Cockroach627 (Talk | contribs) |
Sustcer why (Talk | contribs) |
||
(30 intermediate revisions by 3 users not shown) | |||
Line 68: | Line 68: | ||
'''Step 1''': run 10 cycles without primer to let Bla and 2A link together. | '''Step 1''': run 10 cycles without primer to let Bla and 2A link together. | ||
− | |||
− | |||
{| | {| | ||
Line 91: | Line 89: | ||
|} | |} | ||
− | 4. PCR product cycle purification by using [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A. | + | 4. PCR product cycle purification by using [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Cycle_Pure_Kit_-_Centrifugation_Protocol | '''E.Z.N.A.® Cycle Pure Kit''']]. |
---- | ---- | ||
Line 164: | Line 162: | ||
'''Note:''' BclI and BglII have the same sticky end. | '''Note:''' BclI and BglII have the same sticky end. | ||
− | 7. Gel running and Gel extraction to get the insert and vector fragments.[[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A. | + | 7. Gel running and Gel extraction to get the insert and vector fragments.[[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Gel_Extraction_Kit_-_Spin_Protocol | '''E.Z.N.A.® Gel Extraction Kit - Spin Protocol''']] |
---- | ---- | ||
Line 172: | Line 170: | ||
==== Geco plasmid construction ==== | ==== Geco plasmid construction ==== | ||
− | 1. Geco,Vector,Bla+2A Ligation with [[Team:SUSTech_Shenzhen/Notebook/Protocol# | + | 1. Geco,Vector,Bla+2A Ligation with [[Team:SUSTech_Shenzhen/Notebook/Protocol#T4_DNA_Ligase.28M0202.29 | '''T4 DNA Ligase''']](Vector:Insert=1:3). |
Vector (5.8 kbp): 5.5ng/μl | Vector (5.8 kbp): 5.5ng/μl | ||
Line 200: | Line 198: | ||
Room temperature for 10 minutes. | Room temperature for 10 minutes. | ||
− | 2. Mix&Go hyper-efficient competent cells [[Team: | + | 2. Mix&Go hyper-efficient competent cells [[Team:SUSTech_Shenzhen/Notebook/Protocol#Transformation_.26_Competent_cell_recovery|'''transformation''']]. |
:* Quickly thaw: remove "Mix&Go" hyper-efficient competent cells from -80℃ freezer and water flow till 50% of the cells melt. | :* Quickly thaw: remove "Mix&Go" hyper-efficient competent cells from -80℃ freezer and water flow till 50% of the cells melt. | ||
Line 217: | Line 215: | ||
1. Vector+Bla 2A+Geco transformation results: | 1. Vector+Bla 2A+Geco transformation results: | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--BBCBE55B-457E-48C9-8622-DD30E0826C72.png | caption= | width=300px}} | |
2. Pick single clones and overnight culture. | 2. Pick single clones and overnight culture. | ||
Line 229: | Line 227: | ||
==== Geco plasmid construction ==== | ==== Geco plasmid construction ==== | ||
− | 1. Extraction of plasmid with [[Team: | + | 1. Extraction of plasmid with [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Plasmid_DNA_Mini_Kit_I_Protocol_-_Spin_Protocol | '''E.Z.N.A.® Plasmid DNA Mini Kit I Protocol''']]. |
− | + | {| class="table table-striped" | |
+ | ! Geco plasmid !! Conc. (ng/ul) !! A260/280 | ||
+ | |- | ||
+ | | 1 ||94.2 || 1.92 | ||
+ | |- | ||
+ | | 2 || 79.7 || 1.96 | ||
+ | |- | ||
+ | | 3 || 110.6 || 1.90 | ||
+ | |- | ||
+ | | 4 || 150.3 || 1.87 | ||
+ | |- | ||
+ | | 5 || 149.7 || 1.88 | ||
+ | |} | ||
2. Send 5 plasmids to sequence. | 2. Send 5 plasmids to sequence. | ||
Line 241: | Line 251: | ||
==== Piezo plasmid construction ==== | ==== Piezo plasmid construction ==== | ||
− | 1. Piezo backbone(PBX-123 plasmid from Prof.Huang’s lab) transformation.[[Team: | + | 1. Piezo backbone(PBX-123 plasmid from Prof.Huang’s lab) transformation.[[Team:SUSTech_Shenzhen/Notebook/Protocol#Mix.26Go_method. | '''Mix&Go method.''']] |
Piezo backbone plasmids 2μl + competent cells 20μl | Piezo backbone plasmids 2μl + competent cells 20μl | ||
Line 253: | Line 263: | ||
1. Piezo backbone transformation results: | 1. Piezo backbone transformation results: | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--09F6D763-DCE8-4956-9A22-FA6451167FAC.png | caption= | width=300px}} | |
2. Pick single clones and overnight culture. | 2. Pick single clones and overnight culture. | ||
Line 263: | Line 273: | ||
==== Piezo plasmid construction ==== | ==== Piezo plasmid construction ==== | ||
− | 1. Extraction of plasmid with [[Team: | + | 1. Extraction of plasmid with [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Plasmid_DNA_Mini_Kit_I_Protocol_-_Spin_Protocol | '''E.Z.N.A.® Plasmid DNA Mini Kit I Protocol''']]. |
− | + | {| class="table table-striped" | |
+ | ! piezo !! Conc. (ng/ul) !! A260/280 | ||
+ | |- | ||
+ | | 1 || 143.4 || 1.87 | ||
+ | |- | ||
+ | | 2 || 283.1 || 1.87 | ||
+ | |- | ||
+ | | 3 || 186.8 || 1.87 | ||
+ | |} | ||
2. Piezo GPA、pTRE-3G PCR. | 2. Piezo GPA、pTRE-3G PCR. | ||
Line 271: | Line 289: | ||
Piezo: 310ng/μl GPA: 444bp pTRE-3G: 376bp | Piezo: 310ng/μl GPA: 444bp pTRE-3G: 376bp | ||
− | + | {| class="table table-striped" | |
+ | ! !! Protocol !! Final conc. !! Add (ul) | ||
+ | |- | ||
+ | | PrimeSTAR Max(2X)|| 25ul || 1X ||25 | ||
+ | |- | ||
+ | | Primer1 || 10-15pmol || 0.2-0.3uM || 1.3 | ||
+ | |- | ||
+ | | Primer2 || 10-15pmol || 0.2-0.3uM || 1.3 | ||
+ | |- | ||
+ | | Template || <200ng || ||0.7 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || || || 21.7 | ||
+ | |- | ||
+ | | Total || 50ul || || 50 | ||
+ | |} | ||
Program setting: | Program setting: | ||
Line 284: | Line 316: | ||
3.Gel Running | 3.Gel Running | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--C07837D2-D576-46FF-9DDC-4403716E122E.png | caption= | width=300px}} | |
− | + | ||
4.PCR purification. | 4.PCR purification. | ||
− | [[Team: | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Cycle_Pure_Kit_-_Centrifugation_Protocol | '''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol''']] |
− | + | {| class="table table-striped" | |
+ | ! !! Conc. (ng/ul) !! A260/280 | ||
+ | |- | ||
+ | | GPA || 122.7 || 1.85 | ||
+ | |- | ||
+ | | pTRE-3G || 102.5 || 1.84 | ||
+ | |} | ||
---- | ---- | ||
Line 305: | Line 342: | ||
1. Piezo plasmid construction design: | 1. Piezo plasmid construction design: | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--2016-10-16 17.34.46.png | caption= | width=300px}} | |
2. Piezo plasmid(original) RE digestion: 37℃ 2hours | 2. Piezo plasmid(original) RE digestion: 37℃ 2hours | ||
− | + | {| class="table table-striped" | |
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | piezo DNA (576ng/ul) || 2 | ||
+ | |- | ||
+ | | AscI || 1 | ||
+ | |- | ||
+ | | NotI|| 1 | ||
+ | |- | ||
+ | | 10X CutSmart buffer || 5 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 41 | ||
+ | |} | ||
3. Backbone PBX-123 plasmid RE digestion: 37℃ 2hours | 3. Backbone PBX-123 plasmid RE digestion: 37℃ 2hours | ||
− | + | {| class="table table-striped" | |
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | pBX123 DNA (312ng/ul) || 3 | ||
+ | |- | ||
+ | | MfeI || 1 | ||
+ | |- | ||
+ | | PmeI || 1 | ||
+ | |- | ||
+ | | 10X CutSmart buffer || 5 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 40 | ||
+ | |} | ||
4. Gel running and gel extraction. | 4. Gel running and gel extraction. | ||
− | [[ | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Gel_Extraction_Kit_-_Spin_Protocol | '''E.Z.N.A.® Gel Extraction Kit - Spin Protocol''']] |
− | + | {| class="table table-striped" | |
+ | ! !! Gel Extraction concentration (ng/ul) | ||
+ | |- | ||
+ | | piezo (original) || 18.6 | ||
+ | |- | ||
+ | | pBX123 || 40.7 | ||
+ | |} | ||
5. Gibson assembly: | 5. Gibson assembly: | ||
− | + | {| class="table table-striped" | |
+ | ! !! Gibson system (20ul) !! Gibson Control system(10ul) | ||
+ | |- | ||
+ | | piezo || 4 || 0 | ||
+ | |- | ||
+ | | pBX-123 || 2 ||1 | ||
+ | |- | ||
+ | | pTRE-3G|| 0.2 || 0.1 | ||
+ | |- | ||
+ | | GpA|| 0.2 || 0.1 | ||
+ | |- | ||
+ | | Gibson mix (X2) || 10 ||5 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 3.6 || 3.8 | ||
+ | |} | ||
− | Incubate the mix for 1 hour at 50°C. ([[Team: | + | Incubate the mix for 1 hour at 50°C. ([[Team:SUSTech_Shenzhen/Notebook/Protocol#Gibson_Assembly.C2.AE_Master_Mix_.E2.80.93_Assembly_.28E2611.29 | '''Gibson Assembly® Master Mix – Assembly (E2611) Method''']]) |
6. Gibson product transformation: | 6. Gibson product transformation: | ||
− | [[|'''Transformation & Competent cell recovery'''] | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#Transformation_.26_Competent_cell_recovery | '''Transformation & Competent cell recovery'''] |
5μl gibson product + 50μl competent cells | 5μl gibson product + 50μl competent cells | ||
Line 352: | Line 433: | ||
==== Piezo plasmid construction ==== | ==== Piezo plasmid construction ==== | ||
− | # Extract the plasmids from the single colonies (1 control group and 5 PIEZO group): | + | # Extract the plasmids from the single colonies (1 control group and 5 PIEZO group): |
− | # Gel electrophoresis of the six plasmids: | + | {| class="table table-striped" |
+ | ! !! Conc. (ng/ul) | ||
+ | |- | ||
+ | | Control group || 389.6 | ||
+ | |- | ||
+ | | PIEZO group 1 || 343.5 | ||
+ | |- | ||
+ | | PIEZO group 2 || 376.3 | ||
+ | |- | ||
+ | | PIEZO group 3 || 371.6 | ||
+ | |- | ||
+ | | PIEZO group 4 || 388.5 | ||
+ | |- | ||
+ | | PIEZO group 5 || 245.2 | ||
+ | |} | ||
+ | |||
+ | # Gel electrophoresis of the six plasmids:{{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--A7EFE2A0-3C31-447D-B788-7EB09D31CF7C.png | caption= | width=300px}} | ||
Sample 2 and Sample 4 have shown positive results, which should be tested further with PCR. | Sample 2 and Sample 4 have shown positive results, which should be tested further with PCR. | ||
Line 360: | Line 457: | ||
We sorted the material and put all of them into the lowermost layer of the -20℃ fridge. | We sorted the material and put all of them into the lowermost layer of the -20℃ fridge. | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--5A009DDE-64F2-4E61-B876-6FD3D92E5378.png | caption=Restriction enzyme and buffer ↑ | width=1000px}} | |
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--9ADDA1AA-8603-4FD7-A310-B80A50F1F610.png | caption=PCR related materials ↑ | width=1000px}} | |
− | Restriction enzyme and buffer ↑ | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--E694A56E-0AC6-4BF4-AF48-89D186DEEE93.png | caption=Primer of our group ↑ | width=1000px}} |
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--B58D96EE-F2E7-4CEA-873B-A120DEDB06A6.png | caption=Plasmid construction of our group ↑ | width=1000px}} | |
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--D9D9DF83-4A59-4F9A-8429-4DE7125BE102.png | caption=Inner look of plasmid construction, left row is the final product. Right parts are materials from previous steps. ↑ | width=1000px}} | |
− | PCR related materials ↑ | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--23C1F4A7-57BC-4EE3-AFAE-5C5A921D612E.png | caption=Overall look ↑ | width=1000px}} |
− | + | ||
− | + | ||
− | Primer of our group ↑ | + | |
− | + | ||
− | + | ||
− | Plasmid construction of our group ↑ | + | |
− | + | ||
− | + | ||
− | Inner look of plasmid construction, left row is the final product. Right parts are materials from previous steps. ↑ | + | |
− | + | ||
− | + | ||
− | Overall look ↑ | + | |
− | + | ||
---- | ---- | ||
Line 387: | Line 471: | ||
# Sterilization: | # Sterilization: | ||
#: We put a bottle of ddH2O and bunch of tips and tubes for sterilization. | #: We put a bottle of ddH2O and bunch of tips and tubes for sterilization. | ||
− | #PCR test for PIEZO group 2 and PIEZO group 4: [[Team: | + | #PCR test for PIEZO group 2 and PIEZO group 4: [[Team:SUSTech_Shenzhen/Notebook/Protocol#Premix_TaqTM_.28RR902A.29 | '''Premix TaqTM (RR902A)''']] |
For each system | For each system | ||
− | + | {| class="table table-striped" | |
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | Premix Taq || 10 | ||
+ | |- | ||
+ | | Sample || 0.5 | ||
+ | |- | ||
+ | | GpA primer1|| 1 | ||
+ | |- | ||
+ | | GpA primer2 || 1 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 7.5 | ||
+ | |} | ||
Program setting: | Program setting: | ||
Line 402: | Line 498: | ||
3. Gel running: | 3. Gel running: | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--D6C99E88-58AB-4948-A865-328D22676BE8.png | caption=The result showed that GpA had linked with backbone and piezo. | width=300px}} | |
− | + | ||
− | The result showed that GpA had linked with backbone and piezo. | + | |
4. Pick up single colonies and colony PCR | 4. Pick up single colonies and colony PCR | ||
Line 410: | Line 504: | ||
As the result of gel electrophoresis of piezo Gibson group 2&4(yesterday,2016.1.24) missed bands of 4000, we picked up 20 single colonies to test by colony PCR. (use primers of GpA and PTRE). | As the result of gel electrophoresis of piezo Gibson group 2&4(yesterday,2016.1.24) missed bands of 4000, we picked up 20 single colonies to test by colony PCR. (use primers of GpA and PTRE). | ||
− | The system of colony PCR (total 20 μl): [[Team: | + | The system of colony PCR (total 20 μl): [[Team:SUSTech_Shenzhen/Notebook/Protocol#Premix_TaqTM_.28RR902A.29 | '''Premix TaqTM (RR902A)''']] |
− | + | {| class="table table-striped" | |
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | 2X Taq mix || 10 | ||
+ | |- | ||
+ | | Template || 05 | ||
+ | |- | ||
+ | | Primer1|| 1 | ||
+ | |- | ||
+ | | Primer2 || 1 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 3 | ||
+ | |} | ||
Program setting: | Program setting: | ||
Line 429: | Line 535: | ||
5. Gel electrophoresis of 40 groups after PCR colonies. | 5. Gel electrophoresis of 40 groups after PCR colonies. | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--08D1DF5D-59CE-445F-B47F-B0CB2AEE7358.png | caption= | width=1000px}} | |
− | 6.TRPC5 & TRPC6 &PBX-090 [[Team: | + | 6.TRPC5 & TRPC6 &PBX-090 [[Team:SUSTech_Shenzhen/Notebook/Protocol#Transformation_.26_Competent_cell_recovery | '''transformation''']]. |
