File:media/image133.jpeg|341x267px]]
 +
3&gt; Use ''Gibson Assembly® Master Mix'' to get whole plasmid
 +
4&gt; Transformation
 +
 +
8.31
 +
 +
1.Gibson assembly result: NONE colony
 +
 +
2.Random mutagenesis with Kit, according to ''Random mutagenesis protocol''
 +
 +
09.01
 +
 +
'''Design qPCR Primers and Send for Synthesization'''
 +
 +
Sequences:
 +
 +
1.097&amp;NeoLoxP qPCR-1st
 +
 +
[[File:media/image134.png|552x228px]]
 +
 +
start="2" style="list-style-type: decimal;">
 +
qPCR Internal Positive Control
 +
[[File:media/image135.png|553x118px]]
 +
 +
09.04
 +
 +
'''''Gibson Assembly'''''
 +
 +
Insert : vector=2 : 3(50~100ng vector)
 +
 +
[[File:media/image136.png|608x120px]]
 +
 +
'''''T5 Exonuclease Digestion'''''
 +
 +
Temperature: 50℃
 +
 +
[[File:media/image137.png|472x64px]]
 +
 +
'''''Transformation'' into Competent Cells'''
 +
 +
5μl product are transformed with 50ul competent cells.
 +
 +
'''Error-prone PCR(low frequency)'''
 +
 +
1. Information supplied with ''the GeneMorph II Random Mutagenesis Kit''
 +
 +
(Agilent Technologies,Catalog #200550):
 +
 +
[[File:media/image138.png|553x320px]]
 +
 +
start="2" style="list-style-type: decimal;">
 +
Primers sequence:
 +
Forward: ttactcaccatacagagatcgaattcc
 +
Reverse: ttttccactttgctcagctccttaag
 +
Target DNA mass: 500ng,corresponding to low frequency mutation
 +
[[File:media/image139.png|529x284px]]
 +
 +
start="4" style="list-style-type: decimal;">
 +
Procedure
 +
[[File:media/image140.png|553x226px]]
 +
The annealing temperature is set to be 57℃.
 +
 +
'''''Gel Extraction'' of ep-PCR Product'''
 +
 +
Concentration: 135ng/μl, 30μl
 +
 +
'''qPCR Primer Test'''
 +
 +
Instrument: ABI StepOne Plus qPCR
 +
 +
Kit: Power SYBR® Green PCR Master Mix and RT-PCR Reagents Kit
 +
 +
style="list-style-type: decimal;">
 +
Sample:
 +
CHO cell genomic DNA extracted from 4.5x10<sup>6</sup> cells.
 +
Concentration: 56.1ng/μl, 400μl
 +
Target:
 +
Neoloxp segment, 18sRNA, GAPDH
 +
Standard:
 +
097&amp;Neoloxp plasmid(length:6635bp)
 +
Concentration: 101.2ng/μl
 +
[[File:media/image141.png|616x156px]]
 +
4.
 +
[[File:media/image142.png|611x175px]]
 +
 +
start="5" style="list-style-type: decimal;">
 +
Procedure
 +
[[File:media/image143.png|669x161px]]
 +
 +
09.05
 +
 +
'''Transformation Result'''
 +
 +
No colony
 +
 +
Possible reason: The transformation efficiency of self-made competent cells is quite low.
 +
 +
09.06
 +
 +
'''TRPC5 PCR with ''PrimeStar'''''
 +
 +
1.Primers sequence:
 +
 +
Forward: ttactcaccatacagagatcgaattcc
 +
 +
Reverse: ttttccactttgctcagctccttaag
 +
 +
2.Total 8 tubes of PCR reaction:
 +
 +
[[File:media/image144.png|553x212px]]
 +
 +
start="3" style="list-style-type: decimal;">
 +
Procedure
 +
[[File:media/image145.png|553x156px]]
 +
'''''Gel Extraction'''''
 +
[[File:media/image146.png|711x226px]]
 +
 +
Concentration: 180ng/μl, 30μl, total 4 tubes.
 +
 +
'''''T5 Digestion'' for 3.5 minutes and ''Cycle-pure'' '''
 +
 +
Concentration: 60ng/μl, 50μl
 +
 +
'''Mega-primer PCR with ''KOD Polymerase'''''
 +
 +
style="list-style-type: decimal;">
 +
Template DNA: 0.1ng,
 +
Mega-primer:Template=10000:1
 +
 +
[[File:media/image147.png|553x260px]]
 +
 +
style="list-style-type: decimal;">
 +
Procedure:
 +
[[File:media/image148.png|553x155px]]
 +
 +
'''''Cycle-pure'' and Gel Running'''
 +
 +
Concentration: 30ng/μl, 50μl
 +
 +
[[File:media/image149.png|242x319px]]
 +
 +
No 6000bp band is appeared,it’s a problem!!
 +
 +
'''DpnI Digestion for 1 hour'''
 +
 +
'''''Transformation'''''
 +
 +
5μl product are transformed with 100ul competent cells.
 +
 +
'''qPCR Primer Test'''
 +
 +
Instrument: Bio-Rad
 +
 +
''Kit: TaKaRa-One Step SYBR PrimeScript RT-PCR Kit I''
 +
 +
1. Sample:
 +
 +
CHO cell genomic DNA extracted from 4.5x10<sup>6</sup> cells.
 +
 +
Concentration: 56.1ng/μl, 400μl
 +
 +
2. Target:
 +
 +
Neoloxp segment, 18sRNA, GAPDH
 +
 +
3. Standard:
 +
 +
097&amp;Neoloxp plasmid(length:6635bp)
 +
 +
Concentration: 101.2ng/μl
 +
 +
[[File:media/image150.png|612x155px]]
 +
 +
4.
 +
 +
[[File:media/image151.png|608x186px]]
 +
 +
Wrong: Forget to add ‘PrimeScript Enzyme Mix’ which contains ‘Taq enzyme’,thus no PCR reaction works.
 +
 +
5. Procedure
 +
 +
[[File:media/image143.png|669x161px]]
 +
 +
09.07
 +
 +
'''Transformation Result'''
 +
 +
No colony
 +
 +
Possible reason: The mega-primer PCR procedure didn’t work.
 +
 +
'''Mega-primer PCR with ''Q5'''''
 +
 +
1.Template DNA: 0.1ng,
 +
 +
Mega-primer:Template=10000:1
 +
 +
[[File:media/image152.png|553x164px]]
 +
 +
start="2" style="list-style-type: decimal;">
 +
Procedure
 +
[[File:media/image153.png|553x155px]]
 +
'''qPCR Primer Test with ''Premix'' and Gel Running'''
 +
 +
style="list-style-type: decimal;">
 +
Gel concentration: 2%(to better show the needed band)
 +
[[File:media/image154.png|551x231px]]
 +
Procedure
 +
[[File:media/image155.png|553x174px]]
 +
4. Results
 +
[[File:media/image156.png|576x295px]]
 +
[[File:media/image157.png|696x187px]]
 +
The gel running results show that primer 1~4 and primer GAPDH has been contaminated,we need to use new primer and be care of experiment operation.
 +
 +
09.08
 +
 +
'''Gel Running with 30μl mega-primer PCR product'''
 +
 +
[[File:media/image158.png|352x316px]]
 +
 +
There is a band at around 6000bp position!
 +
 +
'''DpnI Digestion for 1 hour'''
 +
 +
[[File:media/image159.png|392x174px]]
 +
 +
'''''Transformation'''''
 +
 +
10μl product are transformed with 100ul competent cells.
 +
 +
09.09
 +
 +
'''Transformation Result'''
 +
 +
Little or no colony is appeared,maybe the transformation efficiency of competent cell is still too low.
 +
 +
09.12 Pre-experiment of enzyme digestion and ligation
 +
 +
TRPC5 PCR with PrimeStar
 +
 +
style="list-style-type: decimal;">
 +
Primers sequence
 +
Forward Primer:　atccGAATTCccctccaaatc
 +
Reverse Primer:　ATGATCTCCAGTTCTCTGGA
 +
2. Total 2 tubes PCR reaction
 +
[[File:media/image160.png|405x203px]]
 +
 +
start="3" style="list-style-type: decimal;">
 +
Procedure
 +
[[File:media/image145.png|553x156px]]
 +
 +
'''''Gel Extraction'''''
 +
 +
[[File:media/image161.png|406x293px]]
 +
 +
Concentration: 44.4ng/μl, 40μl
 +
 +
'''EcoRI,SacI Restriction Enzyme Digestion'''
 +
 +
1. Insert
 +
 +
[[File:media/image162.png|294x212px]]
 +
 +
The digestion is from 00:20 to 09:00.
 +
 +
start="2" style="list-style-type: decimal;">
 +
Vector
 +
[[File:media/image163.png|300x214px]]
 +
 +
The digestion is from 21:00 to 09:00.
 +
 +
'''qPCR Primer Re-design and Send for Synthesization'''
 +
 +
Sequences:
 +
 +
097&amp;NeoLoxP qPCR-2nd
 +
 +
[[File:media/image164.png|622x225px]]
 +
 +
09.13
 +
 +
'''''Transformation'''''
 +
 +
Use the bought competent cell,with transformation efficiency of approximately 10^7.
 +
 +
'''''Gel Extraction'' of Enzyme Digested Vector'''
 +
 +
[[File:media/image165.png|360x360px]]
 +
 +
Concentration of vector: 44.8ng/μl,20μl
 +
 +
'''''Cycle-pure'' of Enzyme Digested Insert'''
 +
 +
Concentration of insert: 25.3ng/μl, 40μl
 +
 +
'''Ligation with ''T4 DNA Ligase'''''
 +
 +
[[File:media/image166.png|502x212px]]
 +
 +
The ligation is from 12:50 to 14:00.
 +
 +
'''''Transformation'''''
 +
 +
09.14
 +
 +
'''Transformation Result'''
 +
 +
[[File:media/image167.png|553x388px]]
 +
 +
[[File:media/image168.png|516x504px]]
 +
 +
[[File:media/image169.png|518x177px]]
 +
 +
'''Competent Cell Efficiency'''
 +
 +
1. Formula: Colonies on plate / ng of DNA plated x 1000 ng/μg
 +
 +
2. Calculation:　237 / 0.02 x 1000=1.185x10<sup>7</sup> cfu/μg
 +
 +
3. Actual meaning: 20pg,5640bp→3.457x10<sup>6</sup> copies
 +
 +
3.457x10<sup>6</sup> / 237=14586,which means 1 of 14586 vectors would actually grow on the plate.
 +
 +
'''Ligation Efficiency'''
 +
 +
1. 62ng,4906bp→1.232x10<sup>10</sup> copies
 +
 +
2. Efficiency=
 +
 +
'''Mutation Library'''
 +
 +
1.Q5: 2.782x10<sup>6</sup>
 +
 +
2.Gibson: 5.54x10<sup>5</sup>
 +
 +
3. Ligation:　2.102x10<sup>7</sup>
 +
 +
'''Repeat the pre-experiment on 09.12'''
 +
 +
Use enzyme digestion and ligation method to construct mutation library,except that using error-prone PCR,and the target DNA is 500ng.
 +
 +
[[File:media/image171.png|461x331px]]
 +
 +
[[File:media/image172.png|334x302px]]
 +
 +
09.15
 +
 +
'''qPCR Primer Test with Premix and Gel Running'''
 +
 +
1. Procedure is the same with the experiment on 09.07
 +
 +
2. Results:
 +
 +
[[File:media/image173.png|755x188px]]
 +
 +
start="2" style="list-style-type: decimal;">
 +
Conclusion:
 +
I. Primer 1~4 are not good enough,cause they all can match with CHO cell’s gDNA and have PCR products.
 +
II. Primer 2~4 are contaminated.
 +
III. Primer GAPDH has unspecific PCR product,so it can’t be used.
 +
Primer 18sRNA can be used.
 +
09.18
 +
'''''Transformation'''''
 +
 +
10μl positive ligation product are transformed with 125ul competent cells.For control group,5ul ligation product are transformed with 50ul competent cells.
 +
 +
'''qPCR Primer Test with Premix and Gel Running'''
 +
 +
1. We set 2 annealing temperature,which are 65℃ and 70℃ respectively.
 +
 +
2. Results:
 +
 +
[[File:media/image174.png|865x276px]]3. Conclusion:
 +
 +
I. Primer 1~4 are all not contaminated and have specific PCR band with annealing temperature of 65℃,while they don’t have PCR product band with annealing temperature of 70℃.
 +
 +
II. Raising annealing temperature can reduce unspecific amplification,while it can also decrease the PCR efficiency and cause Ct increasement.Also we need to verify whether the product band is what we need.
 +
 +
09.19
 +
 +
'''Transformation Result'''
 +
 +
[[File:media/image175.png|330x57px]]
 +
 +
1. Mutation library(10ul ligation product)=10688
 +
 +
2. Ligation efficiency=
 +
 +
'''Pick 20 Single Colony for sequencing'''
 +
 +
Sequencing Result:
 +
 +
7 out of 20 plasmids have mutation(s) among specific region,in which one has 15 base mutations,one has 2 base mutations,and the rest five have 1 base mutation.
 +
 +
'''Scrape the Colonies for ''Endo-free Plasmid Extraction'' '''
 +
 +
The scraped colonies are cultured for around 9 hours till the OD achieves 2.879,with 150ml Amp.
 +
 +
Concentration: 55ng/μl, 1.75ml
 +
 +
09.20
 +
 +
'''qPCR Primer Test with Premix and Gel Running'''
 +
 +
1. We set 3 annealing temperature,which are 61℃,62℃ and 63℃ respectively.
 +
 +
2. Results:
 +
 +
[[File:media/image28.tiff|621x618px]]
 +
 +
09.21
 +
 +
CHO cell ''Genomic DNA Extraction''
 +
 +
style="list-style-type: decimal;">
 +
Positive: GECO+NFAT+Neoloxp
 +
①d1-A10 ②d2-B5 ③d2-B9 ④d1-D3 ⑤d2-E9
 +
⑥d1-F5 ⑦d1-F11 ⑧d1-A9 ⑨d1-B3 ⑩d2-C1
 +
Control: GECO+NFAT
 +
①C4 ②E6 ③F8 ④H10
 +
 +
09.22
 +
 +
'''qPCR Primer Test'''
 +
 +
Instrument: ABI StepOne Plus qPCR
 +
 +
Kit: TaKaRa-One Step SYBR PrimeScript RT-PCR Kit II
 +
 +
1. Sample:
 +
 +
CHO cell genomic DNA
 +
 +
Positive: transfected with GECO+NFAT+Neoloxp
 +
 +
Negative Control: transfected with GECO+NFAT
 +
 +
Wild Type Control: CHO cell genomic DNA
 +
 +
2. Target:
 +
 +
Neoloxp segment, 18sRNA
 +
 +
3. Standard:
 +
 +
097&amp;Neoloxp plasmid(length:6635bp)
 +
 +
Concentration: 101.2ng/μl
 +
 +
[[File:media/image177.png|612x149px]]
 +
 +
4.
 +
 +
[[File:media/image151.png|608x186px]]
 +
 +
5. Procedure
 +
 +
[[File:media/image178.png|671x158px]]
 +
 +
start="6" style="list-style-type: decimal;">
 +
Results
 +
[[File:media/image179.png|314x157px]]
 +
Conclusion
 +
 +
I.Can’t use ‘TaKaRa-One Step SYBR PrimeScript RT-PCR Kit II’,cause our sample is DNA.
 +
 +
II.We forgot to add ‘PrimeScript Enzyme Mix’ at the beginning,which may cause inaccurate results.
 +
 +
III.We forgot to change pipette tips during the dilution,which may bring huge deviation.
 +
 +
IV.Two-step PCR has a low amplification efficiency in our experiment.To increase the efficiency,we need to use three-step PCR.
 +
 +
09.23
 +
 +
'''qPCR Primer Test'''
 +
 +
Instrument: ABI StepOne Plus qPCR
 +
 +
Kit: TaKaRa-SYBR Premix Ex Taq II(Tli RNaseH Plus)
 +
 +
1. Sample,Target and Standard are the same with the experiment yesterday.
 +
 +
2.
 +
 +
[[File:media/image180.png|442x268px]]
 +
 +
start="3" style="list-style-type: decimal;">
 +
Procedure
 +
[[File:media/image181.png|650x146px]]
 +
4. Results
 +
[[File:media/image182.png|332x143px]]
 +
[[File:media/image183.png|471x117px]]
 +
5. Conclusion
 +
 +
Primer 3,4 are similarly efficient,combining with previous experiment result,we choose Primer 3 in the later experiment.
 +
 +
09.24
 +
 +
'''Repeat the mutation experiment on 09.14'''
 +
 +
1. The targeted mutation segments are 1ng,10ng,100ng respectively.
 +
 +
2. During the first PCR procedure,the annealing temperature is set to be 52℃,which is quite low,so it didn’t work.Then we change it to 57℃.
 +
 +
3. Procedure
 +
 +
[[File:media/image184.png|553x172px]]
 +
 +
'''''Gel Extraction'' of PCR Product(as Insert)'''
 +
 +
[[File:media/image185.png|553x55px]]
 +
 +
Each with volume of 30μl.
 +
 +
'''EcoRI,SacI Restriction Enzyme Digestion for 9 hours'''
 +
 +
'''''Cycle-pure'''''
 +
 +
[[File:media/image186.png|553x56px]]
 +
 +
'''qPCR Primer Test with Premix and Gel Running'''
 +
 +
Annealing temperature: 62℃
 +
 +
[[File:media/image187.png|543x192px]]
 +
 +
Conclusion:
 +
 +
I.We can directly see the band’s brightness differences from the gel running result,which may indicate their plasmid copy number differences.Still,we need to do quantitative PCR to get more precise results.
 +
 +
II.It’s strange as well as unreasonable that band appears in wild-type control PCR result,which may indicate that it has been contaminated.
 +
 +
'''qPCR: 097-gDNA with Primer3'''
 +
 +
Instrument: ABI StepOne Plus qPCR
 +
 +
''Kit: TaKaRa-SYBR Premix Ex Taq II(Tli RNaseH Plus)''
 +
 +
style="list-style-type: decimal;">
 +
Sample: Positive ①②③⑤⑦⑧⑩
 +
Target: Neoloxp
 +
Standard: 097&amp;Neoloxp plasmid-③
 +
2. Reagent and Procedure are the same with the experiment on 09.23.
 +
3. Results
 +
[[File:media/image188.png|470x57px]]
 +
[[File:media/image189.png|259x107px]]
 +
[[File:media/image190.png|312x220px]]
 +
4. Conclusion
 +
 +
Wild type control(new) may be contaminated.
 +
 +
09.25
 +
 +
We find that the synthesized TRPC5 has a problem,which may cause replacement during protein translation,so we need to re-construct TRPC5 plasmid.
 +
 +
'''Primer Synthesization(send to Invitrogen)'''
 +
 +
Sequences
 +
 +
Forward Primer: atccGAATTCccctccaaatc(we already have,don’t need to synthesize)
 +
 +
Reverse Primer: tgc tctaga gtg gcccagctgtactacaag
 +
 +
09.26
 +
 +
'''qPCR Primer Verification with Premix and Sequencing'''
 +
 +
Sequencing Results:
 +
 +
The PCR results are what we need,and the wild-type genomic DNA which were recently extracted are indeed contaminated.
 +
 +
09.27 Re-construct TRPC5 Plasmid
 +
 +
'''TRPC5 PCR with modify-primer'''
 +
 +
Same procedure as before
 +
 +
'''''Gel Extraction '''''
 +
 +
[[File:media/image191.jpeg|181x354px]]
 +
 +
'''XbaI,SacI Restriction Enzyme Digestion for Vector and Insert'''
 +
 +
09.28
 +
 +
'''''Gel Extraction'' for Vector'''
 +
 +
'''''Cycle-pure'' for Insert'''
 +
 +
'''''T4 DNA Ligation'' for 20min'''
 +
 +
'''''Transformation '''''
 +
 +
After culture for 10 hours:
 +
 +
[[File:media/image192.jpeg|584x279px]]
 +
 +
'''Pick 8 Single Colony and Culture for Sequencing'''
 +
 +
Sequencing Result:
 +
 +
All correct.
 +
 +
'''Culture Colonies for ''Endo-free Plasmid Extraction'''''
 +
 +
'''CHO Cell ''Genomic DNA Extraction'''''
 +
 +
Positive: GECO+NFAT+Neoloxp
 +
 +
(11)d1-C1 (12)d1-C8 (13)d1-D12 (14)d1-E3 (15)d1-E4
 +
 +
(16)d1-F3 (17)d1-F6 (18)d1-F9 (19)d2-C3 (20)d2-C8
 +
 +
(21)d2-D5
 +
 +
09.29
 +
 +
'''PvuI,NcoI Restriction Enzyme Digestion for Verification'''
 +
 +
[[File:media/image29.tiff|669x264px]]
 +
 +
Verification result: All correct.
 +
 +
10.01 Construct Mutation Library
 +
 +
Vector: TRPC5 digested with EcoRI,SacI,AflII
 +
 +
Insert: ep-PCR segments,with low&amp;medium&amp;high mutation frequency.
 +
 +
'''''Gel Extraction'' of Enzyme-digested Vector'''
 +
 +
[[File:media/image193.png|516x413px]]
 +
 +
'''Ligation for 1 hour'''
 +
 +
'''''Transformation'''''
 +
 +
5μl ligation product are transformed with 100ul competent cells.
 +
 +
'''qPCR: 097-gDNA with Primer3'''
 +
 +
Instrument: ABI StepOne Plus qPCR
 +
 +
'''''Kit: TaKaRa-SYBR Premix Ex Taq II(Tli RNaseH Plus)'''''
 +
 +
1. Sample: Positive (3),(11)~(21)
 +
 +
Negative: wild type cho cell gDNA
 +
 +
Target: Neoloxp
 +
 +
Standard: 097&amp;Neoloxp plasmid（ Endofree-① ），289ng/μl
 +
 +
The first and last dilution point are added with 10ng wild-type gDNA,to see its influence on standard curve.
 +
 +
2. Reagent and Procedure are the same with the experiment on 09.23,except that the annealing temperature is set to be 64℃.
 +
 +
3. Results
 +
 +
[[File:media/image194.png|462x61px]]
 +
 +
[[File:media/image195.png|260x79px]]
 +
 +
4. Conclusion
 +
 +
I. The plasmid concentration differs each time,we need to standardize the method for concentration measurement.
 +
 +
II. The primer is not good enough,which may cause inaccurate standard curve and copy number result.
 +
 +
10.02
 +
 +
'''Scrape the Plate for ''Endo-free Plasmid Extraction'''''
 +
 +
[[File:media/image196.jpeg|323x323px]]
 +
 +
[[File:media/image197.jpeg|264x538px]] [[File:media/image198.jpeg|270x540px]]
 +
 +
[[File:media/image199.jpeg|270x524px]] [[File:media/image200.jpeg|267x525px]]
 +
 +
[[File:media/image201.png|322x63px]]
 +
 +
[[File:media/image202.png|620x52px]]
 +
 +
Each with volume of 100μl.
 +
 +
'''CHO ''Cell Genomic DNA Extraction'''''
 +
 +
Positive: GECO+NFAT+Neoloxp
  