We transformed these plasmids into competent cell and coated. After that, incubated at 37℃ for 16 hours.(5 plasmids onto 5 Amp plates) | We transformed these plasmids into competent cell and coated. After that, incubated at 37℃ for 16 hours.(5 plasmids onto 5 Amp plates) | ||
Line 445: | Line 551: | ||
After TRPC5, TRPC6 and PBX-090 transformation, we found that there are no colony growing on PBX-090 plate. Later we knew that PBX-090 is Kanamycin resistant. We pick 1 colony from other 4 plates. Add into 5ml Amp LB, shake at 37℃. | After TRPC5, TRPC6 and PBX-090 transformation, we found that there are no colony growing on PBX-090 plate. Later we knew that PBX-090 is Kanamycin resistant. We pick 1 colony from other 4 plates. Add into 5ml Amp LB, shake at 37℃. | ||
− | 2.PCR test [[Team:'''Premix TaqTM (RR902A)' | + | 2.PCR test [[Team:SUSTech_Shenzhen/Notebook/Protocol#Premix_TaqTM_.28RR902A.29 | '''Premix TaqTM (RR902A)''']] |
For yesterday PIEZO group 2 and PIEZO group 4(GPA verified): | For yesterday PIEZO group 2 and PIEZO group 4(GPA verified): | ||
− | + | {| class="table table-striped" | |
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | Premix Taq || 10 | ||
+ | |- | ||
+ | | Sample || 0.5 | ||
+ | |- | ||
+ | | GpA primer1|| 1 | ||
+ | |- | ||
+ | | GpA primer2 || 1 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 7.5 | ||
+ | |} | ||
Program setting: | Program setting: | ||
Line 463: | Line 581: | ||
For yesterday PIEZO colony PCR promoter(pTRE) group 9,11,15(pTRE verified): | For yesterday PIEZO colony PCR promoter(pTRE) group 9,11,15(pTRE verified): | ||
− | + | {| class="table table-striped" | |
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | Premix Taq || 10 | ||
+ | |- | ||
+ | | Sample || 0.5 | ||
+ | |- | ||
+ | | GpA primer1|| 1 | ||
+ | |- | ||
+ | | GpA primer2 || 1 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 7.5 | ||
+ | |} | ||
Program setting: | Program setting: | ||
Line 478: | Line 608: | ||
3.Gel running of PCR product | 3.Gel running of PCR product | ||
− | + | ||
+ | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--1EC6006A-7945-4889-A9FF-60373F6A6F07.png| caption= | width=300px}} | ||
4.Streak plate of colony PCR9&11&15 | 4.Streak plate of colony PCR9&11&15 | ||
Line 485: | Line 616: | ||
5.RE Digestion of PIEZO(original plasmid), PIEZO group 2,and PIEZO group 4 | 5.RE Digestion of PIEZO(original plasmid), PIEZO group 2,and PIEZO group 4 | ||
− | + | PIEZO Total 20μl | |
+ | {| class="table table-striped" | ||
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | 1ug PIEZO(original plasmid, conc. 576ng/ul) || 1.7 | ||
+ | |- | ||
+ | | BamHI || 0.2 | ||
+ | |- | ||
+ | | CutSmart buffer(X10)|| 2 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 16.1 | ||
+ | |} | ||
PIEZO group 2(1) Total 20μl | PIEZO group 2(1) Total 20μl | ||
− | + | {| class="table table-striped" | |
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | 1ug PIEZO group2(original plasmid, conc. 376.3ng/ul) || 2.6 | ||
+ | |- | ||
+ | | PmeI || 0.2 | ||
+ | |- | ||
+ | | CutSmart buffer(X10)|| 2 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 15.2 | ||
+ | |} | ||
PIEZO group 2(2) Total 20μl | PIEZO group 2(2) Total 20μl | ||
− | + | {| class="table table-striped" | |
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | 1ug PIEZO group2(original plasmid, conc. 376.3ng/ul) || 2.6 | ||
+ | |- | ||
+ | | PmeI || 0.2 | ||
+ | |- | ||
+ | | BamHI || 0.2 | ||
+ | |- | ||
+ | | CutSmart buffer(X10)|| 2 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 15 | ||
+ | |} | ||
PIEZO group 4(1) Total 20μl | PIEZO group 4(1) Total 20μl | ||
− | + | {| class="table table-striped" | |
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | 1ug PIEZO group4(original plasmid, conc. 388.5ng/ul) || 2.6 | ||
+ | |- | ||
+ | | PmeI || 0.2 | ||
+ | |- | ||
+ | | CutSmart buffer(X10)|| 2 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 15.2 | ||
+ | |} | ||
PIEZO group 4(2) Total 20μl | PIEZO group 4(2) Total 20μl | ||
− | + | {| class="table table-striped" | |
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | 1ug PIEZO group2(original plasmid, conc. 388.5ng/ul) || 2.6 | ||
+ | |- | ||
+ | | PmeI || 0.2 | ||
+ | |- | ||
+ | | BamHI || 0.2 | ||
+ | |- | ||
+ | | CutSmart buffer(X10)|| 2 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 15 | ||
+ | |} | ||
Gel running results: | Gel running results: | ||
− | + | ||
+ | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--745D7648-D433-4834-9361-CE69D21D2543.png| caption= | width=300px}} | ||
Since the results out to be blurred, we decide to run gel again tomorrow. | Since the results out to be blurred, we decide to run gel again tomorrow. | ||
Line 510: | Line 697: | ||
==== Piezo plasmid construction ==== | ==== Piezo plasmid construction ==== | ||
− | 1.Plasmid purification [[Team: | + | 1.Plasmid purification [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Plasmid_DNA_Mini_Kit_I_Protocol_-_Spin_Protocol | '''E.Z.N.A.® Plasmid DNA Mini Kit I Protocol - Spin Protocol''']] |
Plasmid purification of TRPC5 and TRPC6 from the single colonies we picked yesterday | Plasmid purification of TRPC5 and TRPC6 from the single colonies we picked yesterday | ||
The concentration of the plasmids: | The concentration of the plasmids: | ||
− | + | {| class="table table-striped" | |
− | + | ! !! Conc. (ng/ul) | |
− | + | |- | |
− | + | | TRPC5 IRES-GFP || 461.9 | |
+ | |- | ||
+ | | TRPC5 IRES-GFP || 425.1 | ||
+ | |- | ||
+ | | TRPC5 IRES-GFP || 542.7 | ||
+ | |- | ||
+ | | TRPC5 IRES-GFP|| 866.8 | ||
+ | |} | ||
− | ''Something must have been wrong!'' | + | 2.Gel electrophoresis of Restriction Enzyme Digestion product:{{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--FE7F4D31-A59D-401B-85BC-2A2C4130881B.png | caption=''Something must have been wrong!'' | width=300px}} |
3.Pick single colonies | 3.Pick single colonies | ||
After we strake plate of colony PCR9&11&15, we pick 1 colony from each plate. Add into 5ml Amp LB, shake at 37℃. | After we strake plate of colony PCR9&11&15, we pick 1 colony from each plate. Add into 5ml Amp LB, shake at 37℃. | ||
− | 4. TRPC5 T5-GFP PCR [[Team: | + | 4. TRPC5 T5-GFP PCR [[Team:SUSTech_Shenzhen/Notebook/Protocol#Q5.C2.AE_High-Fidelity_2X_Master_Mix.28M0492S.29 | '''Q5® High-Fidelity 2X Master Mix(M0492S)''']] |
− | + | ||
+ | {| class="table table-striped" | ||
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | Q5 premix || 10 | ||
+ | |- | ||
+ | | Primer1 || 1 | ||
+ | |- | ||
+ | | Primer2 || 1 | ||
+ | |- | ||
+ | | TRPC5 T5-GFP|| 0.8 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 7.2 | ||
+ | |- | ||
+ | | Total || 20 | ||
+ | |} | ||
We make 2 groups of 50μL PCR solution. | We make 2 groups of 50μL PCR solution. | ||
− | 5. PCR purification [[Team: | + | 5. PCR purification [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Cycle_Pure_Kit_-_Centrifugation_Protocol | '''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol''']] |
Accidentally make the centrifuge in step 8 30 seconds rather than 1 minute | Accidentally make the centrifuge in step 8 30 seconds rather than 1 minute | ||
Line 542: | Line 751: | ||
Group2: 31.6ng/μL | Group2: 31.6ng/μL | ||
− | 6. TRPC5 T5-GFP PCR(2nd) [[Team: | + | 6. TRPC5 T5-GFP PCR(2nd) [[Team:SUSTech_Shenzhen/Notebook/Protocol#Q5.C2.AE_High-Fidelity_2X_Master_Mix.28M0492S.29 | '''Q5® High-Fidelity 2X Master Mix(M0492S)''']] |
Because the DNA concentration in the last step was too low to conduct the following experiment, we did the TRPC5 T5-GFP PCR for the second time. | Because the DNA concentration in the last step was too low to conduct the following experiment, we did the TRPC5 T5-GFP PCR for the second time. | ||
− | + | {| class="table table-striped" | |
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | Q5 premix || 25 | ||
+ | |- | ||
+ | | Primer1 || 2.5 | ||
+ | |- | ||
+ | | Primer2 || 2.5 | ||
+ | |- | ||
+ | | TRPC5 T5-GFP|| 3 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 17 | ||
+ | |- | ||
+ | | Total || 50 | ||
+ | |} | ||
We make 5 groups of 50μL PCR solution, and run 40 cycles. | We make 5 groups of 50μL PCR solution, and run 40 cycles. | ||
Line 561: | Line 784: | ||
Use 50μL ddH2O to elute DNA in the last process. | Use 50μL ddH2O to elute DNA in the last process. | ||
− | [[Team: | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Plasmid_DNA_Mini_Kit_I_Protocol_-_Spin_Protocol | '''E.Z.N.A.® Plasmid DNA Mini Kit I Protocol - Spin Protocol''']] |
The concentration of the plasmids: | The concentration of the plasmids: | ||
Line 575: | Line 798: | ||
Mix 500μL bacterial liquid with 500μL (volume fraction:50%)glycerol, and then shore at -80℃. | Mix 500μL bacterial liquid with 500μL (volume fraction:50%)glycerol, and then shore at -80℃. | ||
− | 2. PCR purification [[Team: | + | 2. PCR purification [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Cycle_Pure_Kit_-_Centrifugation_Protocol | '''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol''']] |
PCR purification of TPRC5 T5-GFP(2nd) | PCR purification of TPRC5 T5-GFP(2nd) | ||
Line 597: | Line 820: | ||
a. PCR the supernatant by the primers of mycoplasma DNA. | a. PCR the supernatant by the primers of mycoplasma DNA. | ||
− | The system of PCR (total 50μL): [[Team: | + | The system of PCR (total 50μL): [[Team:SUSTech_Shenzhen/Notebook/Protocol#Q5.C2.AE_High-Fidelity_2X_Master_Mix.28M0492S.29 | '''Q5® High-Fidelity 2X Master Mix(M0492S''']] |
− | + | {| class="table table-striped" | |
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | Q5 hot start || 25 | ||
+ | |- | ||
+ | | Primer1 || 2.5 | ||
+ | |- | ||
+ | | Primer2 || 2.5 | ||
+ | |- | ||
+ | | DNA|| 3 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 17 | ||
+ | |} | ||
Program setting: | Program setting: | ||
Line 619: | Line 854: | ||
b. Gel electrophoresis of PCR product. | b. Gel electrophoresis of PCR product. | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--17AA552A-D996-4D41-8622-ECD433966EA1.png | caption= | width=300px}} | |
Obviously, positive control turns out to be positive result, while negative control and the samples are negative results, so that our freezing cells are not polluted and we can store them into liquid nitrogen (big liquid nitrogen cell storage tank 3-4). | Obviously, positive control turns out to be positive result, while negative control and the samples are negative results, so that our freezing cells are not polluted and we can store them into liquid nitrogen (big liquid nitrogen cell storage tank 3-4). | ||
4.Restriction Enzyme Digestion(A) | 4.Restriction Enzyme Digestion(A) | ||
− | + | {|class="table table-striped" | |
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | DNA (~50ng/uL)(actually, we use group 1&2 from step 2. today) || 80 | ||
+ | |- | ||
+ | | Age I-HF || 1 | ||
+ | |- | ||
+ | | 10X CutSmart buffer || 9 | ||
+ | |} | ||
'''Digest the ends of TRPC5 for ligation.''' | '''Digest the ends of TRPC5 for ligation.''' | ||
Line 643: | Line 886: | ||
The system (total 20μL): | The system (total 20μL): | ||
− | + | {| class="table table-striped" | |
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | DNA(~50ng/ul) || 1 | ||
+ | |- | ||
+ | | Bam HI-HF || 10.2 | ||
+ | |- | ||
+ | | 10X CutSmart buffer || 2 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 16.8 | ||
+ | |} | ||
Incubate at 37℃ for two hours. | Incubate at 37℃ for two hours. | ||
5. Gel electrophoresis of the digestion of plasmid purification product of colonies PCR 9&11&15 | 5. Gel electrophoresis of the digestion of plasmid purification product of colonies PCR 9&11&15 | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--006E645A-42B4-4F76-BC16-8760890BD87F.png | caption= | width=300px}} | |
As we digest the plasmid with only one enzyme, we only get linear 15k bp DNA. | As we digest the plasmid with only one enzyme, we only get linear 15k bp DNA. | ||
Line 674: | Line 927: | ||
7. Restriction Enzyme Digestion purification | 7. Restriction Enzyme Digestion purification | ||
− | [[Team: | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Cycle_Pure_Kit_-_Centrifugation_Protocol | '''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol''']] |
Use 30μL ddH<sub>2</sub>O to elute DNA in the last process. | Use 30μL ddH<sub>2</sub>O to elute DNA in the last process. | ||
Line 682: | Line 935: | ||
TRPC5 T5-GFP 2 71.3ng/μL | TRPC5 T5-GFP 2 71.3ng/μL | ||
− | 8. Restriction Enzyme Digestion [[Team: | + | 8. Restriction Enzyme Digestion [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Cycle_Pure_Kit_-_Centrifugation_Protocol | '''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol''']] |
We digest PBX-123 with Age I to get the sticky end which can connected with TPRC5. | We digest PBX-123 with Age I to get the sticky end which can connected with TPRC5. | ||
Line 712: | Line 965: | ||
T4 DNA ligase 1μL | T4 DNA ligase 1μL | ||
− | 10. Transformation: | + | 10. [[Team:SUSTech_Shenzhen/Notebook/Protocol#Transformation_.26_Competent_cell_recovery | '''Transformation''']]: |
We transform the plasmid which we get in the step 9. Ligation into 25μL competent cell. | We transform the plasmid which we get in the step 9. Ligation into 25μL competent cell. | ||
Line 743: | Line 996: | ||
Incubate at 50℃ for two hours. | Incubate at 50℃ for two hours. | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--9BD1E423-8A7E-48F3-B515-75DFE0EE04D2.png | caption= | width=300px}} | |
− | + | ||
The result is strange. The brightest band is larger than 10000. | The result is strange. The brightest band is larger than 10000. | ||
Line 751: | Line 1,003: | ||
Gel running of restriction enzyme digestion (PIEZO Gibson Ligation from colony PCR group 9&15, BamHI Bgl II) | Gel running of restriction enzyme digestion (PIEZO Gibson Ligation from colony PCR group 9&15, BamHI Bgl II) | ||
− | + | ||
+ | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--479328BC-5A4D-4B62-AD43-142AD03EDAF2.png | caption= | width=300px}} | ||
The undigested ones showed more bands while digested one only showed one band which is really strange. | The undigested ones showed more bands while digested one only showed one band which is really strange. | ||
Line 773: | Line 1,026: | ||
Primers: GpA primers/PTRE primers | Primers: GpA primers/PTRE primers | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--FEB10CCD-ECFD-4535-9C5C-85A9DE4DB600.png | caption= | width=300px}} | |
From the results, GpA can still be seen in ddH2O. The result is so strange. We don’t know how to explain. | From the results, GpA can still be seen in ddH2O. The result is so strange. We don’t know how to explain. | ||
Line 791: | Line 1,044: | ||
ddH2O 3μl | ddH2O 3μl | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--CD63D026-EB5F-4EE7-9B23-C95E83B86EAD.png | caption= | width=300px}} | |
The PCR results showed no correct one. We can’t see TRPC5 band. | The PCR results showed no correct one. We can’t see TRPC5 band. | ||
Line 863: | Line 1,116: | ||
2. Gel electrophoresis of PBX123(Mfe I, BamH I and Pme I for piezo), PBX123(Age I and Bcl I for TRPC5) and Piezo | 2. Gel electrophoresis of PBX123(Mfe I, BamH I and Pme I for piezo), PBX123(Age I and Bcl I for TRPC5) and Piezo | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--B5361157-B494-4866-8007-D1A31E13D7AB.png | caption= | width=300px}} | |
The PBX123(MfeI BamHI PmeI for piezo) and Piezo(digested) on the other gel was cut off for gel extraction | The PBX123(MfeI BamHI PmeI for piezo) and Piezo(digested) on the other gel was cut off for gel extraction | ||
Line 873: | Line 1,126: | ||
Piezo 28.4ng/μL | Piezo 28.4ng/μL | ||
− | 3. Plasmid extraction [[Team: | + | 3. Plasmid extraction [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Plasmid_DNA_Mini_Kit_I_Protocol_-_Spin_Protocol | '''E.Z.N.A.® Plasmid DNA Mini Kit I Protocol - Spin Protocol''']] |
Plasmid extraction from the single colonies we picked up yesterday. | Plasmid extraction from the single colonies we picked up yesterday. | ||
Line 909: | Line 1,162: | ||
5. Gel electrophoresis of the PCR products and the gel extraction products. | 5. Gel electrophoresis of the PCR products and the gel extraction products. | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--49497EEB-1D5A-4815-A31F-4A8833A01C2C.png | caption= | width=300px}} | |
Nothing, even with the positive control group from the original TRPC5 T5-GFP plasmid we got, have shown the right result (some brightness around 3000bp). | Nothing, even with the positive control group from the original TRPC5 T5-GFP plasmid we got, have shown the right result (some brightness around 3000bp). | ||
Line 915: | Line 1,168: | ||
6. Gibson assembly of Piezo and PBX123 | 6. Gibson assembly of Piezo and PBX123 | ||
− | ''Gibson Assembly® Master Mix – Assembly (E2611)'' | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#Gibson_Assembly.C2.AE_Master_Mix_.E2.80.93_Assembly_.28E2611.29 | '''Gibson Assembly® Master Mix – Assembly (E2611)''']] |
− | + | {| class="table table-striped" | |
+ | ! !! Gibson group (10ul) !! Control group1 (10ul) !! Control group2 (10ul) !! Control group3 (10ul) | ||
+ | |- | ||
+ | |Piezo (28.4ng/ul)|| || || 2.5ul | ||
+ | |- | ||
+ | | pBX-123 (40.8ng/ul) || 1.5ul || 1.5ul || 1.5ul || 1.5ul | ||
+ | |- | ||
+ | | pTRE-3G (102.5ng/ul) || 0.13ul || 0.13ul || || | ||
+ | |- | ||
+ | | GpA (122.7ng/ul) || 0.11ul || 0.11ul || || | ||
+ | |- | ||
+ | | Gibson mix || 5ul || 5ul || 2.5ul || 5ul | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 0.76ul || 3.26ul || 1ul || 1ul | ||
+ | |} | ||
7. Enzyme digestion of PBX123(Age I and Bcl I for TRPC5)(2nd) | 7. Enzyme digestion of PBX123(Age I and Bcl I for TRPC5)(2nd) | ||
Line 955: | Line 1,222: | ||
==== Piezo plasmid construction ==== | ==== Piezo plasmid construction ==== | ||
− | # Gel electrophoresis of digested PBX123(Age I and Bcl I for TRPC5)(2nd) | + | # Gel electrophoresis of digested PBX123(Age I and Bcl I for TRPC5)(2nd){{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--7576C126-8FF8-4B8E-9CA5-A7602B948653.png| caption= | width=300px}} |
# Colony PCR | # Colony PCR | ||
Line 993: | Line 1,260: | ||
3. Gel electrophoresis of colony PCR (step 2.) | 3. Gel electrophoresis of colony PCR (step 2.) | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--9E239877-516E-49B0-99A9-49A83E6B1E69.png | caption= | width=1000px}} | |
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--3AB9F15F-FC9F-4691-918B-264C87B3BEEF.png | caption= | width=1000px}} | |
− | + | ||
− | + | ||
Obviously, every Gibson group are negative. | Obviously, every Gibson group are negative. | ||
Line 1,048: | Line 1,313: | ||
5. Gel electrophoresis of PBX133 digested by Bcl I(after incubating for 1 hour) (step 4.) | 5. Gel electrophoresis of PBX133 digested by Bcl I(after incubating for 1 hour) (step 4.) | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--01A475D3-69F5-4D44-AA85-8E6DAAE633F2.png | caption= | width=300px}} | |
+ | |||
+ | From the result we can ensure our enzyme is available. | ||
---- | ---- | ||
Line 1,060: | Line 1,327: | ||
1. Gel running of 4 enzymes digestion | 1. Gel running of 4 enzymes digestion | ||
− | + | {{SUSTech_Image_Center_10 | filename=T--SUSTech_Shenzhen--2BB482CC-E29E-45C2-8631-B693AD77846C.png | caption= | width=1000px}} | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
Digestion sites: Bcl I,Age I,Nhe I,Xba I | Digestion sites: Bcl I,Age I,Nhe I,Xba I | ||
− | 2. Gel Extraction ''E.Z.N.A.® Gel Extraction Kit - Spin Protocol'' | + | 2. Gel Extraction '''E.Z.N.A.® Gel Extraction Kit - Spin Protocol''' |
We use the rest digested product to do gel extraction of cut PBX133(After 4 enzymes digested) Concentration:39.7 ng/μl | We use the rest digested product to do gel extraction of cut PBX133(After 4 enzymes digested) Concentration:39.7 ng/μl | ||
Line 1,076: | Line 1,337: | ||
3. '''Transformation''' of enzyme digested products | 3. '''Transformation''' of enzyme digested products | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--71DF8976-E10F-48E0-BA91-84F5B09C4664.png | caption=2.5μl PBX133 digested by 4 enzymes, 2.5μl PBX133 digested by BclI(iGEM), 1μl PBX133 original, 2.5μl PBX133 digested by BclI(HW) with 25μl competent cells each. | width=1000px}} | |
---- | ---- | ||
Line 1,084: | Line 1,345: | ||
==== TRPC5 plasmid construction ==== | ==== TRPC5 plasmid construction ==== | ||
− | + | 1. Enzyme digestion of TRPC5(T5-GFP and IRES-GPF) | |
+ | {| class="table table-striped" | ||
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | TRPC5(~400ng/ul) || 0.5 | ||
+ | |- | ||
+ | | Not I || 0.2 | ||
+ | |- | ||
+ | | 10X CutSmart buffer || 1 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 8.3 | ||
+ | |- | ||
+ | | Total || 10 | ||
+ | |} | ||
Incubate in 37℃ for 3 hours. | Incubate in 37℃ for 3 hours. | ||
Line 1,090: | Line 1,364: | ||
2. TRPC5 PCR(T5-GFP and IRES-GPF) | 2. TRPC5 PCR(T5-GFP and IRES-GPF) | ||
− | + | {| class="table table-striped" | |
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | Template || 1 | ||
+ | |- | ||
+ | | Primer1 || 2.5 | ||
+ | |- | ||
+ | | Primer2 || 2.5 | ||
+ | |- | ||
+ | | Q5 hotstart 2X Master Mix || 25 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 19 | ||
+ | |} | ||
40 cycles | 40 cycles | ||
Line 1,099: | Line 1,385: | ||
4. Gel electrophoresis of TRPC5 | 4. Gel electrophoresis of TRPC5 | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--AEE87545-CC9C-4B03-B175-6FCEC4BDA8CF.png | caption= | width=300px}} | |
The expected brightness (~3k bp) appeared with TRPC5 T5-GFP PCR. | The expected brightness (~3k bp) appeared with TRPC5 T5-GFP PCR. | ||
Line 1,107: | Line 1,393: | ||
5. PCR purification of TRPC5 PCR products (T5-GFP and IRES-GPF) | 5. PCR purification of TRPC5 PCR products (T5-GFP and IRES-GPF) | ||
− | ''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol'' | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Cycle_Pure_Kit_-_Centrifugation_Protocol | '''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol''']] |
The concentration of the products (diluted with 40μL ddH<sub>2</sub>O): | The concentration of the products (diluted with 40μL ddH<sub>2</sub>O): | ||
Line 1,119: | Line 1,405: | ||
Since we have the expected brightness (~3k bp) appeared with TRPC5 T5-GFP PCR, we carry on with the experiment. And started the enzyme digestion. Because Bcl I only have 75% activity in CutSmart buffer. So we decided to leave it overnight. | Since we have the expected brightness (~3k bp) appeared with TRPC5 T5-GFP PCR, we carry on with the experiment. And started the enzyme digestion. Because Bcl I only have 75% activity in CutSmart buffer. So we decided to leave it overnight. | ||
− | + | {| class="table table-striped" | |
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | TRPC5 T5 GFP(~102ng/ul) || 30 | ||
+ | |- | ||
+ | | Bcl I || 2 | ||
+ | |- | ||
+ | | CutSmart || 5 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 13 | ||
+ | |- | ||
+ | | Total || 50 | ||
+ | |} | ||
Incubate in 50℃ for overnight. | Incubate in 50℃ for overnight. | ||
Line 1,137: | Line 1,435: | ||
2. Enzyme digested product purification of TRPC5 | 2. Enzyme digested product purification of TRPC5 | ||
− | ''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol'' | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Cycle_Pure_Kit_-_Centrifugation_Protocol | '''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol''']] |
The concentration of the products (diluted with 30μL ddH<sub>2</sub>O): | The concentration of the products (diluted with 30μL ddH<sub>2</sub>O): | ||
Line 1,145: | Line 1,443: | ||
3. Gel electrophoresis of used TRPC5 | 3. Gel electrophoresis of used TRPC5 | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--97B6C7E4-A016-4B5F-BA36-FC94118B7DAB.png | caption= | width=300px}} | |
As we can see, the expected brightness (~3k bp) also appeared. It means that our TRPC5 PCR purification product is no problem, while the other four T5 products which were did before all have problem. So the four can’t be used, we will go deep by using the new TRPC5 PCR purification product. | As we can see, the expected brightness (~3k bp) also appeared. It means that our TRPC5 PCR purification product is no problem, while the other four T5 products which were did before all have problem. So the four can’t be used, we will go deep by using the new TRPC5 PCR purification product. | ||
− | 4. | + | 4. Ligation of TRPC5 and PBX133 backbone [[Team:SUSTech_Shenzhen/Notebook/Protocol#T4_DNA_Ligase.28M0202.29 | '''T4 DNA Ligase(M0202)''']] |
+ | {| class="table table-striped" | ||
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | 10* T4 DNA Ligase Buffer || 2 | ||
+ | |- | ||
+ | | Vector DNA || 3 | ||
+ | |- | ||
+ | | Insert DNA || 2 | ||
+ | |- | ||
+ | | T4 DNA Ligase || 1 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 12 | ||
+ | |- | ||
+ | | Total || 20 | ||
+ | |} | ||
Gently mix and let it in room temperature for 20 minutes. | Gently mix and let it in room temperature for 20 minutes. | ||
Heat inactive at 65℃ for 10 minutes and put it in -20℃ for 4 hours. | Heat inactive at 65℃ for 10 minutes and put it in -20℃ for 4 hours. | ||
− | 5. ''Transformation'' of TRPC5 plasmid | + | 5. [[Team:SUSTech_Shenzhen/Notebook/Protocol#Transformation_.26_Competent_cell_recovery | '''Transformation''']] of TRPC5 plasmid |
− | + | {| class="table table-striped" | |
+ | ! !! Competent cells/ul !! DNA/ul | ||
+ | |- | ||
+ | | TRPC5-pBX133 Ligation 1 || 33 || 5 | ||
+ | |- | ||
+ | | TRPC5-pBX133 Ligation 2 || 33 || 5 | ||
+ | |- | ||
+ | | pBX133 backbone || 33 || 5 | ||
+ | |} | ||
Results : | Results : | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--27D7040D-E03A-4E93-A14E-E98C0D36F340.png | caption=TRPC5-PBX133 Ligation 2 | width=300px}} | |
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--850B8EAF-D34B-4769-8576-4CA054A3B672.png | caption=TRPC5-PBX133 Ligation 1 | width=300px}} | |
− | TRPC5-PBX133 Ligation 2 TRPC5-PBX133 Ligation 1 | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--D921CB4F-6729-494D-B905-39CB889C0BF5.png | caption=PBX133 backbone | width=300px}} |
− | + | ||
− | + | ||
− | + | ||
− | PBX133 backbone | + | |
The results are not so good. There are many kinds of passible reasons which we will go to confirm one by one tomorrow. | The results are not so good. There are many kinds of passible reasons which we will go to confirm one by one tomorrow. | ||
Line 1,183: | Line 1,500: | ||
'''Amp+ New plate(2016.2.16):''' | '''Amp+ New plate(2016.2.16):''' | ||
− | + | {| class="table table-striped" | |
+ | ! !! Competent cells/ul !! DNA/ul | ||
+ | |- | ||
+ | | TRPC5-pBX133 Ligation 1 || 25 || 5 | ||
+ | |- | ||
+ | | pBX133 backbone 1 || 25 || 5 | ||
+ | |- | ||
+ | | TRPC5-pBX133 Ligation 2 || 25 || 1 | ||
+ | |- | ||
+ | | pBX133 backbone 2 || 25 || 1 | ||
+ | |- | ||
+ | | Control || 25 || 0 | ||
+ | |} | ||
− | + | '''Amp+ Old plate(2016.2.14):''' | |
− | + | {| class="table table-striped" | |
+ | ! !! Competent cells/ul !! DNA/ul | ||
+ | |- | ||
+ | | pBX133 backbone 1 || 25 || 5 | ||
+ | |- | ||
+ | | TRPC5-pBX133 Ligation 2 || 25 || 1 | ||
+ | |- | ||
+ | | pBX133 backbone 2 || 25 || 1 | ||
+ | |- | ||
+ | | Control || 25 || 0 | ||
+ | |} | ||
− | + | '''Amp+ Former plate(2015):''' | |
− | + | {| class="table table-striped" | |
+ | ! !! Competent cells/ul !! DNA/ul | ||
+ | |- | ||
+ | | TRPC5-pBX133 Ligation 1 || 25 || 5 | ||
+ | |} | ||
− | + | '''K+ plate(2016.2.14):''' | |
− | + | {| class="table table-striped" | |
+ | ! !! Competent cells/ul !! DNA/ul | ||
+ | |- | ||
+ | | 090 || 25 || 5 | ||
+ | |- | ||
+ | | Control || 25 || 0 | ||
+ | |} | ||
− | + | '''Results:''' | |
− | + | '''Amp+ New plate(2016.2.16):''' | |
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--94C284F2-8FA7-408A-AB5B-22D38A6CB337.png | caption=TRPC5-PBX133 Ligation 1 | width=300px}} | |