 +
start="22" style="list-style-type: decimal;">
 +
d2-C6 (23)d2-A5 (24)d2-A8
  
 +
start="25" style="list-style-type: decimal;">
 +
d2-A9 (26)d1-D10
 +
Wild type: CHO cell’s gDNA
 +
All the plasmids’ concentrations are re-measured using NanoDrop.
 +
10.03
  
 +
'''qPCR: 097-gDNA with Primer3'''
  
 +
Instrument: ABI StepOne Plus qPCR
  
 +
Kit: TaKaRa-SYBR Premix Ex Taq II(Tli RNaseH Plus)
  
 +
1. Sample: Positive (3),(22)~(26)
  
 +
Negative: wild type cho cell gDNA(newly extracted)
  
 +
Target: Neoloxp
  
 +
Standard: 097&amp;Neoloxp plasmid（ Endofree-① , 307.8ng/μl
  
 +
All the dilution points are added with 10ng wild-type gDNA.
  
 +
2. Reagent and Procedure are the same with the experiment on 09.23,except that the annealing temperature is set to be 64℃.
  
 +
3. Results
  
 +
[[File:media/image203.png|458x61px]]
  
 +
[[File:media/image204.png|210x84px]]
  
 +
4. Conclusion
  
 +
I. The standard curve efficiency is 140%,it may result from the adding of wild type gDNA in the preparation of standard point.
  
 +
II. The Ct of wild type gDNA is 26,which indicates that it has been contaminated.So the copy number results are not precise,we can only compare their differences.
  
  

Revision as of 16:22, 15 October 2016

Team SUSTC-Shenzhen

Molecular Experiment

Notebook

2015

Dec.

13th

Geco plasmid construction

1. Polymerase Chain Reaction (PCR)

Use PBX-084 TRE-mCherry-2A-Bla plasmid as template to get blasticidin(Bla) resistance gene.

Primers: Age-Bla-S & Bla-E2A-AS

(without purification), 20μl, 30 cycles

416x184px

2. PCR

Use PBX-084 TRE-mCherry-2A-Bla plasmid as template to get 2A sequence.

Primers: E2A-S & E2A-Hind III-AS

(without purification), 20μl, 30 cycles

416x184px

3. PCR

Step 1: run 10 cycles without primer to let Bla and 2A link together.

401x155px

98℃ 10s \
55℃ 5s x10 cycles
72℃ 30s /

Step 2：add primers to run 30 cycles.

Primers: AgeI-Bla-S 0.3μM & E2A-HindIII-AS 0.3μM

98℃ 10s \
55℃ 5s x30 cycles
72℃ 30s /

4. PCR product cycle purification by using E.Z.N.A.® Cycle Pure Kit.

15th

Geco plasmid construction

1. Digest the PCR purification product with AgeI and HindIII restriction endonuclease(RE).(37 ℃ 2 hours)

636x164px

2. Digest the Geco plasmid with BglII restriction endonuclease. (50℃ 3 hours)

632x146px3.Cycle pure the RE digestion product with the kit “xxxxxx”.

3. Cycle pure the RE digestion product with the kit “xxxxxx”.

4. Digest the purification product with HindIII restriction endonuclease. (37 ℃ 3 hours)

633x145px

5. Digest the vector plasmid with AgeI restriction endonuclease. (37 ℃ 3 hours)

631x144px

6.Add 1.5 μl BclII restriction endonuclease. (50 ℃ 3 hours)

Note: BclI and BglII have the same sticky end.

7. Gel running and Gel extraction to get the insert and vector fragments.E.Z.N.A.® Gel Extraction Kit - Spin Protocol

16th

Geco plasmid construction

1. Geco,Vector,Bla+2A Ligation with T4 DNA Ligase(Vector:Insert=1:3).

Vector (5.8 kbp): 5.5ng/μl

Bla+2A (0.45kbp): 16.8ng/μl

Geco (1.25kbp): 5.6ng/μl

578x236px

Room temperature for 10 minutes.

2. Mix&Go hyper-efficient competent cells transformation.

  • Quickly thaw: remove "Mix&Go" hyper-efficient competent cells from -80℃ freezer and water flow till 50% of the cells melt.
  • Add DNA: DNA volume is less than 1/10 volume of competent cells. (blow and suck for mixing )
  • Heat shock: heat shock at 42℃ water bath for 45s.
  • Spread the plates: remove LB(Amp+) plates from 4℃refrigerator,and spread all the bacterial on the plates. Overnight culture at 37℃ incubator (12~16hours).

Vector+Bla 2A+Geco 3 μl + competent cells 30 μl

17th

Geco plasmid construction

1. Vector+Bla 2A+Geco transformation results:

358x439px

2. Pick single clones and overnight culture.

Pick 5 single clones and use 6 ml Amp+ LB medium with 37℃ and 220 rpm shaker to overnight culture each clones.

18th

Geco plasmid construction

1. Extraction of plasmid with E.Z.N.A.® Plasmid DNA Mini Kit I Protocol.

581x209px

2. Send 5 plasmids to sequence.

29th

Piezo plasmid construction

1. Piezo backbone(PBX-123 plasmid from Prof.Huang’s lab) transformation.Mix&Go method.

Piezo backbone plasmids 2μl + competent cells 20μl

30th

Piezo plasmid construction

1. Piezo backbone transformation results:

402x443px

2. Pick single clones and overnight culture.

Pick 3 single clones and use 6 ml Amp+ LB medium with 37℃ and 220 rpm shaker to overnight culture each clones.

31th

Piezo plasmid construction

1. Extraction of plasmid with E.Z.N.A.® Plasmid DNA Mini Kit I Protocol.

577x138px

2. Piezo GPA、pTRE-3G PCR.

Piezo: 310ng/μl GPA: 444bp pTRE-3G: 376bp

584x232px

Program setting:

98℃ 10s \
55℃ 15s X 35 cycles
72℃ 30s /

3.Gel Running

289x225px

4.PCR purification.

E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol

583x107px

2016

Jan.

21th

Piezo plasmid construction

1. Piezo plasmid construction design:

552x496px

2. Piezo plasmid(original) RE digestion: 37℃ 2hours

590x183px

3. Backbone PBX-123 plasmid RE digestion: 37℃ 2hours

600x192px

4. Gel running and gel extraction.

579x98px

E.Z.N.A.® Gel Extraction Kit - Spin Protocol

5. Gibson assembly:

573x251px

Incubate the mix for 1 hour at 50°C. (Gibson Assembly® Master Mix – Assembly (E2611) Method)

6. Gibson product transformation:

[[|Transformation & Competent cell recovery]

5μl gibson product + 50μl competent cells

Spread plates and overnight cultrue.

22<th

Piezo plasmid construction

  1. Pick single colonies:
    pick 1 colony from control group, pick 5 colonies from piezo group.
    Add into 6ml Amp+ LB, shake at 37℃ and 220 rpm.
  2. Make Amp LB and agar.
    make two 500ml Amp+ LB medium and one 500ml Amp+ LB agar.
    pour 29 plates.
  3. Sterilization.
    We put bunch of tips and tubes for sterilization.

Piezo plasmid construction

  1. Extract the plasmids from the single colonies (1 control group and 5 PIEZO group):259x496px
  2. Gel electrophoresis of the six plasmids:400x229px

Sample 2 and Sample 4 have shown positive results, which should be tested further with PCR.

Materials sorting:

We sorted the material and put all of them into the lowermost layer of the -20℃ fridge.

314x176px Restriction enzyme and buffer ↑

317x178px PCR related materials ↑

277x155px Primer of our group ↑

281x157px Plasmid construction of our group ↑

281x265px Inner look of plasmid construction, left row is the final product. Right parts are materials from previous steps. ↑

396x222px Overall look ↑

25th

Piezo plasmid construction

  1. Sterilization:
    We put a bottle of ddH2O and bunch of tips and tubes for sterilization.
  2. PCR test for PIEZO group 2 and PIEZO group 4: Premix TaqTM (RR902A)

For each system 433x209px

Program setting:

95℃ 5min 95℃ 30s \ 55℃ 20s x35 cycles 72℃ 40s /

3. Gel running:

294x416px

The result showed that GpA had linked with backbone and piezo.

4. Pick up single colonies and colony PCR

As the result of gel electrophoresis of piezo Gibson group 2&4(yesterday,2016.1.24) missed bands of 4000, we picked up 20 single colonies to test by colony PCR. (use primers of GpA and PTRE).

The system of colony PCR (total 20 μl): Premix TaqTM (RR902A)

386x220px

Program setting:

95℃ 5min
95℃ 30s \
55℃ 20s x35 cycles
72℃ 40s /

Finally, we got 40 groups for PCR colonies (20 for GpA and 20 for PTRE).

5. Gel electrophoresis of 40 groups after PCR colonies.

467x437px

6.TRPC5 & TRPC6 &PBX-090 transformation.