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--E8ABC468-5003-41B9-ACED-57332F7885B5.png | caption=TRPC5-PBX133 Ligation 2 | width=300px}} | |
− | + | ||
− | + | ||
+ | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--E5051F6E-8916-4C58-9F70-90872B474BD6.png | caption=PBX133 backbone 1 | width=300px}} | ||
+ | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--032856AD-A4A9-4D16-8C6E-A7691493BD56.png | caption=PBX133 backbone 2 | width=300px}} | ||
+ | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--FAB067A4-02ED-4599-B426-0AF2CA77128D.png | caption=Control | width=300px}} | ||
'''Amp+ Old plate(2016.2.14):''' | '''Amp+ Old plate(2016.2.14):''' | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--0F349A21-8A98-4FEA-97CE-2F81CE87079D.png | caption=TRPC5-PBX133 Ligation 1 | width=300px}} | |
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--5378CD07-8995-4C75-81F5-48598827C5BA.png | caption=PBX133 backbone 1 | width=300px}} | |
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--FE6A9781-AF55-4925-AC3B-452A44B87765.png | caption=PBX133 backbone 2 | width=300px}} | |
− | TRPC5-PBX133 Ligation 1 PBX133 backbone 1 | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--E8588B5E-7D0F-4343-8D79-46E476A6D6C7.png | caption= Control | width=300px}} |
− | + | ||
− | + | ||
− | + | ||
− | PBX133 backbone 2 Control | + | |
'''Amp+ Former plate(2015):''' | '''Amp+ Former plate(2015):''' | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--9BEE3689-77DB-48A0-82A9-9EEFB8DD5B6D.png | caption=TRPC5-PBX133 Ligation 1 | width=300px}} | |
− | + | ||
− | + | ||
− | TRPC5-PBX133 Ligation 1 | + | |
'''K+ plate(2016.2.14):''' | '''K+ plate(2016.2.14):''' | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--5975BA35-0B4E-4C00-B16C-7AB110D8C8AE.png | caption=Control | width=300px}} | |
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--978A569E-1EFE-4F7F-8625-ED5CC8E39E33.png | caption=090 | width=300px}} | |
− | + | ||
− | Control 090 | + | |
Discussion: | Discussion: | ||
Line 1,253: | Line 1,594: | ||
# TRPC5 primer design | # TRPC5 primer design | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--DB6807A5-37D4-415F-96EC-DBFA0A8BFB0D.png | caption= | width=1000px}} | |
3. Make Amp<sup>+</sup> and K<sup>+</sup> LB agar plates. | 3. Make Amp<sup>+</sup> and K<sup>+</sup> LB agar plates. | ||
Line 1,299: | Line 1,640: | ||
3. Enzyme digestion of PBX-123 backbone(previous extracted PBX-123) | 3. Enzyme digestion of PBX-123 backbone(previous extracted PBX-123) | ||
− | + | 2 tubes,each 3μL | |
+ | |||
+ | {| class="table table-striped" | ||
+ | | NotI/ul || 1 | ||
+ | |- | ||
+ | | CutSmart/ul || 5 | ||
+ | |- | ||
+ | | pBX123 /ul || 3 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 41 | ||
+ | |- | ||
+ | | Total/ul || 50 | ||
+ | |} | ||
Purification of PBX-123(30μL system,2 tubes) | Purification of PBX-123(30μL system,2 tubes) | ||
Line 1,313: | Line 1,666: | ||
Klenow Fragment: 5units/μL | Klenow Fragment: 5units/μL | ||
− | ''DNA Polymerase I, Large (Klenow) Fragment(M0210S)'' | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#DNA_Polymerase_I.2C_Large_.28Klenow.29_Fragment.28M0210S.29 |'''DNA Polymerase I, Large (Klenow) Fragment(M0210S)''']] |
Protocol(combine the NEB and Chinese protocol): | Protocol(combine the NEB and Chinese protocol): | ||
− | ① | + | ① |
+ | {| class="table table-striped" | ||
+ | ! Total!! 40 !! Final | ||
+ | |- | ||
+ | | 10X NEBuffer2 || 4 || | ||
+ | |- | ||
+ | | dNTP(2.5mM) || 0.6 || 33uM | ||
+ | |- | ||
+ | | pBX123 || 27.5 || 20~30ul(0.2~8ug) | ||
+ | |- | ||
+ | | Klenow Fragment || 0.1 || 0.4~1.6ul (2~8unit) 1 unit per ugDNA | ||
+ | |- | ||
+ | | Control || 7.8 || | ||
+ | |} | ||
②Incubate 15min at 25℃ | ②Incubate 15min at 25℃ | ||
Line 1,341: | Line 1,707: | ||
Concentration:7.6ng/μL, A260/280: 1.55 | Concentration:7.6ng/μL, A260/280: 1.55 | ||
− | 2. Ligation of PBX-123 blunt end ''T4 DNA Ligase(M0202)'' | + | 2. Ligation of PBX-123 blunt end [[Team:SUSTech_Shenzhen/Notebook/Protocol#T4_DNA_Ligase.28M0202.29 | '''T4 DNA Ligase(M0202)''']] |
− | + | {| class="table table-striped" | |
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | Total || 30 | ||
+ | |- | ||
+ | | 10X Buffer || 3 | ||
+ | |- | ||
+ | | DNA || 25 | ||
+ | |- | ||
+ | | T4 DNA Ligase || 2 | ||
+ | |||
+ | |} | ||
Amplify PBX-123 backbone,transform,select single colony and shake colony(4 tubes) | Amplify PBX-123 backbone,transform,select single colony and shake colony(4 tubes) | ||
Line 1,371: | Line 1,748: | ||
|} | |} | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--FEF98DD3-6E2C-4CB1-BF3E-E6321D436A02.png | caption=Fig.1 PBX-123 0 μl | width=300px}} | |
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--17DF72BB-A227-4B12-A05A-035EC6874F00.png | caption=Fig.2 PBX-123 5 μl | width=300px}} | |
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--0953426A-6D63-4488-B067-E76BC6B1B75D.png | caption=Fig.3 PBX-123 15 μl | width=300px}} | |
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--3F45E866-355E-4215-9D63-2138D0BAD9BE.png | caption=Fig.4 PBX-123 25 μl | width=300px}} | |
− | Fig.3 PBX-123 15 μl Fig.4 PBX-123 25 μl | + | |
Discussion: | Discussion: | ||
Line 1,389: | Line 1,765: | ||
Results: only one culture dish grows 1 colony | Results: only one culture dish grows 1 colony | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--2287B7C4-E242-4B47-84E7-560015DC1645.png | caption=PBX-123 Not I-cut ligation 3 | width=300px}} | |
− | + | ||
− | PBX-123 Not I-cut ligation 3 | + | |
--- | --- | ||
Line 1,401: | Line 1,775: | ||
1. PBX123 and PBX123(NotI-cut ligation) plasmid extraction | 1. PBX123 and PBX123(NotI-cut ligation) plasmid extraction | ||
− | ''AxyPrep Plasmid Miniprep Spin Protocol'' | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#AxyPrep_Plasmid_Miniprep_Spin_Protocol | '''AxyPrep Plasmid Miniprep Spin Protocol''']] |
Final volume: 70 ul each tube | Final volume: 70 ul each tube | ||
− | + | {| class="table table-striped" | |
+ | | PBX-123 NotI-cut || 249.3ng/ul | ||
+ | |- | ||
+ | | PBX-123 plasmid1 || 299.1ng/ul | ||
+ | |- | ||
+ | | PBX-123 plasmid2 || 213.6ng/ul | ||
+ | |- | ||
+ | | PBX-123 plasmid3 || 252.9ng/ul | ||
+ | |- | ||
+ | | PBX-123 plasmid4 || 360.3ng/ul | ||
+ | |} | ||
2. Breed preservation : | 2. Breed preservation : | ||
Line 1,411: | Line 1,795: | ||
500ul bacterial : 500ul glycerol each tube | 500ul bacterial : 500ul glycerol each tube | ||
− | + | {| class="table table-striped" | |
+ | | PBX-123 NotI-cut || 1 ml || -8℃ 107 | ||
+ | |- | ||
+ | | PBX-123 plasmid1 || 1 ml || -8℃ 107 | ||
+ | |- | ||
+ | | PBX-123 plasmid2 || 1 ml || -8℃ 107 | ||
+ | |- | ||
+ | | PBX-123 plasmid3 || 1 ml || -8℃ 107 | ||
+ | |- | ||
+ | | PBX-123 plasmid4 || 1 ml || -8℃ 107 | ||
+ | |} | ||
3. NotI digest and transform (2 tubes) | 3. NotI digest and transform (2 tubes) | ||
− | + | {| class="table table-striped" | |
+ | |NotI/ul || 1 | ||
+ | |- | ||
+ | | CutSmart/ul || 5 | ||
+ | |- | ||
+ | | pBX-123/ul || 3 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>0/ul || 41 | ||
+ | |- | ||
+ | | Total/ul || 50 | ||
+ | |||
+ | |} | ||
Purification: 40 ul system | Purification: 40 ul system | ||
Line 1,427: | Line 1,832: | ||
NotI digest: 2 tubes | NotI digest: 2 tubes | ||
− | + | {| class="table table-striped" | |
+ | |NotI/ul || 1 | ||
+ | |- | ||
+ | | CutSmart/ul || 5 | ||
+ | |- | ||
+ | | pBX-123/ul || 3 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>0/ul || 41 | ||
+ | |- | ||
+ | | Total/ul || 50 | ||
+ | |||
+ | |} | ||
Purification: 30 ul system each | Purification: 30 ul system each | ||
Line 1,454: | Line 1,870: | ||
and extract plasmid from those colonies which are confirmed to be right. | and extract plasmid from those colonies which are confirmed to be right. | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--2FEB8E64-EC56-4C2F-8764-8DA6F6372C49.png | caption=PBX-123 Not I cut 2.20 ① | width=300px}} | |
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--7C3235ED-3E7F-4810-AE5F-588F160E9FC0.png | caption= PBX-123 Not I cut 2.20 ② | width=300px}} | |
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--B8762C5F-65CD-443F-AC0D-9F388570C70C.png | caption=PBX-123 Not I cut 2.20 ③ | width=300px}} | |
− | + | ||
− | PBX-123 Not I cut 2.20 ① PBX-123 Not I cut 2.20 ② | + | |
− | + | ||
− | + | ||
− | + | ||
− | PBX-123 Not I cut 2.20 ③ | + | |
---- | ---- | ||
Line 1,472: | Line 1,882: | ||
1.Enzyme double digestion of HindIII-HF,Not I-HF. 37 ℃, 3hrs | 1.Enzyme double digestion of HindIII-HF,Not I-HF. 37 ℃, 3hrs | ||
− | + | {| class="table table-striped" | |
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | pBX-123 Not I-cut plasmid(~249ng/ul) || 4 | ||
+ | |- | ||
+ | | CutSmart buffer(10X) || 5 | ||
+ | |- | ||
+ | | HindIII-HF || 1 | ||
+ | |- | ||
+ | | NotI-HF || 1 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 39 | ||
+ | |} | ||
− | + | {| class="table table-striped" | |
− | + | ! !! Volume/ul | |
− | + | |- | |
+ | | pBX-123 Not I-cut plasmid(~252ng/ul) || 4 | ||
+ | |- | ||
+ | | CutSmart buffer(10X) || 5 | ||
+ | |- | ||
+ | | HindIII-HF || 1 | ||
+ | |- | ||
+ | | NotI-HF || 1 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 39 | ||
+ | |} | ||
+ | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--3D51AB03-58B6-4093-83A4-370EE7A8C1E7.png | caption=Fig.1 PBX-123 plasmid pattern | width=300px}} | ||
2.Gel running, proof: | 2.Gel running, proof: | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--C271F777-9E8F-40CC-B473-B0A1671DB2FB.png | caption=This shows we have successfully delete the Not-I RE site. | width=300px}} | |
− | + | ||
=== 24 <sup>th</sup> === | === 24 <sup>th</sup> === | ||
Line 1,492: | Line 1,924: | ||
Only 23μL DNA left inside the tube. | Only 23μL DNA left inside the tube. | ||
− | + | {| class="table table-striped" | |
+ | ! !! Volume/ul | ||
+ | |- | ||
+ | | DNA || 23 | ||
+ | |- | ||
+ | | CutSmart buffer(10X) || 5 | ||
+ | |- | ||
+ | | BclI || 1 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 39 | ||
+ | |- | ||
+ | | Total || 50 | ||
+ | |} | ||
− | 2. ''Transformation'': | + | 2. [[Team:SUSTech_Shenzhen/Notebook/Protocol#Transformation_.26_Competent_cell_recovery | '''Transformation''']]: |
We transform PBX133 PBX090 and Piezo to propagate them for further use. | We transform PBX133 PBX090 and Piezo to propagate them for further use. | ||
Line 1,513: | Line 1,957: | ||
'''Restriction Enzyme Digestion for Verification''' | '''Restriction Enzyme Digestion for Verification''' | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--9AE8E50F-6A5C-4732-AB8D-D3BF7FAF53BF.png | caption= | width=1000px}} | |
− | + | ||
− | + | ||
'''Gel Extraction''' | '''Gel Extraction''' | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--84DDD83D-126A-4897-A4BB-C72B50FD2085.png | caption= | width=1000px}} | |
− | + | ||
− | + | ||
'''Sequencing Result''': | '''Sequencing Result''': | ||
Line 1,528: | Line 1,968: | ||
'''06.15~06.30 Restriction Enzyme,Ligase and Transformation Efficiency Test sfgfp PCR and Gel Extraction''' | '''06.15~06.30 Restriction Enzyme,Ligase and Transformation Efficiency Test sfgfp PCR and Gel Extraction''' | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--D7E96985-2A7C-4A01-874F-F1A6B81D169D.png | caption= | width=1000px}} | |
− | + | ||
'''Transformation Result''' | '''Transformation Result''' | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--D47F3B97-857F-4FA0-A5B4-669F7B034984.png | caption= | width=300px}} | |
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--E695F544-5457-40DD-B9BB-D717A9C4518D.png | caption= | width=300px}} | |
− | + | ||
== July == | == July == | ||
Line 1,542: | Line 1,980: | ||
Transformation efficiency (3 groups) | Transformation efficiency (3 groups) | ||
− | + | {| class="table table-striped" | |
+ | ! Competent cell/ul !! sfGFP plasmid/ng !! sfGFP plasmid/ul | ||
+ | |- | ||
+ | | 33 || 45.88 || 0.3 | ||
+ | |} | ||
Enzyme digestion efficiency (3 groups) | Enzyme digestion efficiency (3 groups) | ||
− | + | {| class="table table-striped" | |
+ | ! Competent cell/ul !! sfGFP digested/ng !! sfGFP digested/ul | ||
+ | |- | ||
+ | | 33 || 45.88 || 1.9 | ||
+ | |} | ||
1>Prepare digestion system: | 1>Prepare digestion system: | ||
− | + | {| class="table table-striped" | |
+ | ! !! Amount/ ul | ||
+ | |- | ||
+ | | DNA || 2.4 | ||
+ | |- | ||
+ | | AflII || 1 | ||
+ | |- | ||
+ | | EcoRI || 1 | ||
+ | |- | ||
+ | | CutSmart(NEB) || 2.5 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 18.1 | ||
+ | |- | ||
+ | | Total || 25 | ||
+ | |} | ||
Incubate at 37℃,6hrs. | Incubate at 37℃,6hrs. | ||
Line 1,556: | Line 2,016: | ||
Ligation efficiency (3 groups) | Ligation efficiency (3 groups) | ||
− | + | {| class="table table-striped" | |
+ | ! Competent cell/ul !! sfGFP plasmid ligated/ng !! sfGFP plasmid ligated/ul | ||
+ | |- | ||
+ | | 33 || 41.67 || 3.3 | ||
+ | |} | ||
− | 1> Prepare ligation system ''T4 DNA Ligase(M0202)'' | + | 1> Prepare ligation system [[Team:SUSTech_Shenzhen/Notebook/Protocol#T4_DNA_Ligase.28M0202.29 | '''T4 DNA Ligase(M0202)''']] |
− | + | {| class="table table-striped" | |
+ | | Vector || 0.02pmol | ||
+ | |- | ||
+ | | Insert || 0.08pmol | ||
+ | |- | ||
+ | | T4 ligase || 1ul | ||
+ | |- | ||
+ | | T4 ligase buffer 10X || 2ul | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || to 20ul | ||
+ | |- | ||
+ | | Total || 20ul | ||
+ | |} | ||
Incubate at room temperature for 20mins | Incubate at room temperature for 20mins | ||
− | ''Transformation & Competent cell recovery'' | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#Transformation_.26_Competent_cell_recovery | '''Transformation & Competent cell recovery''']] |
1. Get competent cell (DH5α) from -80℃,lay on ice for 15mins till melted. | 1. Get competent cell (DH5α) from -80℃,lay on ice for 15mins till melted. | ||
Line 1,593: | Line 2,069: | ||
'''Efficiency tests results:''' | '''Efficiency tests results:''' | ||
− | + | {| class="table table-striped" | |
+ | ! !! Green colony number!! Non-green colony number | ||
+ | |- | ||
+ | | Transformation 1|| >1000 ||24 | ||
+ | |- | ||
+ | | Transformation 2|| >1000 ||32 | ||
+ | |- | ||
+ | | Transformation 3|| >1000 ||21 | ||
+ | |- | ||
+ | | Digestion1 || 0 ||382 | ||
+ | |- | ||
+ | | Digestion2 || 1 ||370 | ||
+ | |- | ||
+ | | Digestion3 || 0 ||400 | ||
+ | |- | ||
+ | | Ligation1 || 0 || 300 | ||
+ | |- | ||
+ | | Ligation2 || 4 || 302 | ||
+ | |- | ||
+ | | Ligation3 || 0 || 267 | ||
+ | |} | ||
NOTE: | NOTE: | ||
Line 1,619: | Line 2,115: | ||
2> Polymerase Chain Reaction (PCR)system</ul> | 2> Polymerase Chain Reaction (PCR)system</ul> | ||
− | ''Q5® High-Fidelity 2X Master Mix(M0492S)'' | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#Q5.C2.AE_High-Fidelity_2X_Master_Mix.28M0492S.29 | '''Q5® High-Fidelity 2X Master Mix(M0492S)''']] |
− | + | {| class="table table-striped" | |
+ | ! !!Amount/ul | ||
+ | |- | ||
+ | | Q5 Master Mix 2X || 12.5 | ||
+ | |- | ||
+ | | Colony mixture || 10 | ||
+ | |- | ||
+ | | PrimerF || 1 | ||
+ | |- | ||
+ | | PrimerR || 1 | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || 0.5 | ||
+ | |- | ||
+ | | Total || 25ul | ||
+ | |} | ||
3> PCR setting | 3> PCR setting | ||
− | + | {| class="table table-striped" | |
+ | !STEP !!TEMP !!TIME | ||
+ | |- | ||
+ | | Initial Denaturation || 98℃ ||30s | ||
+ | |- | ||
+ | | 30 Cycles || 98℃ ||10s | ||
+ | |- | ||
+ | | 30 Cycles || 50-72℃ ||20s | ||
+ | |- | ||
+ | | 30 Cycles || 72℃ ||20s | ||
+ | |- | ||
+ | | Final Extension || 72℃ ||2mins | ||
+ | |- | ||
+ | | Hold || 10℃ || ∞ | ||
+ | |} | ||
4> Gel electrophoresis | 4> Gel electrophoresis | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--062A9E41-7810-44FF-BE94-E6732DD107C4.png | caption= }} | |
=== 03 <sup>th</sup> === | === 03 <sup>th</sup> === | ||
− | + | ==== Non-green colony test (II) ==== | |
1. Use E.Z.N.A.<sup>TM</sup> Plasmid Mini Kit(Omega D6942-02) to purified plasmids. | 1. Use E.Z.N.A.<sup>TM</sup> Plasmid Mini Kit(Omega D6942-02) to purified plasmids. | ||
− | According to '' | + | According to [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Cycle_Pure_Kit_-_Centrifugation_Protocol | '''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol''']] |
+ | |||
Test the concentration ( Eppendorf BioSpectrometer) | Test the concentration ( Eppendorf BioSpectrometer) | ||
Line 1,649: | Line 2,174: | ||
4.Double-enzyme digestion | 4.Double-enzyme digestion | ||
− | + | {| class="table table-striped" | |
+ | | Non-green plasmid || 200ng | ||
+ | |- | ||
+ | | AflII || 1ul | ||
+ | |- | ||
+ | | EcoRI || 1ul | ||
+ | |- | ||
+ | | CutSmart(NEB) || 2ul | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || to 20ul | ||
+ | |- | ||
+ | | Total || 20ul | ||
+ | |} | ||
− | |||
− | + | 5. Gel electrophoresis | |
+ | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--409CDE59-4CA1-4507-9C6A-ADABD713EBE5.png | caption= | width=1000px}} | ||
=== 04 <sup>th</sup> === | === 04 <sup>th</sup> === | ||
Line 1,662: | Line 2,199: | ||
1.Enzyme digestion | 1.Enzyme digestion | ||
− | + | {| class="table table-striped" | |
+ | | DNA || 200ng | ||
+ | |- | ||
+ | | ScaI || 1ul | ||
+ | |- | ||
+ | | CutSmart(NEB) || 2ul | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || to 10ul | ||
+ | |- | ||
+ | | Total || 10ul | ||
+ | |} | ||
+ | |||
2. Gel electrophoresis | 2. Gel electrophoresis | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--05C4C22E-8533-4C66-872E-25162BD13243.png | caption= | width=1000px}} | |
=== 06 <sup>th</sup> === | === 06 <sup>th</sup> === | ||
Line 1,672: | Line 2,220: | ||
1.Enzyme digestion | 1.Enzyme digestion | ||
− | + | {| class="table table-striped" | |
+ | | Non-green plasmid || 200ng | ||
+ | |- | ||
+ | | ScaI/XbaI/XhoI || 1ul | ||
+ | |- | ||
+ | | CutSmart(NEB) || 2ul | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || to 20ul | ||
+ | |- | ||
+ | | Total || 20ul | ||
+ | |} | ||
+ | |||
2. Gel electrophoresis | 2. Gel electrophoresis | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--1827C817-EAAD-45DF-93D3-C4FED3FFE9A2.png | caption= | width=1000px}} | |
=== 07 <sup>th</sup>-10 <sup>th</sup> === | === 07 <sup>th</sup>-10 <sup>th</sup> === | ||
Line 1,694: | Line 2,253: | ||
1. TRPC5-R plasmid enzyme digestion | 1. TRPC5-R plasmid enzyme digestion | ||
− | + | {| class="table table-striped" | |
+ | | TRPC5-R || 2ug | ||
+ | |- | ||
+ | | DraIII || 1ul | ||
+ | |- | ||
+ | | CutSmart(NEB) || 2ul | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || to 20ul | ||
+ | |- | ||
+ | | Total || 20ul | ||
+ | |} | ||
− | |||
− | + | 2. Gel electrophoresis for gel extraction | |
+ | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--8DD287FB-94BE-44AB-9651-A8C7AFBF225A.png | caption= | width=300px}} | ||
+ | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--CD235B8C-DEE0-4F6F-9904-E879C9E582AA.png | caption= | width=300px}} | ||
NOTE: Wrong length and faint bands | NOTE: Wrong length and faint bands | ||
DraIII digestion site: | DraIII digestion site: | ||
− | [[File: | + | [[File:T--SUSTech_Shenzhen--2AB6C5A1-1D24-4574-AE12-11E655388644.png | 300px | thumb | Center]] |
=== 12 <sup>th</sup> === | === 12 <sup>th</sup> === | ||
Line 1,718: | Line 2,288: | ||
2.Gel electrophoresis for gel extraction | 2.Gel electrophoresis for gel extraction | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--DA09C444-791C-467B-BBC8-DBCDE8900ED0.png | caption= | width=1000px}} | |
− | 3.Gel Extraction (According to ''Gel Extraction protocol'' ) | + | 3.Gel Extraction (According to [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Gel_Extraction_Kit_-_Spin_Protocol|'''Gel Extraction protocol''']] ) |
4.TRPC5-L plasmid re-synthesis | 4.TRPC5-L plasmid re-synthesis | ||
Line 1,730: | Line 2,300: | ||
Neoloxp PCR from pBX123 plasmid | Neoloxp PCR from pBX123 plasmid | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--3B046929-E0B4-4299-9246-FF6A6AD89624.png | caption= | width=1000px}} | |
− | ''Gel | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Gel_Extraction_Kit_-_Spin_Protocol|'''Gel Extraction protocol''']] |
− | Test product’s concentration | + | 3. Test product’s concentration |
4.Double-enzyme digestion and pBX097 plasmid enzyme digestion | 4.Double-enzyme digestion and pBX097 plasmid enzyme digestion | ||
− | + | {| class="table table-striped" | |
+ | | pBX097/neoLoxP || 3ug | ||
+ | |- | ||
+ | | MfeI || 1ul | ||
+ | |- | ||
+ | | BamHI || 1ul | ||
+ | |- | ||
+ | | CutSmart(NEB) || 5ul | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || to 50ul | ||
+ | |- | ||
+ | | Total || 50ul | ||
+ | |} | ||
+ | |||
5.Gel electrophoresis | 5.Gel electrophoresis | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--5339BC30-7CF8-4A6D-BA04-CEC8F9B2B48B.png | caption= | width=1000px}} | |
=== 16 <sup>th</sup> - 21 <sup>th</sup> === | === 16 <sup>th</sup> - 21 <sup>th</sup> === | ||
Line 1,748: | Line 2,331: | ||
'''pBX097-neoloxp construction(II) ''' | '''pBX097-neoloxp construction(II) ''' | ||
− | 1.Ligate the pBX097 and neoloxp with ''T4 DNA | + | 1.Ligate the pBX097 and neoloxp with [[Team:SUSTech_Shenzhen/Notebook/Protocol#T4_DNA_Ligase.28M0202.29 | '''T4 DNA Ligase(M0202)''']] and [[Team:SUSTech_Shenzhen/Notebook/Protocol#Quick_Ligation.E2.84.A2_Kit_.28M2200S.29|'''Quick Ligation''']] |
2.DNA ''transformation'' | 2.DNA ''transformation'' | ||
Line 1,776: | Line 2,359: | ||
Single-enzyme digestion (PvuI; BamHI) and gel electrophoresis | Single-enzyme digestion (PvuI; BamHI) and gel electrophoresis | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--A4E9F06A-E3F8-400C-8DDE-5474F3C2286A.png | caption= | width=1000px}} | |
Correct | Correct | ||
Line 1,787: | Line 2,370: | ||
3. Double-enzyme digestion ( AgeI; BamHI ) of sfGFP Overnight | 3. Double-enzyme digestion ( AgeI; BamHI ) of sfGFP Overnight | ||
− | 4.''Gel Extraction'' and ''Cycle | + | 4.[[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Gel_Extraction_Kit_-_Spin_Protocol|'''Gel Extraction protocol''']] and [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Cycle_Pure_Kit_-_Centrifugation_Protocol | '''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol''']] |
5. Ligation of sfGFP and pBX123 backbone | 5. Ligation of sfGFP and pBX123 backbone | ||
Line 1,797: | Line 2,380: | ||
8. Plasmid purification | 8. Plasmid purification | ||
− | ''E.Z.N.A.® Plasmid DNA Mini Kit I Protocol | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Plasmid_DNA_Mini_Kit_I_Protocol_-_Spin_Protocol | '''E.Z.N.A.® Plasmid DNA Mini Kit I Protocol''']] |
9. Double enzyme digestion for proof (AflII; EcoRI) | 9. Double enzyme digestion for proof (AflII; EcoRI) | ||
Line 1,803: | Line 2,386: | ||
10.Gel electrophoresis | 10.Gel electrophoresis | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--5604834E-AA0D-4E25-9B2F-0FD1F47AEF81.png | caption= | width=1000px}} | |
=== 22 <sup>th</sup> - 23 <sup>th</sup> === | === 22 <sup>th</sup> - 23 <sup>th</sup> === | ||
Line 1,809: | Line 2,392: | ||
'''pBX097-neoloxp construction(II) ''' | '''pBX097-neoloxp construction(II) ''' | ||
− | 1.Ligate the pBX097 and neoloxp with ''T4 DNA | + | 1.Ligate the pBX097 and neoloxp with [[Team:SUSTech_Shenzhen/Notebook/Protocol#T4_DNA_Ligase.28M0202.29 | '''T4 DNA Ligase(M0202)''']] |
2.DNA transformation | 2.DNA transformation | ||
Line 1,821: | Line 2,404: | ||
5.Single-enzyme digestion | 5.Single-enzyme digestion | ||
− | + | {| class="table table-striped" | |
+ | | pBX097/neoLoxP || 200ng | ||
+ | |- | ||
+ | | AflIII/ScaI || 1ul | ||
+ | |- | ||
+ | | CutSmart(NEB) || 2ul | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O || to 20ul | ||
+ | |- | ||
+ | | Total || 20ul | ||
+ | |} | ||
Incubate at 37℃, overnight. | Incubate at 37℃, overnight. | ||
Line 1,831: | Line 2,424: | ||
1.Gel electrophoresis | 1.Gel electrophoresis | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--F0DF5800-428A-4E60-96F2-748DC71E77FE.png | caption= | width=1000px}} | |
Result: pBX097-neoloxp successfully constructed. | Result: pBX097-neoloxp successfully constructed. | ||
Line 1,839: | Line 2,432: | ||
'''TRPC5-Loxp Plasmid Construction(IV)''' | '''TRPC5-Loxp Plasmid Construction(IV)''' | ||
− | 1.TRPC5-Loxp ''endofree plasmid purification.'' | + | 1.TRPC5-Loxp [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Endo-Free_Plasmid_DNA_Mini_Kit_II_Protocol_-_Spin_Protocol | '''endofree plasmid purification.''']] |
2.pBX097-neoloxp and TRPC5 sequencing | 2.pBX097-neoloxp and TRPC5 sequencing | ||
Line 1,852: | Line 2,445: | ||
'''pBX123-sfGFP Efficiency test''' | '''pBX123-sfGFP Efficiency test''' | ||
− | + | {| class="table table-striped" | |
+ | | pBX123-sfGFP Efficiency Test(AflII, EcoRI) || Transformation | ||
+ | |- | ||
+ | | pBX123-sfGFP Efficiency Test(AflII, EcoRI) || Enzyme digestion | ||
+ | |- | ||
+ | | pBX123-sfGFP Efficiency Test(AflII, EcoRI) || Ligation | ||
+ | |} | ||
+ | |||
Repeat the experiments steps mentioned in 7.1 | Repeat the experiments steps mentioned in 7.1 | ||
Line 1,860: | Line 2,460: | ||
'''pBX123-sfGFP enzymes’ digestion sites ligation ability''' | '''pBX123-sfGFP enzymes’ digestion sites ligation ability''' | ||
− | [[File: | + | [[File:T--SUSTech_Shenzhen--7D3AEAF4-EEA3-45C0-938A-11FA9BC6A569.png | 500px | thumb | Center ]] |
+ | |||
+ | {| class="table table-striped" | ||
+ | ! Groups !! Combination | ||
+ | |- | ||
+ | | 1 || AgeI+BamHI | ||
+ | |- | ||
+ | | 2 || AgeI+AflI | ||
+ | |- | ||
+ | | 3 || EcoRI+BamHI | ||
+ | |- | ||
+ | | 4 || EcoRI+AflI | ||
+ | |} | ||
1> Prepare digestion system, incubate overnight | 1> Prepare digestion system, incubate overnight | ||
− | 2> ''Gel | + | 2> [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Gel_Extraction_Kit_-_Spin_Protocol|'''Gel Extraction protocol''']] to get different fragments |
− | 3> Ligation of ''T4 DNA | + | 3> Ligation of [[Team:SUSTech_Shenzhen/Notebook/Protocol#T4_DNA_Ligase.28M0202.29 | '''T4 DNA Ligase(M0202)''']] |
4> Transformation | 4> Transformation | ||
Line 1,872: | Line 2,484: | ||
Results: | Results: | ||
− | + | {| class="table table-striped" | |
+ | ! Groups !! Colony number | ||
+ | |- | ||
+ | | AgeI+BamHI || 0 | ||
+ | |- | ||
+ | | AgeI+AflI || 0 | ||
+ | |- | ||
+ | | EcoRI+BamHI ||non-green | ||
+ | |- | ||
+ | | EcoRI+AflI || non-green | ||
+ | |} | ||
+ | |||
=== 05 <sup>th</sup> === | === 05 <sup>th</sup> === | ||
Line 1,878: | Line 2,501: | ||
'''TRPC5-loxp sequencing results:''' | '''TRPC5-loxp sequencing results:''' | ||
− | + | {| class="table table-striped" | |
+ | | TRPC5-(1) || 1 mismatch | ||
+ | |- | ||
+ | | TRPC5-(2) || Correct | ||
+ | |- | ||
+ | | TRPC5-(3) || 1 Failed | ||
+ | |- | ||
+ | | TRPC5-(4) || 1 Correct | ||
+ | |} | ||
'''pBX097-neoloxp sequencing results:''' | '''pBX097-neoloxp sequencing results:''' | ||
− | + | {| class="table table-striped" | |
+ | | 097-neoLoxP-(1) || Correct | ||
+ | |- | ||
+ | | 097-neoLoxP-(2) || Correct | ||
+ | |- | ||
+ | | 097-neoLoxP-(3) || 3 mismatches | ||
+ | |- | ||
+ | |} | ||
=== 06 <sup>th</sup> - 07 <sup>th </sup> === | === 06 <sup>th</sup> - 07 <sup>th </sup> === | ||
Line 1,888: | Line 2,526: | ||
Non-green colony PCR | Non-green colony PCR | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--985AF0ED-6C83-4388-8A9B-C583AEEF6384.png | caption= | width=1000px}} | |
=== 09 <sup>th</sup> === | === 09 <sup>th</sup> === | ||
Line 1,902: | Line 2,540: | ||
'''Change NFAT-YFP to NFAT-EGFP(II)''' | '''Change NFAT-YFP to NFAT-EGFP(II)''' | ||
− | ''Gel | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Gel_Extraction_Kit_-_Spin_Protocol|'''Gel Extraction protocol''']] for EGFP and NFAT backbone |
− | Ligation by ''T4 DNA | + | Ligation by [[Team:SUSTech_Shenzhen/Notebook/Protocol#T4_DNA_Ligase.28M0202.29 | '''T4 DNA Ligase(M0202)''']] |
Transformation | Transformation | ||