We transformed these plasmids into competent cell and coated. After that, incubated at 37℃ for 16 hours.（5 plasmids onto 5 Amp plates）

26th

Piezo plasmid construction

1. Pick up single colonies

After TRPC5, TRPC6 and PBX-090 transformation, we found that there are no colony growing on PBX-090 plate. Later we knew that PBX-090 is Kanamycin resistant. We pick 1 colony from other 4 plates. Add into 5ml Amp LB, shake at 37℃.

2.PCR test 'Premix TaqTM (RR902A)

For yesterday PIEZO group 2 and PIEZO group 4(GPA verified): 433x209px

Program setting:

95℃ 5min
95℃ 30s \
55℃ 20s x30 cycles
72℃ 40s /

For yesterday PIEZO colony PCR promoter(pTRE) group 9,11,15(pTRE verified): 433x209px

Program setting:

95℃ 5min
95℃ 30s \
55℃ 20s x30 cycles
72℃ 40s /

3.Gel running of PCR product 346x376px

4.Streak plate of colony PCR9&11&15

We streaked 3 Amp plates using tips.

5.RE Digestion of PIEZO(original plasmid), PIEZO group 2,and PIEZO group 4 478x208pxPIEZO Total 20μl

PIEZO group 2(1) Total 20μl 450x196px

PIEZO group 2(2) Total 20μl 456x236px

PIEZO group 4(1) Total 20μl 458x201px

PIEZO group 4(2) Total 20μl 456x235px

Gel running results: 366x367px

Since the results out to be blurred, we decide to run gel again tomorrow.

27th

Piezo plasmid construction

1.Plasmid purification E.Z.N.A.® Plasmid DNA Mini Kit I Protocol - Spin Protocol

Plasmid purification of TRPC5 and TRPC6 from the single colonies we picked yesterday

The concentration of the plasmids: 490x187px

2.Gel electrophoresis of Restriction Enzyme Digestion product: 369x336px

Something must have been wrong!

3.Pick single colonies After we strake plate of colony PCR9&11&15, we pick 1 colony from each plate. Add into 5ml Amp LB, shake at 37℃.

4. TRPC5 T5-GFP PCR Q5® High-Fidelity 2X Master Mix(M0492S) 455x215px

We make 2 groups of 50μL PCR solution.

5. PCR purification E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol

Accidentally make the centrifuge in step 8 30 seconds rather than 1 minute

Use 50μl ddH2O to elute DNA in the last process.

DNA concentration:

Group1: 21.8ng/μL

Group2: 31.6ng/μL

6. TRPC5 T5-GFP PCR(2nd) Q5® High-Fidelity 2X Master Mix(M0492S)

Because the DNA concentration in the last step was too low to conduct the following experiment, we did the TRPC5 T5-GFP PCR for the second time.

459x212px

We make 5 groups of 50μL PCR solution, and run 40 cycles.

28th

Piezo plasmid construction

1. Plasmid purification and maintenance breeding ① Plasmid purification of colony PCR9&11&15 from the single colonies we picked yesterday

Use 50μL ddH2O to elute DNA in the last process.

E.Z.N.A.® Plasmid DNA Mini Kit I Protocol - Spin Protocol

The concentration of the plasmids:

Colony PCR9 463.6ng/μl

Colony PCR11 556.1ng/μl

Colony PCR15 474.4ng/μl

② Maintenance breeding

Mix 500μL bacterial liquid with 500μL (volume fraction:50%)glycerol, and then shore at -80℃.

2. PCR purification E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol

PCR purification of TPRC5 T5-GFP(2nd)

Use 80 μl Tris-HCl to elute DNA in the last process.

Finally, the concentration of DNA:

Group 1 55.8ng/μl

Group 2 68.7ng/μl

Group 3 69.2ng/μl

Group 4 71.6ng/μl

3. Mycoplasma detection

We did mycoplasma detection for the supernatant from the cell culture (step 4. Cell freezing) we collected yesterday.

a. PCR the supernatant by the primers of mycoplasma DNA.

The system of PCR (total 50μL): Q5® High-Fidelity 2X Master Mix(M0492S)

504x213px

Program setting:

95℃ 30s
98℃ 20s \
50℃ 10s x35 cycles
72℃ 100s /
72℃ 120s
4℃ ∞

b. Gel electrophoresis of PCR product.

264x301px Obviously, positive control turns out to be positive result, while negative control and the samples are negative results, so that our freezing cells are not polluted and we can store them into liquid nitrogen (big liquid nitrogen cell storage tank 3-4).

4.Restriction Enzyme Digestion(A) 547x142px

Digest the ends of TRPC5 for ligation.

Since we have the PBX123 with sticky ends of Age I and Bcl I, we should digest TRPC5 with Age I enzyme and Bcl I.

Firstly, we digest TRPC5 with Age I (activity:100%).The system (total 90μL):

Incubate at 37℃ for two hours.

Then, we digest TRPC5 with Bcl I (activity:75%).

We add Bcl I enzyme (1μL) into the final system of the first digestion. Incubate at 50℃ for six hours.

Digest the product of plasmid purification (step 1. today).

We digest the product of plasmid purification of pick up single colonies of streak plate of colony PCR group9&11&15 to test its linking.

The system (total 20μL): 447x201px

Incubate at 37℃ for two hours.

5. Gel electrophoresis of the digestion of plasmid purification product of colonies PCR 9&11&15 264x495px

As we digest the plasmid with only one enzyme, we only get linear 15k bp DNA. Obviously, group9&15 are positive.

6. Restriction Enzyme Digestion(B) and gel electrophoresis

We decide to digest the product of plasmid purification of colony PCR group 9&15 with Bam-HI and Bgl I to ensure they are exactly correct.

The system (total 20μL):

Bam HI-HF 0.2μL(activity:100%)

Bgl I 0.2μL(activity:100%)

DNA(~500ng/μL) 1.25μL

10×NEBuffer 2μL(3.1 buffer)

ddH2O 16.35μL

Incubate at 37℃ for two hours.

Gel electrophoresis of the product of digestion.

7. Restriction Enzyme Digestion purification E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol

Use 30μL ddH2O to elute DNA in the last process.

TRPC5 T5-GFP 1 72.6ng/Μl

TRPC5 T5-GFP 2 71.3ng/μL

8. Restriction Enzyme Digestion E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol

We digest PBX-123 with Age I to get the sticky end which can connected with TPRC5.

The system (total 50μL):

Age I-HF 2μL

DNA(~300ng/μL) 20μL(actually, we use PBX group 3.)

10×NEBuffer 5μL(CutSmart buffer)

ddH2O 23μL

Incubate at 37℃ for two hours.

9. Ligation (TRPC5 and PBX-123)

The system (total 20μL):

10×T4 DNA buffer 2μL

Vector(PBX123) 10μL(43.26ng)

TRPC5 1μL(55.26ng)

ddH2O 6μL

T4 DNA ligase 1μL

10. Transformation:

We transform the plasmid which we get in the step 9. Ligation into 25μL competent cell.

We also help Dr. Huang (our mentor) transform 3 plasmids into competent cell (each 25μL).

Then, we coat and incubate at 37℃for 16 hours.

29 th

Piezo plasmid construction

  1. Restriction Enzyme Digestion(PBX-123, Age I& Bcl I)

We digested PBX-123 with Age I to get the sticky end which can connected with TPRC5.

Then we use Bcl1 to digest.

The system (total 50μL):

Bcl I 2μL

DNA(~300ng/μL) 20μL (actually, we use PBX group 3.)

10×NEBuffer 5μL(CutSmart buffer)

ddH2O 23μL

Incubate at 50℃ for two hours.

179x358px

The result is strange. The brightest band is larger than 10000.

Still, we extract the plasmid from the brightest band. Concentration:61.8ng/μl

Gel running of restriction enzyme digestion (PIEZO Gibson Ligation from colony PCR group 9&15, BamHI Bgl II) 270x467px

The undigested ones showed more bands while digested one only showed one band which is really strange.

We ran the gel for two times and still got the same results.

3.Colony PCR (5 PIEZO Gibson colony &2 PIEZO Gibson control colony&Negative control ddH2O, PCR for GpA& PTRE)
Total 20μl

2xTaq 10μl

Template 5μl

Primer 1 1μl

Primer 2 1μl

DdH2O 3μl

  • Primers: GpA primers/PTRE primers

389x546px

From the results, GpA can still be seen in ddH2O. The result is so strange. We don’t know how to explain.

4.Colony PCR (12 TRPC5 Ligation colonies&dd H2O)

Total 20μl

2xTaq 10μl

Template 5μl

TRPC5 Primer 1 1μl

TRPC5 Primer 2 1μl

ddH2O 3μl

438x377px

The PCR results showed no correct one. We can’t see TRPC5 band.

  • The rightmost one: Digested PBX123 backbone for TRPC5 is the gel extraction from step 1(Conc. 61.8ng/μl).The band should be around 8000bp. While the result is larger than 10000bp. This indicates that the extracted plasmid is not right.

5. Restriction enzyme digest(PBX123 backbone for PIEZO, PIEZO, both MfeI&BamHI&PmeI)

  • PBX123 backbone for PIEZO

Total 50μl

PBX123(~300ng/μl) 35 μl

10x Buffer 5 μl

DdH2O 7 μl

MfeI 1μl

BamHI 1μl

PmeI 1μl

  • PIEZO

Total 50μl

PBX123(~570ng/μl) 20μl

10x Buffer 5 μl

DdH2O 22 μl

MfeI 1μl

BamHI 1μl

PmeI 1μl

6. Pick up single colonies

Since the results from the Colony PCR of TRPC5 ligation was not very promising, we pick up 6 colony from the plate. Add into 5ml Amp LB, shake at 37℃.

The signal colonies are picked for the PCR process to make sure that Colony PCR it self have nothing to do with the failure.

2016-1-30

Piezo plasmid construction

  1. Enzyme digestion of PBX123(Age I and Bcl I for TRPC5)

PBX123(~300ng/μL) 30μL

Age I 1μL

CutSmart 5μL

ddH2O 14μL

Incubate in 37℃ for a whole night.

Add in Bcl I at 11:00, and move to 50℃.

Bcl I 1μL

Incubate in 50℃ for a 4 hours.

  1. Gel electrophoresis of PBX123(Mfe I, BamH I and Pme I for piezo), PBX123(Age I and Bcl I for TRPC5) and Piezo
266x528px

The PBX123(MfeI BamHI PmeI for piezo) and Piezo(digested) on the other gel was cut off for gel extraction

The concentration of the extraction:

PBX-123 40.8ng/μL

Piezo 28.4ng/μL

  1. Plasmid extraction E.Z.N.A.® Plasmid DNA Mini Kit I Protocol - Spin Protocol
Plasmid extraction from the single colonies we picked up yesterday.

The concentration of the plasmids:

TRPC5 ligation 1 378.2ng/μL

TRPC5 ligation 2 347.8ng/μL

TRPC5 ligation 3 343.3ng/μL

TRPC5 ligation 4 441.5ng/μL

TRPC5 ligation 5 438.0ng/μL

TRPC5 ligation 6 431.0ng/μL

  1. TRPC5 PCR
We add in the primer of TRPC5 and try to make TRPC5 PCR from the ligation plasmid we extracted from the single colonies.

We also make two control groups, positive control group from the original TRPC5 T5-GFP plasmid we got, and negative control group from ddH2O.

rTaq premix 5μL

Templet 1μL

Primer1 0.5μL

Primer2 0.5μL

ddH2O 3μL

  1. Gel electrophoresis of the PCR products and the gel extraction products.
365x381px

Nothing, even with the positive control group from the original TRPC5 T5-GFP plasmid we got, have shown the right result (some brightness around 3000bp).

  1. Gibson assembly of Piezo and PBX123

Gibson Assembly® Master Mix – Assembly (E2611)

528x232px

  1. Enzyme digestion of PBX123(Age I and Bcl I for TRPC5)(2nd)
PBX123(~300ng/μL) 30μL

Bcl I 1μL

3.1 5μL

ddH2O 14μL

Incubate in 50℃ for a 4 hours.

Conduct DNA extraction with Cycle-Pure Kit, use 45μL ddH2O to elute the DNA.

The DNA concentration was 92.5ng/μL.

DNA extraction 45μL

Age I 1μL

CutSmart 5μL

Incubate in 37℃ overnight.

  1. Transformation
We transform the plasmids which we get in Gibson assembly into 33μL competent cell(1 gibson system and 4 control systems).

We also transform PBX090 and PBX123 to get more plasmid for further use.

2016-1-31

Piezo plasmid construction

  1. 251x437pxGel electrophoresis of digested PBX123(Age I and Bcl I for TRPC5)(2nd)
  2. Colony PCR
Before colony PCR, we remove the plate of PBX123 from incubator to cold room.

We pick up 20 single colonies from the plate of Gibson group, 2 colonies from both control group 1 and 2. There are no colonies on plates of control group 3 and PBX090.

The system of colony PCR(use primers of poly A and pTRE):

Primer1 0.5μL

Primer2 0.5μL

Bacterial liquid 5μL

rTaq premix 6μL

We use original PBX123 to substitute the Bacterial liquid in positive control group 1.

We use poly A or pTRE that we get from the original PBX123 by PCR process to substitute the Bacterial liquid in positive control group 2.

We use ddH2O to substitute the Bacterial liquid in negative control group.

95℃ 30s

98℃ 10s

50℃ 10s x30 cycles

72℃ 100s

72℃ 120s

16℃ ∞

  1. Gel electrophoresis of colony PCR (step 2.)
497x449px

503x479px

Obviously, every Gibson group are negative.

  1. Enzyme digestion of PBX133(Bcl I and Age I, Nhe I, Xba I )
We suspect the availability of our Bcl I enzyme, so we digest this new backbone with another tube of Bcl I, and set a group digested by our enzyme to test its availability.

The system of digestion (by Bcl I of HW) (total 100μL):

Template(~200ng/μL) 50μL

Bcl I 5μL

NEBuffer(3.1) 10μL

ddH2O 35μL

Incubate in 50℃ for 1 hour.

The system of digestion (by Bcl I of IGEM)(total 10μL):

Template(~200ng/μL) 2.5μL

Bcl I(IGEM) 0.25μL

NEBuffer(3.1) 1μL

ddH2O 6.25μL

Incubate in 50℃ for 3.5 hours.

Conduct DNA extraction with Cycle-Pure Kit, use 50μL ddH2O to elute the DNA.

The DNA concentration was ng/μL.

The system of digestion (by Age I, Nhe I, Xba I )(total 50μL):

DNA extraction 42μL

Age I 1μL

Nhe I 1μL

Xba I 1μL

NEBuffer(CutSmart) 5μL

Incubate in 37℃ overnight.

  1. Gel electrophoresis of PBX133 digested by Bcl I(after incubating for 1 hour) (step 4.)
229x496pxFrom the result we can ensure our enzyme is available.

2016-2-1

Piezo plasmid construction

  1. Gel running of 4 enzymes digestion

193x529px 139x528px

For verification For gel extraction

574x410pxIt’s easy to observe small fragments which is about 100-200bp. This indicates that the PBX133 backbone was cut.

Digestion sites: Bcl I,Age I,Nhe I,Xba I

  1. Gel Extraction E.Z.N.A.® Gel Extraction Kit - Spin Protocol
We use the rest digested product to do gel extraction of cut PBX133(After 4 enzymes digested) Concentration:39.7 ng/μl
  1. Transformation of enzyme digested products
360x406px2.5μl PBX133 digested by 4 enzymes, 2.5μl PBX133 digested by BclI(iGEM), 1μl PBX133 original, 2.5μl PBX133 digested by BclI(HW) with 25μl competent cells each.

2016-2-14

TRPC5 plasmid construction

476x194px1. Enzyme digestion of TRPC5(T5-GFP and IRES-GPF)

Incubate in 37℃ for 3 hours.

2. TRPC5 PCR(T5-GFP and IRES-GPF)

476x195px

40 cycles

3. Make petro dishes.

We make 10 LB K+ petro dishes,75 Amp+ petro dishes and 14 LB petro dishes while waiting.

4. Gel electrophoresis of TRPC5

269x481px

The expected brightness (~3k bp) appeared with TRPC5 T5-GFP PCR.

But TRPC5 PCR purification group 4, which we did with the same process as TRPC5 T5-GFP PCR. Did not have the same brightness. So we decided to do another Gel electrophoresis process tomorrow.

  1. PCR purification of TRPC5 PCR products (T5-GFP and IRES-GPF)

E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol

The concentration of the products (diluted with 40μL ddH2O):

TRPC5 T5-GFP 105.2ng/μL

TRPC5 IRES-GPF 38.8ng/μL

  1. Enzyme digestion of TRPC5 T5-GFP PCR purification product
Since we have the expected brightness (~3k bp) appeared with TRPC5 T5-GFP PCR, we carry on with the experiment. And started the enzyme digestion. Because Bcl I only have 75% activity in CutSmart buffer. So we decided to leave it overnight.

459x196px

Incubate in 50℃ for overnight.

2016-2-15

TRPC5 plasmid construction

  1. Enzyme digestion of TRPC5(T5-GFP-Age 1)
Add 2 μL Age 1 into the system of last-night enzyme digestion.

Incubate in 37℃ for 2 hours.

  1. Enzyme digested product purification of TRPC5

E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol

The concentration of the products (diluted with 30μL ddH2O):

TRPC5 T5-GFP 58.8 ng/μl

  1. Gel electrophoresis of used TRPC5

283x461px

As we can see, the expected brightness (~3k bp) also appeared. It means that our TRPC5 PCR purification product is no problem, while the other four T5 products which were did before all have problem. So the four can’t be used, we will go deep by using the new TRPC5 PCR purification product.

  1. 569x173pxLigation of TRPC5 and PBX133 backbone T4 DNA Ligase(M0202)
Gently mix and let it in room temperature for 20 minutes.

Heat inactive at 65℃ for 10 minutes and put it in -20℃ for 4 hours.

  1. Transformation of TRPC5 plasmid

596x122px

Results :

236x236px 237x247px

TRPC5-PBX133 Ligation 2 TRPC5-PBX133 Ligation 1

227x227px

PBX133 backbone

The results are not so good. There are many kinds of passible reasons which we will go to confirm one by one tomorrow.

2016-2-16

TRPC5 plasmid construction

  1. Learn to design primer from Prof. Huang.
  2. Make new Amp+ agar plate.

Spread 12μl 50mg/ml Amp+ (sodium salt) to the plate made in Feb.24

Put the plate to 25℃ for 3 hours

  1. Examination of experiment and propagation of 090

Amp+ New plate(2016.2.16):

601x146pxAmp+ Old plate(2016.2.14):

588x121pxAmp+ Former plate(2015):

578x54pxK+ plate(2016.2.14):

574x77pxResults:

Amp+ New plate(2016.2.16):

251x245px247x244px

TRPC5-PBX133 Ligation 1 TRPC5-PBX133 Ligation 2

249x248px 249x246px

PBX133 backbone 1 PBX133 backbone 2

249x254px

Control

Amp+ Old plate(2016.2.14):

248x244px 246x246px

TRPC5-PBX133 Ligation 1 PBX133 backbone 1

252x257px 271x256px

PBX133 backbone 2 Control

Amp+ Former plate(2015):

250x252px

TRPC5-PBX133 Ligation 1

K+ plate(2016.2.14):

253x254px 260x256px

Control 090

Discussion:

Compare new and old plate, it comes out that some is wrong with the plate for its antibiotic function.

We thinks there may be two reason for this:

1.the antibiotics is inactived.

2.there is some distribution problem in the production of plate.

3.there is some concentration issue with the antibiotic.

There is also some problem with the ligation of TPRC6 and PBX133 backbone.

2016-2-17

TRPC5 plasmid construction

  1. To check whether Ampicillin and Kanamycin are effective
  1. Add 1 μl Ampicillin solution to each LB agar plate and spread.

Add 1 μl Kanamycin solution to each LB agar plate and spread.

  1. 2 Let them stay for 3 hours.
  2. 3 Add 25 μl competent cell to each plate. Incubate for 16 hours in 37 ℃

Result：There is no any colony in each plate. So Ampicillin and Kanamycin are effective.

  1. TRPC5 primer design

398x501px 

start="3" style="list-style-type: decimal;">

Make Amp+ and K+ LB agar plates.

We made 2*500ml LB agar. Add 500μl 1000x Amp+ in one and add 500 μl 1000x K+ in the other. We poured 15 K+ plates and 13 Amp+ plates.