Line 1,913: | Line 2,551: | ||
# Pick single colony to culture in 15ml Amp+ LB for 16hrs | # Pick single colony to culture in 15ml Amp+ LB for 16hrs | ||
− | # ''Plasmid | + | # [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Plasmid_DNA_Mini_Kit_I_Protocol_-_Spin_Protocol | '''E.Z.N.A.® Plasmid DNA Mini Kit I Protocol''']] to get purified plasmid |
# Enzyme digestion to prove | # Enzyme digestion to prove | ||
# Send to sequencing | # Send to sequencing | ||
Line 1,921: | Line 2,559: | ||
'''TRPC5 Random mutagenesis(I)''' | '''TRPC5 Random mutagenesis(I)''' | ||
− | + | {| class="table table-striped" | |
+ | | TRPC5 Random mutagenesis|| Megaprimer PCR | ||
+ | |- | ||
+ | | TRPC5 Random mutagenesis|| Gibson | ||
+ | |- | ||
+ | | TRPC5 Random mutagenesis|| Enzyme Digestion | ||
+ | |} | ||
'''Megaprimer PCR''' | '''Megaprimer PCR''' | ||
Line 1,933: | Line 2,577: | ||
c. Set a series gradients of T5 digestion time: 0, 5, 10, 20mins | c. Set a series gradients of T5 digestion time: 0, 5, 10, 20mins | ||
− | + | {| class="table table-striped" | |
+ | !T5 exonuclease digestion time!! groups | ||
+ | |- | ||
+ | | 5 mins|| 1,2 | ||
+ | |- | ||
+ | | 10 mins|| 3,4 | ||
+ | |- | ||
+ | | 20 mins|| 5,6 | ||
+ | |} | ||
d. EDTA preparation | d. EDTA preparation | ||
Line 1,948: | Line 2,600: | ||
Note: To keep T5 exonuclease digestion time as precise as possible, according to its | Note: To keep T5 exonuclease digestion time as precise as possible, according to its | ||
protocol, we use EDTA to stop the digestion. | protocol, we use EDTA to stop the digestion. | ||
− | e. T5 digestion (according to ''T5 exonuclease protocol'') | + | e. T5 digestion (according to '''T5 exonuclease protocol''') |
− | + | {| class="table table-striped" | |
+ | | T5 exonuclease|| 3.4ul | ||
+ | |- | ||
+ | | NEB4.0 Buffer|| 5ul | ||
+ | |- | ||
+ | | TRPC5 region || 3.4ug | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O|| to 50ul | ||
+ | |- | ||
+ | | Total|| 50ul | ||
+ | |} | ||
+ | |||
f. Take group①②③for gel extraction; ④⑤⑥for cycle pure. | f. Take group①②③for gel extraction; ④⑤⑥for cycle pure. | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--1EBC3032-BC8F-4CD8-A0D5-FF87301A168F.png | caption= | width=1000px}} | |
=== 23 <sup>th</sup> === | === 23 <sup>th</sup> === | ||
Line 1,960: | Line 2,623: | ||
Primer R:TATGTTAAGTTCCCAGCCCAG | Primer R:TATGTTAAGTTCCCAGCCCAG | ||
2> Megaprimer PCR: | 2> Megaprimer PCR: | ||
− | * Use ''Q5® High-Fidelity 2X Master Mix(M0492S)'', System 50μl, Tm=65℃ | + | * Use [[Team:SUSTech_Shenzhen/Notebook/Protocol#Q5.C2.AE_High-Fidelity_2X_Master_Mix.28M0492S.29 | '''Q5® High-Fidelity 2X Master Mix(M0492S)''']], System 50μl, Tm=65℃ |
− | ** ''Cycle | + | ** [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Cycle_Pure_Kit_-_Centrifugation_Protocol | '''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol''']] to get purified PCR products. |
*** Use DpnI to digest plasmids that come from bacteria (methylated sites) | *** Use DpnI to digest plasmids that come from bacteria (methylated sites) | ||
− | + | **** Transformation of digested products. | |
+ | [[File:T--SUSTech_Shenzhen--10D5555B-2204-464C-A1A7-13F3D3B24A44.png | 500px|thumb|Center]] | ||
=== 24 <sup>th</sup> === | === 24 <sup>th</sup> === | ||
Line 1,970: | Line 2,634: | ||
primer: | primer: | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--727712A4-615F-47EB-867D-46B7A5149270.png | caption= | width=1000px}} | |
TRPC5 mutation region PCR | TRPC5 mutation region PCR | ||
Line 1,980: | Line 2,644: | ||
Result: | Result: | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--56807C5C-A842-4EFF-8BBB-45C0B076F57D.png | caption= | width=1000px}} | |
=== 25 <sup>th</sup> === | === 25 <sup>th</sup> === | ||
Line 1,988: | Line 2,652: | ||
# To find out the best annealing temperature for megaprimer. Set a series of annealing temperatures: 55, 60,65,70℃ | # To find out the best annealing temperature for megaprimer. Set a series of annealing temperatures: 55, 60,65,70℃ | ||
# Repeat PCR | # Repeat PCR | ||
− | # ''Cycle | + | # [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Cycle_Pure_Kit_-_Centrifugation_Protocol | '''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol''']] to get purified PCR products. |
# DpnI digestion | # DpnI digestion | ||
− | # ''Transformation'' | + | # [[Team:SUSTech_Shenzhen/Notebook/Protocol#Transformation_.26_Competent_cell_recovery | '''Transformation''']] |
=== 26 <sup>th</sup> === | === 26 <sup>th</sup> === | ||
Line 1,996: | Line 2,660: | ||
Megaprimer PCR results of different digestion time;PCR annealing temperatures and ratios of templet and primer: | Megaprimer PCR results of different digestion time;PCR annealing temperatures and ratios of templet and primer: | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--24F0A2F6-6F08-4ED8-BAB3-BDC87FB26626.png | caption= | width=1000px}} | |
Colony number according to different annealing temperatures and ratios of templet and primer: | Colony number according to different annealing temperatures and ratios of templet and primer: | ||
− | + | {| class="table table-striped" | |
+ | !PCR Annealing TEMP!!Primer:Template= 1:1!!Primer:Template= 1:2 | ||
+ | |- | ||
+ | | 55℃|| 125 ||44 | ||
+ | |- | ||
+ | | 60℃|| 120 ||100 | ||
+ | |- | ||
+ | | 65℃|| 116 ||58 | ||
+ | |- | ||
+ | | 70℃|| 168 ||76 | ||
+ | |} | ||
Sequencing results of T5 exonuclease digestion level according to time: | Sequencing results of T5 exonuclease digestion level according to time: | ||
− | + | {| class="table table-striped" | |
+ | !T5 Exonuclease digestion time!!5' end digest number/bp!!Direction | ||
+ | |- | ||
+ | | 5mins|| 48 ||Forward | ||
+ | |- | ||
+ | | 5mins|| 43 ||Reverse | ||
+ | |- | ||
+ | | 10mins|| 176 ||Forward | ||
+ | |- | ||
+ | | 10mins|| 166 ||Reverse | ||
+ | |} | ||
− | + | Repeat T5 exonuclease digestion level according to time: | |
Set series of time gradients: 0, 5, 7.5, 10mins | Set series of time gradients: 0, 5, 7.5, 10mins | ||
Line 2,013: | Line 2,697: | ||
a. T5 digestion (according to T5 exonuclease protocol) | a. T5 digestion (according to T5 exonuclease protocol) | ||
− | + | {| class="table table-striped" | |
+ | |T5 Exonuclease|| 3.4ul | ||
+ | |- | ||
+ | | NEB4.0 Buffer|| 5ul | ||
+ | |- | ||
+ | | TRPC5 region ||3.4ug | ||
+ | |- | ||
+ | | ddH<sub>2</sub>O|| to 50ul | ||
+ | |- | ||
+ | | Total|| 50ul | ||
+ | |} | ||
+ | |||
b. Take each group for Gel electrophoresis | b. Take each group for Gel electrophoresis | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--22F8F891-2C7D-4624-9BAA-32BFE8AF06D8.png | capiton= | width=1000px}} | |
c. Send each group to sequence | c. Send each group to sequence | ||
Line 2,029: | Line 2,724: | ||
Sequencing results of T5 exonuclease digestion level according to time: | Sequencing results of T5 exonuclease digestion level according to time: | ||
− | + | {| class="table table-striped" | |
+ | !T5 Exonuclease digestion time!! 5' end digest number/bp !!Direction | ||
+ | |- | ||
+ | |5mins|| 42 ||Forward | ||
+ | |- | ||
+ | |5mins|| 43 ||Reverse | ||
+ | |- | ||
+ | |7.5mins|| 104 ||Forward | ||
+ | |- | ||
+ | |7.5mins|| 96 ||Reverse | ||
+ | |- | ||
+ | |10mins|| 188 ||Forward | ||
+ | |- | ||
+ | |10mins|| 156 ||Forward | ||
+ | |} | ||
=== 29 <sup>th</sup> === | === 29 <sup>th</sup> === | ||
Line 2,037: | Line 2,746: | ||
Set 4 groups of experiments (use sfGFP plasmid): | Set 4 groups of experiments (use sfGFP plasmid): | ||
− | [[File: | + | [[File:T--SUSTech_Shenzhen--B489D0F5-56BC-41E2-AD91-0A9C19C67373.png | 500px | thumb | Center]] |
=== 30 <sup>th</sup>=== | === 30 <sup>th</sup>=== | ||
Line 2,057: | Line 2,766: | ||
2> Gel extraction to get the 640bp fragment | 2> Gel extraction to get the 640bp fragment | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--ADF91B07-37AA-46B0-88A8-8547FA1C6F48.png | caption= | width=1000px}} | |
− | 3> Use ''Gibson Assembly® Master Mix'' to get whole plasmid | + | 3> Use [[Team:SUSTech_Shenzhen/Notebook/Protocol#Gibson_Assembly.C2.AE_Master_Mix_.E2.80.93_Assembly_.28E2611.29 | '''Gibson Assembly® Master Mix''']] to get whole plasmid |
4> Transformation | 4> Transformation | ||
Line 2,067: | Line 2,776: | ||
1.Gibson assembly result: NONE colony | 1.Gibson assembly result: NONE colony | ||
− | 2.Random mutagenesis with Kit, according to ''Random mutagenesis protocol'' | + | 2.Random mutagenesis with Kit, according to [[Team:SUSTech_Shenzhen/Notebook/Protocol#GeneMorph_II_Random_Mutagenesis_Kit.28Agilent_Technologies.2CCatalog_.23200550.29 | '''Random mutagenesis protocol''']] |
== Sept. == | == Sept. == | ||
Line 2,079: | Line 2,788: | ||
1.097&NeoLoxP qPCR-1st | 1.097&NeoLoxP qPCR-1st | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--39FFB580-9D47-4532-BEFD-F1B8FC237ED7.png | caption= | width=1000px}} | |
2. qPCR Internal Positive Control | 2. qPCR Internal Positive Control | ||
− | + | ||
+ | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--31B05B7B-9422-4DBE-AC4D-133DCBA17DC5.png | caption= | width=1000px}} | ||
=== 04 <sup>th</sup> === | === 04 <sup>th</sup> === | ||
− | ==== Gibson | + | ==== [[Team:SUSTech_Shenzhen/Notebook/Protocol#Gibson_Assembly.C2.AE_Master_Mix_.E2.80.93_Assembly_.28E2611.29 | '''Gibson Assembly® Master Mix''']] ==== |
Insert : vector=2 : 3(50~100ng vector) | Insert : vector=2 : 3(50~100ng vector) | ||
− | + | {| class="table table-striped" | |
+ | !Reagent!! Volume/ul(for 20bp) !!Volume/ul(for 30bp)!!fmol | ||
+ | |- | ||
+ | |Vector|| 1 ||1||19.4 | ||
+ | |- | ||
+ | |Insert|| 8.6 ||3.1||58.2 | ||
+ | |- | ||
+ | |2X Master Mix|| 10 ||10|| | ||
+ | |- | ||
+ | |ddH<sub>2</sub>O|| 0.4 ||5.9|| | ||
+ | |- | ||
+ | |Total|| 20 ||20|| | ||
+ | |} | ||
+ | |||
'''''T5 Exonuclease Digestion''''' | '''''T5 Exonuclease Digestion''''' | ||
Line 2,096: | Line 2,819: | ||
Temperature: 50℃ | Temperature: 50℃ | ||
− | + | {| class="table table-striped" | |
+ | ! !! 20bp) !!30bp | ||
+ | |- | ||
+ | |Digestion time/min|| 40 ||60 | ||
+ | |} | ||
− | ''''' | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#Transformation_.26_Competent_cell_recovery | '''Transformation''']] '''into Competent Cells''' |
5μl product are transformed with 50ul competent cells. | 5μl product are transformed with 50ul competent cells. | ||
Line 2,104: | Line 2,831: | ||
'''Error-prone PCR(low frequency)''' | '''Error-prone PCR(low frequency)''' | ||
− | 1. Information supplied with '' | + | 1. Information supplied with [[Team:SUSTech_Shenzhen/Notebook/Protocol#GeneMorph_II_Random_Mutagenesis_Kit.28Agilent_Technologies.2CCatalog_.23200550.29 | '''Random mutagenesis protocol''']] |
(Agilent Technologies,Catalog #200550): | (Agilent Technologies,Catalog #200550): | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--F95FF47F-1338-4FFA-B8F4-0657D2DE136C.png | caption= | width=1000px}} | |
2. Primers sequence: | 2. Primers sequence: | ||
Line 2,118: | Line 2,845: | ||
Target DNA mass: 500ng,corresponding to low frequency mutation | Target DNA mass: 500ng,corresponding to low frequency mutation | ||
− | + | {| class="table table-striped" | |
+ | !Reagent!! Volume/ul | ||
+ | |- | ||
+ | |ddH<sub>2</sub>O|| 9.5 | ||
+ | |- | ||
+ | |dNTP mix|| 1 | ||
+ | |- | ||
+ | |Mutazyme II DNA polymerase|| 1 | ||
+ | |- | ||
+ | |Forward Primer|| 1 | ||
+ | |- | ||
+ | |Reverse Primer|| 1 | ||
+ | |- | ||
+ | |Template|| 31.5 | ||
+ | |- | ||
+ | |10X Mutazyme II reaction buffer|| 5 | ||
+ | |- | ||
+ | |Total|| 50 | ||
+ | |} | ||
4. Procedure | 4. Procedure | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--E43311BC-3EC4-461C-962B-FB4C43888F3E.png | caption= | width=1000px}} | |
The annealing temperature is set to be 57℃. | The annealing temperature is set to be 57℃. | ||
− | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Gel_Extraction_Kit_-_Spin_Protocol|'''Gel Extraction protocol''']] '''of ep-PCR Product''' | |
Concentration: 135ng/μl, 30μl | Concentration: 135ng/μl, 30μl | ||
Line 2,152: | Line 2,897: | ||
Concentration: 101.2ng/μl | Concentration: 101.2ng/μl | ||
− | + | {| class="table table-striped" | |
+ | !Stock Conc./ng*ul<sup>-1</sup>!! Volume/ul!!Dilute Volume/ul | ||
+ | |- | ||
+ | |c(101.2)|| 1||99 | ||
+ | |- | ||
+ | |c/100||1||99 | ||
+ | |- | ||
+ | |c/200|| 50||50 | ||
+ | |- | ||
+ | |c/400|| 50||50 | ||
+ | |- | ||
+ | |c/800|| 50||50 | ||
+ | |- | ||
+ | |c/1600|| || | ||
+ | |} | ||
4. | 4. | ||
− | + | {| class="table table-striped" | |
+ | !Reagent!! Volume/ul!!Final Conc. !!Negative Control | ||
+ | |- | ||
+ | |ddH<sub>2</sub>O|| 6.4|| ||8.4 | ||
+ | |- | ||
+ | |2XSYBR® Master Mix|| 10|| ||10 | ||
+ | |- | ||
+ | |Forward Primer|| 0.8||0.4||0.8 | ||
+ | |- | ||
+ | |Reverse Primer|| 0.8||0.4||0.8 | ||
+ | |- | ||
+ | |Template|| 2|| ||0 | ||
+ | |- | ||
+ | |Total|| 20|| ||20 | ||
+ | |} | ||
5. Procedure | 5. Procedure | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--A15D27C0-2DBE-4DB1-AEAD-AB672B043AFE.png | caption= | width=1000px}} | |
=== 05 <sup>th</sup> === | === 05 <sup>th</sup> === | ||
Line 2,172: | Line 2,945: | ||
=== 06 <sup>th</sup> === | === 06 <sup>th</sup> === | ||
− | '''TRPC5 PCR with '' | + | '''TRPC5 PCR with''' [[Team:SUSTech_Shenzhen/Notebook/Protocol#PrimeSTAR_Max_DNA_Polymerase_-_Clontech.28R045Q.29|'''PrimeStar''']] |
1.Primers sequence: | 1.Primers sequence: | ||
Line 2,182: | Line 2,955: | ||
2.Total 8 tubes of PCR reaction: | 2.Total 8 tubes of PCR reaction: | ||
− | + | {| class="table table-striped" | |
+ | !Reagent!! Volume/ul!! Final conc./uM | ||
+ | |- | ||
+ | |ddH<sub>2</sub>O|| 20.8|| | ||
+ | |- | ||
+ | |2X Premix|| 25|| | ||
+ | |- | ||
+ | |Forward Primer|| 1.5||0.3 | ||
+ | |- | ||
+ | |Reverse Primer|| 1.5||0.3 | ||
+ | |- | ||
+ | |Template|| 1.2(1ng)|| | ||
+ | |- | ||
+ | |Total|| 50|| | ||
+ | |} | ||
3. Procedure | 3. Procedure | ||
− | + | {| class="table table-striped" | |