2016-2-18

TRPC5 plasmid construction 

style="list-style-type: decimal;">

Modify the previous designed primers,based on following defects ①Protection bases are too short,should be 4~6 bases. ②The temperature of matching pieces is too low,should be 55~65℃,and the Tm of primer should be 75~85℃. ③The number of bases between start codon and stop codon of final ligation product should be the fold of 3. Modified primers: ①J23100-sfgfp-pBX123-piezo-primer primer1:5'-AGAC ACCGGT TCTAGA CTAGAGTCGCGGCCGCTTTACTTGTA- 3' AgeI XbaI Tm 62.6 primer2:5'-TACG GGATCC TTA T GGCGCGCC TTGATATCGAGCTCTTGACGGCTAGC- 3' BamHI AscI Tm 60.9 ②J23100-sfgfp-pBX123-TRPC5-primer primer1: 5'-AGAC ACCGGT GAATTC CTAGAGTCGCGGCCGCTTTACTTGTA- 3' AgeI EcoRI Tm 62.6 primer2: 5'-TACG GGATCC TTA T GCGGCCGC TTGATATCGAGCTCTTGACGGCTAGC- 3' BamHI NotI Tm 60.9 Amplify PBX-123 backbone Backbone 1μL+competent cell 33μL (3 tubes) Results:All 3 culture dishes don’t grow colony. Discussion:Maybe the concentration of PBX-123 backbone is too low,so we increase the concentration.(2016.02.19) Enzyme digestion of PBX-123 backbone(previous extracted PBX-123) 414x154px 2 tubes,each 3μL Purification of PBX-123(30μL system,2 tubes) Results: ①13.7ng/μL A260/280: 1.6 ②20.6ng/μL A260/280: 1.4 Add Klenow Fragment to create blunt ends(2 tubes) Klenow Fragment: 5units/μL

DNA Polymerase I, Large (Klenow) Fragment(M0210S)

Protocol(combine the NEB and Chinese protocol):

569x172px ①

②Incubate 15min at 25℃

③Incubate 30min at 75℃ 

style="list-style-type: decimal;">

Gel electrophoresis of 2 tubes blunt-ended PBX-123 Marker: DL10000 Results: Both 2 bands are near 10000bp and at the same site,which means the two bands are both blunt ends or sticky ends,we need to confirm after extracting the plasmid. (We forgot to take a picture of the gel) 2016-2-19 TRPC5 plasmid construction 

style="list-style-type: decimal;">

Gel cutting and extraction of PBX-123 Klenow Fragment products (30μL system) Concentration:7.6ng/μL, A260/280: 1.55 341x141pxLigation of PBX-123 blunt end T4 DNA Ligase(M0202) Amplify PBX-123 backbone,transform,select single colony and shake colony(4 tubes) Results:

PBX-123/ μl Competent cell/ μl Colonies
0 25 0
5 25 10+
15 25 2
25 25 1

333x249px264x302px Fig.1 PBX-123 0 μl control Fig.2 PBX-123 5 μl

337x252px340x255px

Fig.3 PBX-123 15 μl Fig.4 PBX-123 25 μl

Discussion:

The number of colonies decreases as the concentration of PBX-123

backbone increases,which is strange,so we need to do a gel running after

extracting the plasmid to confirm whether the PBX-123 has problem. 

start="4" style="list-style-type: decimal;">

Ligation product transform,select single colony and shake colony (1 tubes) Results: only one culture dish grows 1 colony 326x356px PBX-123 Not I-cut ligation 3 2016-2-20 TRPC5 plasmid construction

  1. PBX123 and PBX123(NotI-cut ligation) plasmid extraction

AxyPrep Plasmid Miniprep Spin Protocol

Final volume: 70 ul each tube

554x128px

  1. Breed preservation :

500ul bacterial : 500ul glycerol each tube

546x112px

  1. NotI digest and transform (2 tubes)

299x188px

Purification: 40 ul system

Results: ① 18.1 ng/μL A260/280: 1.64

Transform 3 plates (Amp+)

  1. He Yuhao repeats PBX123 NotI-cut:

NotI digest: 2 tubes

328x206px

Purification: 30 ul system each

Results: ① 25 ng/μL A260/280: 1.70

② 23 ng/μL A260/280: 1.66

2016-2-21

TRPC5 plasmid construction

1.Select single colony

All 3 culture dishes grow many colonies,but we still need to do colony

PCR to confirm they are blunt-ended.Ling Shaohua has designed the primer

for colony PCR,we need to ask Pro.Huang whether it’s right.

So we select 10 colonies,each with 10ul Amp+ LB broth and store at cold

room.When the primer is verified and synthesized,we will do colony PCR

and extract plasmid from those colonies which are confirmed to be right.

245x258px

248x256px

PBX-123 Not I cut 2.20 ① PBX-123 Not I cut 2.20 ②

247x268px

PBX-123 Not I cut 2.20 ③

2016-2-22

TRPC5 plasmid construction

1.Enzyme double digestion of HindIII-HF，Not I-HF. 37 ℃, 3hrs

507x166px

510x170px

567x436px Fig.1 PBX-123 plasmid pattern

2.Gel running, proof:

318x606px This shows we have successfully delete the Not-I RE site.

2016-2-24

TRPC5 plasmid construction

  1. TRPC5 enzyme digestion
We cut the TRPC5 PCR gel extraction from day 2.16 to give it a shot.

Only 23μL DNA left inside the tube.

523x162px

  1. Transformation：
We transform PBX133 PBX090 and Piezo to propagate them for further use.

We use the micropipette to inhale and blow the liquid inside Piezo for the plasmid sample, and add it to 33μL competent cells.

We add 2.5μL PBX133 and 2.5μL PBX090 to 33μL competent cells.

We coat and incubate at 37℃for 16 hours.

04.13~04.24 087&NFAT Plasmid Construction

Restriction Enzyme Digestion for Verification

553x237px

Gel Extraction

433x288px

Sequencing Result:

Correct

04.24~05.06 TRPC5 Plasmid Construction

06.15~06.30 Restriction Enzyme,Ligase and Transformation Efficiency Test sfgfp PCR and Gel Extraction

368x530px

Transformation Result

319x292px326x311px

7.1

Efficiency Tests

Transformation efficiency (3 groups)

422x77px

Enzyme digestion efficiency (3 groups)

553x79px

1>Prepare digestion system:

193x175px

Incubate at 37℃,6hrs.

Ligation efficiency (3 groups)

553x79px

1> Prepare ligation system T4 DNA Ligase(M0202)

250x162px

Incubate at room temperature for 20mins

Transformation & Competent cell recovery

1. Get competent cell (DH5α) from -80℃，lay on ice for 15mins till melted.

2. Add plasmids according to the table above, gently blow to mix well.

3. Incubate on ice for 30mins.

4. Incubate in 42℃ water bath for 90s.

5. Lay on ice for 5mins.

6. Add 300μl LB, 37℃, 220rpm for 20mins.

7. Add 300μl Amp+ LB, 37℃, 220rpm for 20mins.

8. Centrifuge at 5000rpm, 1min. Drop 400μl suspension.

9. Mix the left 200μl gently, spread plate.

NOTE:

  1. For ligation products, subpackage of competent cell may decrease the final efficiency.
  2. During transformation, after heat shock, competent cell should be spread on preheated agar plate (37℃) to reach a higher transformation efficiency.

7.2

Efficiency tests results:

509x337px

NOTE:

Too many non-target bacterial colonies(non-green).

Efficiency tests failed.

Non-green colony test (I) 

style="list-style-type: decimal;">

Pick 1 non-green colony on each plate. Mix with 20μl ddH2O Get 10μl add into 5ml Amp+ LB to incubate at 37℃, 220rpm for <16hrs. Get 10μl to do colony PCR: 1> Primer

    Forward -- AACGTATAAGCTTTAGGCGTGTACG Reverse -- TTGTGCACCAGTCATAGCCGAATAG 2> Polymerase Chain Reaction (PCR)system

Q5® High-Fidelity 2X Master Mix(M0492S)

220x192px

3> PCR setting

424x181px

4> Gel electrophoresis

362x394px

7.3

Non-green colony test (II) 

style="list-style-type: decimal;">

Use E.Z.N.A.TM Plasmid Mini Kit(Omega D6942-02) to purified plasmids. According to spin protocol. Test the concentration ( Eppendorf BioSpectrometer) Use another pairs of primers to do PCR Primer Forward -- CTAGAGTCGCGGCCGCTTTACTT Primer Reverse -- TCGAGCTCTTGACAGCTAGCTCA 4.Double-enzyme digestion 297x192px 5. Gel electrophoresis 593x238px 7.4 Non-green colony test (III) 1.Enzyme digestion 280x151px 2. Gel electrophoresis 375x276px

7.6

1.Enzyme digestion

301x161px

2. Gel electrophoresis

557x341px

7.7-7.10

New plasmids design:

  • TRPC5-Loxp
  • Sfgfp-pBX123
  • pBX097-neoloxp

7.11

TRPC5-Loxp Plasmid Construction(I)

1. TRPC5-R plasmid enzyme digestion

276x148px 

start="2" style="list-style-type: decimal;">

Gel electrophoresis for gel extraction 238x228px 254x235px NOTE: Wrong length and faint bands DraIII digestion site: 202x45px 7.12

TRPC5-Loxp Plasmid Construction(II)

1.TRPC5-L and TRPC5-R PCR

Primer F -- TTGGCAAAGAATTCCTCGAGG

Primer R -- GCCGATCATGCTGATATTGAGT

2.Gel electrophoresis for gel extraction

280x278px

3.Gel Extraction (According to Gel Extraction protocol )

4.TRPC5-L plasmid re-synthesis

7.13

pBX097-neoloxp construction(I) 

style="list-style-type: decimal;">

Neoloxp PCR from pBX123 plasmid 253x292px Gel extraction Test product’s concentration 4.Double-enzyme digestion and pBX097 plasmid enzyme digestion 278x181px 5.Gel electrophoresis

363x359px

7.16 - 7.21

pBX097-neoloxp construction(II)

1.Ligate the pBX097 and neoloxp with T4 DNA ligase and Quick Ligase (NEB)

2.DNA transformation

Result: None colony

TRPC5-Loxp Plasmid Construction(III) 

style="list-style-type: decimal;">

TRPC5-R PCR product double-enzyme digestion (AflII; KpnI) overnight TRPC5-L synthesis products transformation TRPC5-L plasmid purification TRPC5-L plasmid enzyme digestion (AflII; KpnI) overnight Ligation of TRPC5 left and right (T4 DNA ligase) Spread plate, incubate at 37℃ for <16hrs Pick single colony, incubate in 15ml Amp+ LB for 16hrs at 37℃ Separate the culture into 5ml(to prove); 9.5ml(for endofree); 0.5ml (for preservation in -80℃) Single-enzyme digestion (PvuI; BamHI) and gel electrophoresis 426x271px Correct

pBX123-sfGFP construction

  1. sfGFP PCR
  2. Pbx123 double-enzyme digestion

3. Double-enzyme digestion ( AgeI; BamHI ) of sfGFP Overnight

4.Gel Extraction and Cycle pure

5. Ligation of sfGFP and pBX123 backbone

6. Spread plate incubate at 37℃, <16hrs

7. Pick 8 colonies incubated in 5ml Amp+ LB each, at 37℃ 220rpm for <16hrs

8. Plasmid purification

E.Z.N.A.® Plasmid DNA Mini Kit I Protocol - Spin Protocol

9. Double enzyme digestion for proof (AflII; EcoRI)

10.Gel electrophoresis

589x231px

7.22-7.23

pBX097-neoloxp construction(II)

1.Ligate the pBX097 and neoloxp with T4 DNA ligase and Quick Ligase (NEB)

2.DNA transformation

Result: 7 colonies

3. Pick colonies to 5ml Amp+ LB, incubate at 37℃, 220rpm for <16hrs.

4. Plasmid extraction with Plasmid Mini Kit (Omega)

5.Single-enzyme digestion

283x184px

Incubate at 37℃, overnight.

7.24-7.25

pBX097-neoloxp construction(II)

1.Gel electrophoresis

610x227px

Result: pBX097-neoloxp successfully constructed.

7.26-7.30

TRPC5-Loxp Plasmid Construction(IV)

1.TRPC5-Loxp endofree plasmid purification.

2.pBX097-neoloxp and TRPC5 sequencing

Primer for TRPC5---GCCGATCATGCTGATATTGAGT

Primer for pBX097-neoloxp---GGCAACGTGCTGGTTATTGTGC

8.1-8.2

pBX123-sfGFP Efficiency test

388x104px

Repeat the experiments steps mentioned in 7.1

8.3-8.4

pBX123-sfGFP enzymes’ digestion sites ligation ability

396x73px302x171px

1> Prepare digestion system, incubate overnight

2> Gel extraction to get different fragments

3> Ligation of T4 DNA ligase/Quick ligase

4> Transformation

Results:

320x181px

8.5

TRPC5-loxp sequencing results:

232x139px

pBX097-neoloxp sequencing results:

273x110px

8.6-8.7

Non-green colony PCR

553x408px

8.9

Change NFAT-YFP to NFAT-EGFP(I) 

style="list-style-type: decimal;">

Double enzyme digestion (AgeI, BamHI) pBX123 to get EGFP fragment Double enzyme digestion (AgeI, BamHI) NFAT-YFP to get backbone Overnight 8.10

Change NFAT-YFP to NFAT-EGFP(II) 

style="list-style-type: decimal;">

Gel extraction for EGFP and NFAT backbone Ligation by T4 DNA ligase Transformation 8.11-8.13

Change NFAT-YFP to NFAT-EGFP(II)

  1. Pick single colony to culture in 15ml Amp+ LB for 16hrs
  2. Plasmid mini kit to get purified plasmid
  3. Enzyme digestion to prove
  4. Send to sequencing

8.22

TRPC5 Random mutagenesis(I)

355x96px 

style="list-style-type: decimal;">

Megaprimer PCR 1> Pre-experiments: T5 exonuclease digestion level according to time. a. Use PrimerStar to do PCR of TRPC5 mutation region (~640bp) b. Gel extraction to get TRPC5 mutation region c. Set a series gradients of T5 digestion time: 0, 5, 10, 20mins 290x160px d. EDTA preparation To get EDTA solution with final concentration of 11mM (Planing to add 1μl solution into 50μl to stop reaction). We should get 540mM stock solution.

  • Weigh 1.08g EDTA powder add into 5ml ddH2O
    • Use magnetic stirring bar to help dissolve
      • Add NaOH powder to adjust solution’s PH until dissolved completely
        • Use 0.22μm filter to filtrate the solution
          • store in -20℃

Note: To keep T5 exonuclease digestion time as precise as possible, according to its protocol, we use EDTA to stop the digestion. e. T5 digestion (according to T5 exonuclease protocol) 262x163px f. Take group①②③for gel extraction; ④⑤⑥for cycle pure. 562x245px 8.23 Megaprimer PCR 1> Send ④⑤⑥ to sequence Primer F:ATCCGAATTCCCCTCCAAATC Primer R:TATGTTAAGTTCCCAGCCCAG 2> Megaprimer PCR:

  • Use Q5® High-Fidelity 2X Master Mix(M0492S), System 50μl, Tm=65℃
    • Cycle pure to get purified PCR products.
      • Use DpnI to digest plasmids that come from bacteria (methylated sites)

318x146px **** Transformation of digested products. 8.24 Megaprimer PCR results of different digestion time and ratios of templet and primer: 497x611px 8.24 

style="list-style-type: decimal;">

TRPC5 mutation region PCR TPRC5 preserved bacteria plate streaking DpnI digestion time experiment: “Whether 100ng plasmid can be digested completely by 1μl DpnI in 25μl, for 1h” Result: 334x292px 8.25 Megaprimer PCR

  1. To find out the best annealing temperature for megaprimer. Set a series of annealing temperatures: 55, 60,65,70℃
  2. Repeat PCR
  3. Cycle pure to get purified PCR products.
  4. DpnI digestion
  5. Transformation

8.26

Megaprimer PCR results of different digestion time;PCR annealing temperatures and ratios of templet and primer:

530x304px

Colony number according to different annealing temperatures and ratios of templet and primer:

540x174px

Sequencing results of T5 exonuclease digestion level according to time:

527x169px 

style="list-style-type: decimal;">

Repeat T5 exonuclease digestion level according to time: Set series of time gradients: 0, 5, 7.5, 10mins a. T5 digestion (according to T5 exonuclease protocol) 262x163px b. Take each group for Gel electrophoresis 332x257px c. Send each group to sequence Primer F:ATCCGAATTCCCCTCCAAATC Primer R:TATGTTAAGTTCCCAGCCCAG 8.28

Sequencing results of T5 exonuclease digestion level according to time:

559x244px

8.29

Culture medium Pollution proving:

Set 4 groups of experiments (use sfGFP plasmid):

338x110px

8.30

Culture medium Pollution proving results: 

style="list-style-type: lower-alpha;">

Group 3 number > Group 1 number ; with lots of non-green bacteria Group 4 has >100 colonies of non-green bacteria Group 2 has no colony Conclusion: Culture medium has been polluted. Gibson assembly (pre-experiment) 1> Directly cut the mutation region by AflII and EcoRI for 8hrs 2> Gel extraction to get the 640bp fragment 341x267px 3> Use Gibson Assembly® Master Mix to get whole plasmid 4> Transformation

8.31

1.Gibson assembly result: NONE colony

2.Random mutagenesis with Kit, according to Random mutagenesis protocol

09.01

Design qPCR Primers and Send for Synthesization

Sequences:

1.097&NeoLoxP qPCR-1st

552x228px 

start="2" style="list-style-type: decimal;">

qPCR Internal Positive Control 553x118px

09.04

Gibson Assembly

Insert : vector=2 : 3(50~100ng vector)

608x120px

T5 Exonuclease Digestion

Temperature: 50℃

472x64px

Transformation into Competent Cells

5μl product are transformed with 50ul competent cells.

Error-prone PCR(low frequency)

1. Information supplied with the GeneMorph II Random Mutagenesis Kit

(Agilent Technologies,Catalog #200550):

553x320px 

start="2" style="list-style-type: decimal;">

Primers sequence: Forward: ttactcaccatacagagatcgaattcc Reverse: ttttccactttgctcagctccttaag Target DNA mass: 500ng,corresponding to low frequency mutation 529x284px 

start="4" style="list-style-type: decimal;">

Procedure 553x226px The annealing temperature is set to be 57℃.

Gel Extraction of ep-PCR Product

Concentration: 135ng/μl, 30μl

qPCR Primer Test

Instrument: ABI StepOne Plus qPCR

Kit: Power SYBR® Green PCR Master Mix and RT-PCR Reagents Kit 

style="list-style-type: decimal;">

Sample: CHO cell genomic DNA extracted from 4.5x106 cells. Concentration: 56.1ng/μl, 400μl Target: Neoloxp segment, 18sRNA, GAPDH Standard: 097&Neoloxp plasmid(length:6635bp) Concentration: 101.2ng/μl 616x156px 4. 611x175px 

start="5" style="list-style-type: decimal;">

Procedure 669x161px

09.05

Transformation Result

No colony

Possible reason: The transformation efficiency of self-made competent cells is quite low.

09.06

TRPC5 PCR with PrimeStar

1.Primers sequence:

Forward: ttactcaccatacagagatcgaattcc

Reverse: ttttccactttgctcagctccttaag

2.Total 8 tubes of PCR reaction:

553x212px 

start="3" style="list-style-type: decimal;">

Procedure 553x156px Gel Extraction 711x226px

Concentration: 180ng/μl, 30μl, total 4 tubes.

T5 Digestion for 3.5 minutes and Cycle-pure

Concentration: 60ng/μl, 50μl

Mega-primer PCR with KOD Polymerase 

style="list-style-type: decimal;">

Template DNA: 0.1ng, Mega-primer:Template=10000:1

553x260px 

style="list-style-type: decimal;">

Procedure: 553x155px

Cycle-pure and Gel Running

Concentration: 30ng/μl, 50μl

242x319px

No 6000bp band is appeared,it’s a problem!!

DpnI Digestion for 1 hour

Transformation

5μl product are transformed with 100ul competent cells.

qPCR Primer Test

Instrument: Bio-Rad

Kit: TaKaRa-One Step SYBR PrimeScript RT-PCR Kit I

1. Sample:

CHO cell genomic DNA extracted from 4.5x106 cells.

Concentration: 56.1ng/μl, 400μl

2. Target:

Neoloxp segment, 18sRNA, GAPDH

3. Standard:

097&Neoloxp plasmid(length:6635bp)

Concentration: 101.2ng/μl

612x155px

4.

608x186px

Wrong: Forget to add ‘PrimeScript Enzyme Mix’ which contains ‘Taq enzyme’,thus no PCR reaction works.

5. Procedure

669x161px

09.07

Transformation Result

No colony

Possible reason: The mega-primer PCR procedure didn’t work.

Mega-primer PCR with Q5

1.Template DNA: 0.1ng,

Mega-primer:Template=10000:1

553x164px 

start="2" style="list-style-type: decimal;">

Procedure 553x155px qPCR Primer Test with Premix and Gel Running 

style="list-style-type: decimal;">

Gel concentration: 2%(to better show the needed band) 551x231px Procedure 553x174px 4. Results 576x295px 696x187px The gel running results show that primer 1~4 and primer GAPDH has been contaminated,we need to use new primer and be care of experiment operation.

09.08

Gel Running with 30μl mega-primer PCR product

352x316px

There is a band at around 6000bp position!

DpnI Digestion for 1 hour

392x174px

Transformation

10μl product are transformed with 100ul competent cells.

09.09

Transformation Result

Little or no colony is appeared,maybe the transformation efficiency of competent cell is still too low.

09.12 Pre-experiment of enzyme digestion and ligation

TRPC5 PCR with PrimeStar 

style="list-style-type: decimal;">

Primers sequence Forward Primer:　atccGAATTCccctccaaatc Reverse Primer:　ATGATCTCCAGTTCTCTGGA 2. Total 2 tubes PCR reaction 405x203px 

start="3" style="list-style-type: decimal;">

Procedure 553x156px

Gel Extraction

406x293px

Concentration: 44.4ng/μl, 40μl

EcoRI,SacI Restriction Enzyme Digestion

1. Insert

294x212px

The digestion is from 00:20 to 09:00. 

start="2" style="list-style-type: decimal;">

Vector 300x214px

The digestion is from 21:00 to 09:00.

qPCR Primer Re-design and Send for Synthesization

Sequences:

097&NeoLoxP qPCR-2nd

622x225px

09.13

Transformation

Use the bought competent cell,with transformation efficiency of approximately 10^7.