+ | !Temperature/℃!! Duration/seconds!!Number of cycles | ||
+ | |- | ||
+ | |98||10||1 | ||
+ | |- | ||
+ | |98|| 10|| | ||
+ | |- | ||
+ | |55|| 10|| | ||
+ | |- | ||
+ | |72|| 60||32 | ||
+ | |- | ||
+ | |72|| 120||1 | ||
+ | |- | ||
+ | |10|| ∞|| | ||
+ | |} | ||
− | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Gel_Extraction_Kit_-_Spin_Protocol|'''Gel Extraction protocol''']] | |
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--A66C7316-D75B-437B-BDB0-2AA0188BE09C.png | caption= | width=1000px}} | |
Concentration: 180ng/μl, 30μl, total 4 tubes. | Concentration: 180ng/μl, 30μl, total 4 tubes. | ||
− | '''''T5 Digestion'' for 3.5 minutes and '' | + | '''''T5 Digestion'' for 3.5 minutes and''' [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Cycle_Pure_Kit_-_Centrifugation_Protocol | '''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol''']] |
Concentration: 60ng/μl, 50μl | Concentration: 60ng/μl, 50μl | ||
− | '''Mega-primer PCR with '' | + | '''Mega-primer PCR with''' [[Team:SUSTech_Shenzhen/Notebook/Protocol#KOD_DNA_Polymerase.28Merck_Millipore.40Novagen.2C_TB320.29 | '''KOD Polymerase''']] |
Template DNA: 0.1ng, | Template DNA: 0.1ng, | ||
Line 2,204: | Line 3,005: | ||
Mega-primer:Template=10000:1 | Mega-primer:Template=10000:1 | ||
− | + | {| class="table table-striped" | |
+ | !Component!! Volume/ul!!Final Conc. | ||
+ | |- | ||
+ | |10X buffer#1 for KOD DNA Polymerase|| 5||1X | ||
+ | |- | ||
+ | |dNTP (2mM each)|| 5||0.2mM(each) | ||
+ | |- | ||
+ | |MgCl<sub>2<sub>(10mM)|| 5|| 1mM | ||
+ | |- | ||
+ | |Forward Primer(5pmol/ul)|| 4|| 0.4uM | ||
+ | |- | ||
+ | |Reverse Primer(5pmol/ul)|| 4|| 0.4uM | ||
+ | |- | ||
+ | |Template|| Y|| | ||
+ | |- | ||
+ | |PCR Grade water|| X|| | ||
+ | |- | ||
+ | |KOD DNA Polymerase(2.5U/ul)|| 0.4||0.02U/ul | ||
+ | |- | ||
+ | |Total|| 50|| | ||
+ | |} | ||
Procedure: | Procedure: | ||
− | + | {| class="table table-striped" | |
+ | !Temperature/℃!! Duration/seconds!!Number of cycles | ||
+ | |- | ||
+ | |98||30||1 | ||
+ | |- | ||
+ | |98|| 20|| | ||
+ | |- | ||
+ | |60|| 20|| | ||
+ | |- | ||
+ | |72|| 180||30 | ||
+ | |- | ||
+ | |72|| 120||1 | ||
+ | |- | ||
+ | |10|| ∞|| | ||
+ | |} | ||
− | ''' | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Cycle_Pure_Kit_-_Centrifugation_Protocol | '''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol''']] '''and Gel Running''' |
Concentration: 30ng/μl, 50μl | Concentration: 30ng/μl, 50μl | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--7A7E6594-2E1F-4CA4-B1D9-1569D7F911DB.png | caption= | width=1000px}} | |
− | + | ||
− | + | ||
No 6000bp band is appeared,it’s a problem!! | No 6000bp band is appeared,it’s a problem!! | ||
'''DpnI Digestion for 1 hour''' | '''DpnI Digestion for 1 hour''' | ||
− | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#Transformation_.26_Competent_cell_recovery | '''Transformation''']] | |
5μl product are transformed with 100ul competent cells. | 5μl product are transformed with 100ul competent cells. | ||
Line 2,228: | Line 3,061: | ||
Instrument: Bio-Rad | Instrument: Bio-Rad | ||
− | ''Kit: TaKaRa-One Step SYBR PrimeScript RT-PCR Kit I'' | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#Power_SYBR.C2.AE_Green_PCR_Master_Mix_Kit.28life_technologies.2C4368708.29 | '''Kit: TaKaRa-One Step SYBR PrimeScript RT-PCR Kit I''']] |
1. Sample: | 1. Sample: | ||
Line 2,246: | Line 3,079: | ||
Concentration: 101.2ng/μl | Concentration: 101.2ng/μl | ||
− | + | {| class="table table-striped" | |
+ | !Stock Conc./ng*ul<sup>-1</sup>!! Volume/ul!!Dilute Volume/ul | ||
+ | |- | ||
+ | |c(101.2)|| 1||99 | ||
+ | |- | ||
+ | |c/100|| 1||99 | ||
+ | |- | ||
+ | |c/10000|| 2||18 | ||
+ | |- | ||
+ | |c/100000|| 2||18 | ||
+ | |- | ||
+ | |c/1000000|| 2||18 | ||
+ | |- | ||
+ | |c/10000000|| 2||18 | ||
+ | |} | ||
4. | 4. | ||
− | + | {| class="table table-striped" | |
+ | !Reagent!! Volume/ul!!Final Conc. !!Negative Control | ||
+ | |- | ||
+ | |ddH<sub>2</sub>O|| 6.4|| ||8.4 | ||
+ | |- | ||
+ | |2XSYBR® Master Mix|| 10|| ||10 | ||
+ | |- | ||
+ | |Forward Primer|| 0.8||0.4||0.8 | ||
+ | |- | ||
+ | |Reverse Primer|| 0.8||0.4||0.8 | ||
+ | |- | ||
+ | |Template|| 2|| ||0 | ||
+ | |- | ||
+ | |Total|| 20|| ||20 | ||
+ | |} | ||
Wrong: Forget to add ‘PrimeScript Enzyme Mix’ which contains ‘Taq enzyme’,thus no PCR reaction works. | Wrong: Forget to add ‘PrimeScript Enzyme Mix’ which contains ‘Taq enzyme’,thus no PCR reaction works. | ||
Line 2,256: | Line 3,117: | ||
5. Procedure | 5. Procedure | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--3323D013-B56F-429C-ADBB-38AD7C3EA412.png | caption= | width=1000px}} | |
=== 07 <sup>th</sup> === | === 07 <sup>th</sup> === | ||
Line 2,272: | Line 3,133: | ||
Mega-primer:Template=10000:1 | Mega-primer:Template=10000:1 | ||
− | + | ||
+ | {| class="table table-striped" | ||
+ | ! !! Volume/ul!! Volume/ul | ||
+ | |- | ||
+ | !Reagent!! No T5 Digestion!! T5 digestion for 3.5min | ||
+ | - | ||
+ | |ddH<sub>2</sub>O|| 18.4||17.1 | ||
+ | |- | ||
+ | |2X Q5 mix|| 25||25 | ||
+ | |- | ||
+ | |Mega Primer|| 0.6||1.9 | ||
+ | |- | ||
+ | |Template|| 6(0.1ng)||6 | ||
+ | |- | ||
+ | |Total|| 50||50 | ||
+ | |} | ||
2. Procedure | 2. Procedure | ||
− | + | {| class="table table-striped" | |
+ | !Temperature/℃!! Duration/seconds!!Number of cycles | ||
+ | |- | ||
+ | |98||30||1 | ||
+ | |- | ||
+ | |98|| 10|| | ||
+ | |- | ||
+ | |60|| 30|| | ||
+ | |- | ||
+ | |72|| 300||35 | ||
+ | |- | ||
+ | |72|| 120||1 | ||
+ | |- | ||
+ | |4|| ∞|| | ||
+ | |} | ||
'''qPCR Primer Test with ''Premix'' and Gel Running''' | '''qPCR Primer Test with ''Premix'' and Gel Running''' | ||
− | + | 1. Gel concentration: 2%(to better show the needed band) | |
− | + | 2. | |
+ | {| class="table table-striped" | ||
+ | !Reagent!! Volume/ul!!Mass/ng | ||
+ | |- | ||
+ | |ddH<sub>2</sub>O|| X|| | ||
+ | |- | ||
+ | |2X Premix|| 12.5|| | ||
+ | |- | ||
+ | |Forward Primer|| 0.5|| | ||
+ | |- | ||
+ | |Reverse Primer|| 0.5|| | ||
+ | |- | ||
+ | |Template|| Y|| ||1ng for plasmid,640ng for gDNA | ||
+ | |- | ||
+ | |Total|| 25|| | ||
+ | |} | ||
− | Procedure | + | 3. Procedure |
− | + | {| class="table table-striped" | |
+ | !Temperature/℃!! Duration/seconds!!Number of cycles | ||
+ | |- | ||
+ | |98||60||1 | ||
+ | |- | ||
+ | |98|| 20|| | ||
+ | |- | ||
+ | |60|| 30|| | ||
+ | |- | ||
+ | |72|| 20||30 | ||
+ | |- | ||
+ | |72|| 120||1 | ||
+ | |- | ||
+ | |10|| ∞|| | ||
+ | |} | ||
4. Results | 4. Results | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--4F4C12DC-836D-446E-B845-A530622F1008.png | caption= | width=1000px}} | |
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--897B7029-9550-4BCB-8C19-95F0FE8AAC0F.png | caption= | width=1000px}} | |
− | + | ||
− | + | ||
The gel running results show that primer 1~4 and primer GAPDH has been contaminated,we need to use new primer and be care of experiment operation. | The gel running results show that primer 1~4 and primer GAPDH has been contaminated,we need to use new primer and be care of experiment operation. | ||
Line 2,300: | Line 3,217: | ||
'''Gel Running with 30μl mega-primer PCR product''' | '''Gel Running with 30μl mega-primer PCR product''' | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--432CFFD0-845A-4791-AD97-B5A0257189DD.png | caption= | width=1000px}} | |
There is a band at around 6000bp position! | There is a band at around 6000bp position! | ||
Line 2,306: | Line 3,223: | ||
'''DpnI Digestion for 1 hour''' | '''DpnI Digestion for 1 hour''' | ||
− | + | {| class="table table-striped" | |
+ | !Reagent!! Volume/ul | ||
+ | |- | ||
+ | |ddH<sub>2</sub>O|| 3 | ||
+ | |- | ||
+ | |DNA|| 20 | ||
+ | |- | ||
+ | |5X Buffer|| 6 | ||
+ | |- | ||
+ | |DpnI|| 1 | ||
+ | |- | ||
+ | |Total||30 | ||
+ | |} | ||
'''''Transformation''''' | '''''Transformation''''' | ||
Line 2,330: | Line 3,259: | ||
2. Total 2 tubes PCR reaction | 2. Total 2 tubes PCR reaction | ||
− | + | {| class="table table-striped" | |
+ | !Reagent!! Volume/ul | ||
+ | |- | ||
+ | |ddH<sub>2</sub>O|| 20.8 | ||
+ | |- | ||
+ | |Forward Primer|| 1.5 | ||
+ | |- | ||
+ | |Reverse Primer|| 1.5 | ||
+ | |- | ||
+ | |2X Premix|| 25 | ||
+ | |- | ||
+ | |Template|| 1.2(1ng) | ||
+ | |- | ||
+ | |Total||50 | ||
+ | |} | ||
3. Procedure | 3. Procedure | ||
− | + | {| class="table table-striped" | |
+ | !Temperature/℃!! Duration/seconds!!Number of cycles | ||
+ | |- | ||
+ | |98||10||1 | ||
+ | |- | ||
+ | |98|| 10|| | ||
+ | |- | ||
+ | |55|| 10|| | ||
+ | |- | ||
+ | |72|| 60||32 | ||
+ | |- | ||
+ | |72|| 120||1 | ||
+ | |- | ||
+ | |10|| ∞|| | ||
+ | |} | ||
'''''Gel Extraction''''' | '''''Gel Extraction''''' | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--0D67BA48-6F05-400A-B5FB-89E873D47078.png | caption= | width=1000px}} | |
− | + | ||
Concentration: 44.4ng/μl, 40μl | Concentration: 44.4ng/μl, 40μl | ||
Line 2,346: | Line 3,302: | ||
1. Insert | 1. Insert | ||
− | + | {| class="table table-striped" | |
+ | !Reagent!! Volume/ul | ||
+ | |- | ||
+ | |ddH<sub>2</sub>O|| 1 | ||
+ | |- | ||
+ | |DNA|| 40 | ||
+ | |- | ||
+ | |10X Buffer|| 5 | ||
+ | |- | ||
+ | |EcoRI|| 2 | ||
+ | |- | ||
+ | |SacI|| 2 | ||
+ | |- | ||
+ | |Total||50 | ||
+ | |} | ||
The digestion is from 00:20 to 09:00. | The digestion is from 00:20 to 09:00. | ||
2. Vector | 2. Vector | ||
− | + | {| class="table table-striped" | |
+ | !Reagent!! Volume/ul | ||
+ | |- | ||
+ | |ddH<sub>2</sub>O|| 11 | ||
+ | |- | ||
+ | |DNA|| 30 (5ug) | ||
+ | |- | ||
+ | |10X Buffer|| 5 | ||
+ | |- | ||
+ | |EcoRI|| 2 | ||
+ | |- | ||
+ | |SacI|| 2 | ||
+ | |- | ||
+ | |Total||50 | ||
+ | |} | ||
The digestion is from 21:00 to 09:00. | The digestion is from 21:00 to 09:00. | ||
Line 2,361: | Line 3,345: | ||
097&NeoLoxP qPCR-2nd | 097&NeoLoxP qPCR-2nd | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--A99B219B-8A58-4B7D-894E-9152503A503C.png | caption= | width=1000px}} | |
=== 13 <sup>th</sup> === | === 13 <sup>th</sup> === | ||
Line 2,381: | Line 3,365: | ||
'''Ligation with ''T4 DNA Ligase''''' | '''Ligation with ''T4 DNA Ligase''''' | ||
− | + | {| class="table table-striped" | |
+ | !Volume/ul !!Mass/ng !!pmol !!Control | ||
+ | |- | ||
+ | |2|| || ||2 | ||
+ | |- | ||
+ | |1.4|| 62||0.02||1.4 | ||
+ | |- | ||
+ | |1.1|| 28||0.06||0 | ||
+ | |- | ||
+ | |14.5|| ||||15.6 | ||
+ | |- | ||
+ | |1|| || ||1 | ||
+ | |- | ||
+ | |20|| || ||20 | ||
+ | |} | ||
The ligation is from 12:50 to 14:00. | The ligation is from 12:50 to 14:00. | ||
Line 2,391: | Line 3,389: | ||
'''Transformation Result''' | '''Transformation Result''' | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--6B7D8CFE-EF8B-4ED6-BC8B-316926D1C334.png | caption= | width=1000px}} | |
+ | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--F76486FB-9119-4E9D-846E-051702938721.png | caption= | width=1000px}} | ||
− | + | {| class="table table-striped" | |
− | + | !Method !!Colonies !!Control | |
− | + | |- | |
+ | |Q5||191 ||0 | ||
+ | |- | ||
+ | |Gibson|| 38||7 | ||
+ | |- | ||
+ | |KOD|| 0||0 | ||
+ | |- | ||
+ | |Ligation||1772 ||330 | ||
+ | |- | ||
+ | |Positive Control||237 || | ||
+ | |} | ||
'''Competent Cell Efficiency''' | '''Competent Cell Efficiency''' | ||
Line 2,411: | Line 3,420: | ||
1. 62ng,4906bp→1.232x10<sup>10</sup> copies | 1. 62ng,4906bp→1.232x10<sup>10</sup> copies | ||
− | 2. Efficiency= | + | 2. Efficiency=[[File:T--SUSTech_Shenzhen--FD617370-10DD-4D71-9B28-4C22809C83AA.png | 400px | thumb | Center]] |
'''Mutation Library''' | '''Mutation Library''' | ||
Line 2,425: | Line 3,434: | ||
Use enzyme digestion and ligation method to construct mutation library,except that using error-prone PCR,and the target DNA is 500ng. | Use enzyme digestion and ligation method to construct mutation library,except that using error-prone PCR,and the target DNA is 500ng. | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--A4F17686-3595-4B44-AFDE-39CD091C8A69.png | caption= | width=1000px}} | |
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--FFF5FE40-1963-45C6-990F-14C30C7A41C9.png | caption= | width=1000px}} | |
− | + | ||
− | + | ||
=== 15 <sup>th</sup> === | === 15 <sup>th</sup> === | ||
Line 2,437: | Line 3,444: | ||
2. Results: | 2. Results: | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--9D173ADC-03D0-4E81-80CF-53435133E660.png | caption= | width=1000px}} | |
− | + | ||
2. Conclusion: | 2. Conclusion: | ||
Line 2,461: | Line 3,467: | ||
2. Results: | 2. Results: | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--781FC5A6-70BE-4A5F-8256-4F911DC8069A.png | caption= | width=1000px}} | |
+ | |||
+ | 3. Conclusion: | ||
I. Primer 1~4 are all not contaminated and have specific PCR band with annealing temperature of 65℃,while they don’t have PCR product band with annealing temperature of 70℃. | I. Primer 1~4 are all not contaminated and have specific PCR band with annealing temperature of 65℃,while they don’t have PCR product band with annealing temperature of 70℃. | ||
Line 2,471: | Line 3,479: | ||
'''Transformation Result''' | '''Transformation Result''' | ||
− | + | {| class="table table-striped" | |
+ | !Colonies !!Control | ||
+ | |- | ||
+ | |10688 ||113 | ||
+ | |} | ||
1. Mutation library(10ul ligation product)=10688 | 1. Mutation library(10ul ligation product)=10688 | ||
− | 2. Ligation efficiency= | + | 2. Ligation efficiency=[[File:T--SUSTech_Shenzhen--577AF5FF-F3C5-4C6E-90B7-DC6BDAB37FCD.png | 300px | thumb | Center]] |
'''Pick 20 Single Colony for sequencing''' | '''Pick 20 Single Colony for sequencing''' | ||
Line 2,483: | Line 3,495: | ||
7 out of 20 plasmids have mutation(s) among specific region,in which one has 15 base mutations,one has 2 base mutations,and the rest five have 1 base mutation. | 7 out of 20 plasmids have mutation(s) among specific region,in which one has 15 base mutations,one has 2 base mutations,and the rest five have 1 base mutation. | ||