Gel Extraction of Enzyme Digested Vector

360x360px

Concentration of vector: 44.8ng/μl,20μl

Cycle-pure of Enzyme Digested Insert

Concentration of insert: 25.3ng/μl, 40μl

Ligation with T4 DNA Ligase

502x212px

The ligation is from 12:50 to 14:00.

Transformation

09.14

Transformation Result

553x388px

516x504px

518x177px

Competent Cell Efficiency

1. Formula: Colonies on plate / ng of DNA plated x 1000 ng/μg

2. Calculation:　237 / 0.02 x 1000=1.185x107 cfu/μg

3. Actual meaning: 20pg,5640bp→3.457x106 copies

3.457x106 / 237=14586,which means 1 of 14586 vectors would actually grow on the plate.

Ligation Efficiency

1. 62ng,4906bp→1.232x1010 copies

2. Efficiency=

Mutation Library

1.Q5: 2.782x106

2.Gibson: 5.54x105

3. Ligation:　2.102x107

Repeat the pre-experiment on 09.12

Use enzyme digestion and ligation method to construct mutation library,except that using error-prone PCR,and the target DNA is 500ng.

461x331px

334x302px

09.15

qPCR Primer Test with Premix and Gel Running

1. Procedure is the same with the experiment on 09.07

2. Results:

755x188px 

start="2" style="list-style-type: decimal;">

Conclusion: I. Primer 1~4 are not good enough,cause they all can match with CHO cell’s gDNA and have PCR products. II. Primer 2~4 are contaminated. III. Primer GAPDH has unspecific PCR product,so it can’t be used. Primer 18sRNA can be used. 09.18 Transformation

10μl positive ligation product are transformed with 125ul competent cells.For control group,5ul ligation product are transformed with 50ul competent cells.

qPCR Primer Test with Premix and Gel Running

1. We set 2 annealing temperature,which are 65℃ and 70℃ respectively.

2. Results:

865x276px3. Conclusion:

I. Primer 1~4 are all not contaminated and have specific PCR band with annealing temperature of 65℃,while they don’t have PCR product band with annealing temperature of 70℃.

II. Raising annealing temperature can reduce unspecific amplification,while it can also decrease the PCR efficiency and cause Ct increasement.Also we need to verify whether the product band is what we need.

09.19

Transformation Result

330x57px

1. Mutation library(10ul ligation product)=10688

2. Ligation efficiency=

Pick 20 Single Colony for sequencing

Sequencing Result:

7 out of 20 plasmids have mutation(s) among specific region,in which one has 15 base mutations,one has 2 base mutations,and the rest five have 1 base mutation.

Scrape the Colonies for Endo-free Plasmid Extraction

The scraped colonies are cultured for around 9 hours till the OD achieves 2.879,with 150ml Amp.

Concentration: 55ng/μl, 1.75ml

09.20

qPCR Primer Test with Premix and Gel Running

1. We set 3 annealing temperature,which are 61℃,62℃ and 63℃ respectively.

2. Results:

621x618px

09.21

CHO cell Genomic DNA Extraction 

style="list-style-type: decimal;">

Positive: GECO+NFAT+Neoloxp ①d1-A10 ②d2-B5 ③d2-B9 ④d1-D3 ⑤d2-E9 ⑥d1-F5 ⑦d1-F11 ⑧d1-A9 ⑨d1-B3 ⑩d2-C1 Control: GECO+NFAT ①C4 ②E6 ③F8 ④H10

09.22

qPCR Primer Test

Instrument: ABI StepOne Plus qPCR

Kit: TaKaRa-One Step SYBR PrimeScript RT-PCR Kit II

1. Sample:

CHO cell genomic DNA

Positive: transfected with GECO+NFAT+Neoloxp

Negative Control: transfected with GECO+NFAT

Wild Type Control: CHO cell genomic DNA

2. Target:

Neoloxp segment, 18sRNA

3. Standard:

097&Neoloxp plasmid(length:6635bp)

Concentration: 101.2ng/μl

612x149px

4.

608x186px

5. Procedure

671x158px 

start="6" style="list-style-type: decimal;">

Results 314x157px Conclusion

I.Can’t use ‘TaKaRa-One Step SYBR PrimeScript RT-PCR Kit II’,cause our sample is DNA.

II.We forgot to add ‘PrimeScript Enzyme Mix’ at the beginning,which may cause inaccurate results.

III.We forgot to change pipette tips during the dilution,which may bring huge deviation.

IV.Two-step PCR has a low amplification efficiency in our experiment.To increase the efficiency,we need to use three-step PCR.

09.23

qPCR Primer Test

Instrument: ABI StepOne Plus qPCR

Kit: TaKaRa-SYBR Premix Ex Taq II(Tli RNaseH Plus)

1. Sample,Target and Standard are the same with the experiment yesterday.

2.

442x268px 

start="3" style="list-style-type: decimal;">

Procedure 650x146px 4. Results 332x143px 471x117px 5. Conclusion

Primer 3,4 are similarly efficient,combining with previous experiment result,we choose Primer 3 in the later experiment.

09.24

Repeat the mutation experiment on 09.14

1. The targeted mutation segments are 1ng,10ng,100ng respectively.

2. During the first PCR procedure,the annealing temperature is set to be 52℃,which is quite low,so it didn’t work.Then we change it to 57℃.

3. Procedure

553x172px

Gel Extraction of PCR Product(as Insert)

553x55px

Each with volume of 30μl.

EcoRI,SacI Restriction Enzyme Digestion for 9 hours

Cycle-pure

553x56px

qPCR Primer Test with Premix and Gel Running

Annealing temperature: 62℃

543x192px

Conclusion:

I.We can directly see the band’s brightness differences from the gel running result,which may indicate their plasmid copy number differences.Still,we need to do quantitative PCR to get more precise results.

II.It’s strange as well as unreasonable that band appears in wild-type control PCR result,which may indicate that it has been contaminated.

qPCR: 097-gDNA with Primer3

Instrument: ABI StepOne Plus qPCR

Kit: TaKaRa-SYBR Premix Ex Taq II(Tli RNaseH Plus) 

style="list-style-type: decimal;">

Sample: Positive ①②③⑤⑦⑧⑩ Target: Neoloxp Standard: 097&Neoloxp plasmid-③ 2. Reagent and Procedure are the same with the experiment on 09.23. 3. Results 470x57px 259x107px 312x220px 4. Conclusion

Wild type control(new) may be contaminated.

09.25

We find that the synthesized TRPC5 has a problem,which may cause replacement during protein translation,so we need to re-construct TRPC5 plasmid.

Primer Synthesization(send to Invitrogen)

Sequences

Forward Primer: atccGAATTCccctccaaatc(we already have,don’t need to synthesize)

Reverse Primer: tgc tctaga gtg gcccagctgtactacaag

09.26

qPCR Primer Verification with Premix and Sequencing

Sequencing Results:

The PCR results are what we need,and the wild-type genomic DNA which were recently extracted are indeed contaminated.

09.27 Re-construct TRPC5 Plasmid

TRPC5 PCR with modify-primer

Same procedure as before

Gel Extraction

181x354px

XbaI,SacI Restriction Enzyme Digestion for Vector and Insert

09.28

Gel Extraction for Vector

Cycle-pure for Insert

T4 DNA Ligation for 20min

Transformation

After culture for 10 hours:

584x279px

Pick 8 Single Colony and Culture for Sequencing

Sequencing Result:

All correct.

Culture Colonies for Endo-free Plasmid Extraction

CHO Cell Genomic DNA Extraction

Positive: GECO+NFAT+Neoloxp

(11)d1-C1 (12)d1-C8 (13)d1-D12 (14)d1-E3 (15)d1-E4

(16)d1-F3 (17)d1-F6 (18)d1-F9 (19)d2-C3 (20)d2-C8

(21)d2-D5

09.29

PvuI,NcoI Restriction Enzyme Digestion for Verification

669x264px

Verification result: All correct.

10.01 Construct Mutation Library

Vector: TRPC5 digested with EcoRI,SacI,AflII

Insert: ep-PCR segments,with low&medium&high mutation frequency.

Gel Extraction of Enzyme-digested Vector

516x413px

Ligation for 1 hour

Transformation

5μl ligation product are transformed with 100ul competent cells.

qPCR: 097-gDNA with Primer3

Instrument: ABI StepOne Plus qPCR

Kit: TaKaRa-SYBR Premix Ex Taq II(Tli RNaseH Plus)

1. Sample: Positive (3),(11)~(21)

Negative: wild type cho cell gDNA

Target: Neoloxp

Standard: 097&Neoloxp plasmid（ Endofree-① ），289ng/μl

The first and last dilution point are added with 10ng wild-type gDNA,to see its influence on standard curve.

2. Reagent and Procedure are the same with the experiment on 09.23,except that the annealing temperature is set to be 64℃.

3. Results

462x61px

260x79px

4. Conclusion

I. The plasmid concentration differs each time,we need to standardize the method for concentration measurement.

II. The primer is not good enough,which may cause inaccurate standard curve and copy number result.

10.02

Scrape the Plate for Endo-free Plasmid Extraction

323x323px

264x538px 270x540px

270x524px 267x525px

322x63px

620x52px

Each with volume of 100μl.

CHO Cell Genomic DNA Extraction

Positive: GECO+NFAT+Neoloxp 

start="22" style="list-style-type: decimal;">

d2-C6 (23)d2-A5 (24)d2-A8 

start="25" style="list-style-type: decimal;">

d2-A9 (26)d1-D10 Wild type: CHO cell’s gDNA All the plasmids’ concentrations are re-measured using NanoDrop. 10.03

qPCR: 097-gDNA with Primer3

Instrument: ABI StepOne Plus qPCR

Kit: TaKaRa-SYBR Premix Ex Taq II(Tli RNaseH Plus)

1. Sample: Positive (3),(22)~(26)

Negative: wild type cho cell gDNA(newly extracted)

Target: Neoloxp

Standard: 097&Neoloxp plasmid（ Endofree-① , 307.8ng/μl

All the dilution points are added with 10ng wild-type gDNA.

2. Reagent and Procedure are the same with the experiment on 09.23,except that the annealing temperature is set to be 64℃.

3. Results

458x61px

210x84px

4. Conclusion

I. The standard curve efficiency is 140%,it may result from the adding of wild type gDNA in the preparation of standard point.

II. The Ct of wild type gDNA is 26,which indicates that it has been contaminated.So the copy number results are not precise,we can only compare their differences.






Made by from the iGEM team SUSTech_Shenzhen.

Licensed under CC BY 4.0.

  • ©2016 SUSTech_Shenzhen