− | '''Scrape the Colonies for '' | + | '''Scrape the Colonies for''' [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Endo-Free_Plasmid_DNA_Mini_Kit_II_Protocol_-_Spin_Protocol | '''endofree plasmid purification.''']] |
The scraped colonies are cultured for around 9 hours till the OD achieves 2.879,with 150ml Amp. | The scraped colonies are cultured for around 9 hours till the OD achieves 2.879,with 150ml Amp. | ||
Line 2,497: | Line 3,509: | ||
2. Results: | 2. Results: | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--BD947833-DD22-458A-887B-07173195DFAF.png | caption= | width=1000px}} | |
=== 21 <sup>th</sup> === | === 21 <sup>th</sup> === | ||
Line 2,541: | Line 3,553: | ||
Concentration: 101.2ng/μl | Concentration: 101.2ng/μl | ||
− | + | {| class="table table-striped" | |
+ | !Stock Conc./ng*ul<sup>-1</sup>!! Volume/ul!!Dilute Volume/ul | ||
+ | |- | ||
+ | |c(101.2)|| 10||90 | ||
+ | |- | ||
+ | |c/10|| 10||90 | ||
+ | |- | ||
+ | |c/100|| 10||40 | ||
+ | |- | ||
+ | |c/500|| 10||40 | ||
+ | |- | ||
+ | |..|| ..||.. | ||
+ | |- | ||
+ | |dilution point8(1.5)|| 10||40 | ||
+ | |} | ||
4. | 4. | ||
− | + | {| class="table table-striped" | |
+ | !Reagent!! Volume/ul!!Final Conc. !!Negative Control | ||
+ | |- | ||
+ | |ddH<sub>2</sub>O|| 6.4|| ||8.4 | ||
+ | |- | ||
+ | |2XSYBR® Master Mix|| 10|| ||10 | ||
+ | |- | ||
+ | |Forward Primer|| 0.8||0.4||0.8 | ||
+ | |- | ||
+ | |Reverse Primer|| 0.8||0.4||0.8 | ||
+ | |- | ||
+ | |Template|| 2|| ||0 | ||
+ | |- | ||
+ | |Total|| 20|| ||20 | ||
+ | |} | ||
5. Procedure | 5. Procedure | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--2820C86D-CC83-4161-896C-2FBE61D1FB60.png | caption= | width=1000px}} | |
6. Results | 6. Results | ||
− | + | {| class="table table-striped" | |
− | Conclusion | + | !Primer !!Ct |
+ | |- | ||
+ | |Negative Control-2||32 | ||
+ | |- | ||
+ | |Negative Control-3||29 | ||
+ | |- | ||
+ | |Negative Control-4||30 | ||
+ | |- | ||
+ | |Negative Control-18s||32 | ||
+ | |} | ||
+ | |||
+ | 7. Conclusion | ||
I.Can’t use ‘TaKaRa-One Step SYBR PrimeScript RT-PCR Kit II’,cause our sample is DNA. | I.Can’t use ‘TaKaRa-One Step SYBR PrimeScript RT-PCR Kit II’,cause our sample is DNA. | ||
Line 2,575: | Line 3,626: | ||
2. | 2. | ||
− | + | {| class="table table-striped" | |
+ | !Reagent!! Volume/ul | ||
+ | |- | ||
+ | |ddH<sub>2</sub>O|| 6 | ||
+ | |- | ||
+ | |SYBR Premix Ex Taq II(2X)|| 10 | ||
+ | |- | ||
+ | |Forward Primer|| 0.8 | ||
+ | |- | ||
+ | |Reverse Primer|| 0.8 | ||
+ | |- | ||
+ | |Template(<100ng)|| 2 | ||
+ | |- | ||
+ | |ROX Reference Dye(50X)|| 0.4 | ||
+ | |- | ||
+ | |Total|| 20 | ||
+ | |} | ||
3. Procedure | 3. Procedure | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--148AA4CB-C49A-4769-904C-4132ED9438DB.png | caption= | width=1000px}} | |
4. Results | 4. Results | ||
− | + | {| class="table table-striped" | |
− | + | !Primer !!Ct | |
+ | |- | ||
+ | |Negative Control-2||27.8 | ||
+ | |- | ||
+ | |Negative Control-3||30.7 | ||
+ | |- | ||
+ | |Negative Control-4||32 | ||
+ | |} | ||
+ | |||
+ | {| class="table table-striped" | ||
+ | !Standard !!R<sup>2</sup>!!Efficiency | ||
+ | |- | ||
+ | |Primer-2||0.9954||116% | ||
+ | |- | ||
+ | |Primer-3||0.9993||104% | ||
+ | |- | ||
+ | |Primer-4||0.9998||104% | ||
+ | |} | ||
+ | |||
5. Conclusion | 5. Conclusion | ||
Line 2,596: | Line 3,681: | ||
3. Procedure | 3. Procedure | ||
− | + | {| class="table table-striped" | |
+ | !Temperature/℃!! Duration/seconds!!Number of cycles | ||
+ | |- | ||
+ | |98||10||1 | ||
+ | |- | ||
+ | |98|| 10|| | ||
+ | |- | ||
+ | |55|| 10|| | ||
+ | |- | ||
+ | |72|| 60||32 | ||
+ | |- | ||
+ | |72|| 120||1 | ||
+ | |- | ||
+ | |10|| ∞|| | ||
+ | |} | ||
− | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Gel_Extraction_Kit_-_Spin_Protocol|'''Gel Extraction protocol''']] '''of PCR Product(as Insert)''' | |
− | + | {| class="table table-striped" | |
+ | !Target Mass/ng!! 1!!10!!100 | ||
+ | |- | ||
+ | |Conc./ng*ul<sup>-1</sup>||215.2||208.5||259.5 | ||
+ | |} | ||
Each with volume of 30μl. | Each with volume of 30μl. | ||
Line 2,606: | Line 3,709: | ||
'''EcoRI,SacI Restriction Enzyme Digestion for 9 hours''' | '''EcoRI,SacI Restriction Enzyme Digestion for 9 hours''' | ||
− | ''' | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Cycle_Pure_Kit_-_Centrifugation_Protocol | '''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol''']] |
− | + | {| class="table table-striped" | |
+ | !Target Mass/ng!! 1!!10!!100 | ||
+ | |- | ||
+ | |Conc./ng*ul<sup>-1</sup>||105||107||113 | ||
+ | |} | ||
'''qPCR Primer Test with Premix and Gel Running''' | '''qPCR Primer Test with Premix and Gel Running''' | ||
Line 2,614: | Line 3,721: | ||
Annealing temperature: 62℃ | Annealing temperature: 62℃ | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--51A9659D-EE99-448A-AAFC-DD0BD2E1525E.png | caption= | width=1000px}} | |
Conclusion: | Conclusion: | ||
Line 2,638: | Line 3,745: | ||
3. Results | 3. Results | ||
− | + | {| class="table table-striped" | |
+ | !Standard !!R<sup>2</sup>!!Efficiency | ||
+ | |- | ||
+ | |Primer-3||0.9998||109% | ||
+ | |} | ||
− | + | {| class="table table-striped" | |
+ | !Name !!Ct | ||
+ | |- | ||
+ | |WT-old||29 | ||
+ | |- | ||
+ | |WT-1 new||21.6 | ||
+ | |- | ||
+ | |NC-3||32 | ||
+ | |} | ||
− | + | {| class="table table-striped" | |
+ | !Sample !!Copy Number | ||
+ | |- | ||
+ | |1||19 | ||
+ | |- | ||
+ | |2||8 | ||
+ | |- | ||
+ | |3||4 | ||
+ | |- | ||
+ | |5||5 | ||
+ | |- | ||
+ | |7||12 | ||
+ | |- | ||
+ | |8||7 | ||
+ | |- | ||
+ | |10||5 | ||
+ | |} | ||
4. Conclusion | 4. Conclusion | ||
Line 2,676: | Line 3,811: | ||
Same procedure as before | Same procedure as before | ||
− | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Gel_Extraction_Kit_-_Spin_Protocol|'''Gel Extraction protocol''']] | |
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--A7BB6F29-12A8-41D4-8123-23A27B307FBF.png | caption= | width=1000px}} | |
'''XbaI,SacI Restriction Enzyme Digestion for Vector and Insert''' | '''XbaI,SacI Restriction Enzyme Digestion for Vector and Insert''' | ||
Line 2,684: | Line 3,819: | ||
=== 28 <sup>th</sup> === | === 28 <sup>th</sup> === | ||
− | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Gel_Extraction_Kit_-_Spin_Protocol|'''Gel Extraction protocol''']] '''for Vector''' | |
− | ''' | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Cycle_Pure_Kit_-_Centrifugation_Protocol | '''E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol''']] '''for Insert''' |
− | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#T4_DNA_Ligase.28M0202.29 | '''T4 DNA Ligase(M0202)''']] '''for 20min''' | |
− | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#Transformation_.26_Competent_cell_recovery | '''Transformation''']] | |
After culture for 10 hours: | After culture for 10 hours: | ||
Line 2,702: | Line 3,837: | ||
All correct. | All correct. | ||
− | '''Culture Colonies for '' | + | '''Culture Colonies for''' [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Endo-Free_Plasmid_DNA_Mini_Kit_II_Protocol_-_Spin_Protocol | '''endofree plasmid purification.''']] |
'''CHO Cell ''Genomic DNA Extraction''''' | '''CHO Cell ''Genomic DNA Extraction''''' | ||
Line 2,718: | Line 3,853: | ||
'''PvuI,NcoI Restriction Enzyme Digestion for Verification''' | '''PvuI,NcoI Restriction Enzyme Digestion for Verification''' | ||
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--9889D046-D093-4CCB-8DAC-335137EDE2EF.png | caption= | width=1000px}} | |
Verification result: All correct. | Verification result: All correct. | ||
Line 2,731: | Line 3,866: | ||
Insert: ep-PCR segments,with low&medium&high mutation frequency. | Insert: ep-PCR segments,with low&medium&high mutation frequency. | ||
− | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Gel_Extraction_Kit_-_Spin_Protocol|'''Gel Extraction protocol''']] '''of Enzyme-digested Vector''' | |
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--C04628BD-174D-4FF2-A2E1-B7AC44C84C24.png | caption= | width=1000px}} | |
'''Ligation for 1 hour''' | '''Ligation for 1 hour''' | ||
− | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#Transformation_.26_Competent_cell_recovery | '''Transformation''']] | |
5μl ligation product are transformed with 100ul competent cells. | 5μl ligation product are transformed with 100ul competent cells. | ||
Line 2,745: | Line 3,880: | ||
Instrument: ABI StepOne Plus qPCR | Instrument: ABI StepOne Plus qPCR | ||
− | + | [[Team:SUSTech_Shenzhen/Notebook/Protocol#Power_SYBR.C2.AE_Green_PCR_Master_Mix_Kit.28life_technologies.2C4368708.29 | '''Kit: TaKaRa-One Step SYBR PrimeScript RT-PCR Kit I''']] | |
1. Sample: Positive (3),(11)~(21) | 1. Sample: Positive (3),(11)~(21) | ||
Line 2,761: | Line 3,896: | ||
3. Results | 3. Results | ||
− | + | {| class="table table-striped" | |
+ | !Standard !!R<sup>2</sup>!!Efficiency | ||
+ | |- | ||
+ | |Primer-3||0.9998||97% | ||
+ | |} | ||
+ | |||
+ | {| class="table table-striped" | ||
+ | !Name !!Ct | ||
+ | |- | ||
+ | |WT-old||24 | ||
+ | |- | ||
+ | |NC-3||29 | ||
+ | |} | ||
− | |||
4. Conclusion | 4. Conclusion | ||
Line 2,773: | Line 3,919: | ||
=== 02 <sup>nd</sup> === | === 02 <sup>nd</sup> === | ||
− | '''Scrape the Plate for '' | + | '''Scrape the Plate for''' [[Team:SUSTech_Shenzhen/Notebook/Protocol#E.Z.N.A..C2.AE_Endo-Free_Plasmid_DNA_Mini_Kit_II_Protocol_-_Spin_Protocol | '''endofree plasmid purification.''']] |
− | + | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--3E0BC708-4AF0-406A-BBF4-A0B6367E6798.png | caption= | width=300px}} | |
+ | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--8A805149-ED73-4D02-81E0-F006CBDC0520.png | caption= | width=300px}} | ||
+ | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--066B81E8-A3E8-4ACB-8317-EF4B8F4AB04A.png | caption= | width=300px}} | ||
+ | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--01DFDBA0-928C-47D0-8002-3D4C3DADCC7A.png | caption= | width=300px}} | ||
+ | {{SUSTech_Image_Center_8 | filename=T--SUSTech_Shenzhen--0951AE7E-3DF8-4689-94A9-284B3B595140.png | caption= | width=300px}} | ||
+ | {| class="table table-striped" | ||
+ | !Colonies !!Control | ||
+ | |- | ||
+ | |10<sup>4</sup>~10<sup>5</sup>||12 | ||
+ | |} | ||
− | + | {| class="table table-striped" | |
− | + | !Target Mass/ng!! 1!!10!!100!!500 | |
− | + | |- | |
− | + | |Conc./ng*ul<sup>-1</sup>||295.7||271.5||167.6||200.4 | |
− | + | |} | |
− | + | ||
− | + | ||
Each with volume of 100μl. | Each with volume of 100μl. | ||
Line 2,819: | Line 3,972: | ||
3. Results | 3. Results | ||
− | + | {| class="table table-striped" | |
+ | !Standard !!R<sup>2</sup>!!Efficiency | ||
+ | |- | ||
+ | |Primer-3||0.9998||140% | ||
+ | |} | ||
− | + | {| class="table table-striped" | |
+ | !Name !!Ct | ||
+ | |- | ||
+ | |WT-old||26 | ||
+ | |- | ||
+ | |NC-3||30 | ||
+ | |} | ||
4. Conclusion | 4. Conclusion |
Latest revision as of 12:28, 19 October 2016
Molecular Experiment
Notebook
Contents
- 1 2015
- 2 2016
- 2.1 Jan.
- 2.2 Feb.
- 2.3 April
- 2.4 July
- 2.5 Aug.
- 2.6 Sept.
- 2.7 Oct.
2015
Dec.
13th
Geco plasmid construction
1. Polymerase Chain Reaction (PCR)
Use PBX-084 TRE-mCherry-2A-Bla plasmid as template to get blasticidin(Bla) resistance gene.
Primers: Age-Bla-S & Bla-E2A-AS
(without purification), 20μl, 30 cycles
Volume/ul | |
---|---|
Buffer | 2 |
Template | 0.5 |
Polymerase(Taq) | 0.2 |
dNTP | 1 |
Primer | 0.5, 0.5 |
ddH2O | 15.4 |
2. PCR
Use PBX-084 TRE-mCherry-2A-Bla plasmid as template to get 2A sequence.
Primers: E2A-S & E2A-Hind III-AS
(without purification), 20μl, 30 cycles
Volume/ul | |
---|---|
Buffer | 2 |
Template | 0.5 |
Polymerase(Taq) | 0.2 |
dNTP | 1 |
Primer | 0.5, 0.5 |
ddH2O | 15.4 |
3. PCR
Step 1: run 10 cycles without primer to let Bla and 2A link together.
98℃ | 10s | \ | |
55℃ | 5s | x10 cycles | |
72℃ | 30s | / |
Step 2:add primers to run 30 cycles.
Primers: AgeI-Bla-S 0.3μM & E2A-HindIII-AS 0.3μM
98℃ | 10s | \ | |
55℃ | 5s | x30 cycles | |
72℃ | 30s | / |
4. PCR product cycle purification by using E.Z.N.A.® Cycle Pure Kit.
15th
Geco plasmid construction
1. Digest the PCR purification product with AgeI and HindIII restriction endonuclease(RE).(37 ℃ 2 hours)
Volume/ul | |
---|---|
PCR purification product | 8.4 (~1ug) |
CutSmart buffer | 5 |
AgeI | 1.5 |
HindIII | 1.5 |
ddH2O | 33.6 |
2. Digest the Geco plasmid with BglII restriction endonuclease. (50℃ 3 hours)
Volume/ul | |
---|---|
Geco plasmid | 9.5 (~1ug) |
3.1 buffer(X10) | 5 |
BglII | 1.5 |
ddH2O | 34 |
3.Cycle pure the RE digestion product with the kit “xxxxxx”.
4. Digest the purification product with HindIII restriction endonuclease. (37 ℃ 3 hours)
Volume/ul | |
---|---|
the purification product | 5 (~640ng) |
CutSmart (X10) | 5 |
HindIII | 1 |
ddH2O | 39 |
5. Digest the vector plasmid with AgeI restriction endonuclease. (37 ℃ 3 hours)
Volume/ul | |
---|---|
The vector plasmid | 10 (~2.5 ug) |
CutSmart(X10) | 5 |
AgeI | 1 |
ddH2O | 34 |
6.Add 1.5 μl BclII restriction endonuclease. (50 ℃ 3 hours)
Note: BclI and BglII have the same sticky end.
7. Gel running and Gel extraction to get the insert and vector fragments. E.Z.N.A.® Gel Extraction Kit - Spin Protocol
16th
Geco plasmid construction
1. Geco,Vector,Bla+2A Ligation with T4 DNA Ligase(Vector:Insert=1:3).
Vector (5.8 kbp): 5.5ng/μl
Bla+2A (0.45kbp): 16.8ng/μl
Geco (1.25kbp): 5.6ng/μl
Kit | Add (ul) | |
---|---|---|
10X T4 DNA Ligase Buffer | 2ul | 2.5 |
Vector DNA(5.8kb) | 0.02pmol | 12.7 |
Bla+2A(0.45kb) | 0.06pmol | 1 |
Geco(1.25kb) | 0.06pmol | 8.2 |
ddH2O | 0 | |
T4 DNA Ligase | 1ul | 1 |
Total | 20ul | 25 |
Room temperature for 10 minutes.
2. Mix&Go hyper-efficient competent cells transformation.
- Quickly thaw: remove "Mix&Go" hyper-efficient competent cells from -80℃ freezer and water flow till 50% of the cells melt.
- Add DNA: DNA volume is less than 1/10 volume of competent cells. (blow and suck for mixing )
- Heat shock: heat shock at 42℃ water bath for 45s.
- Spread the plates: remove LB(Amp+) plates from 4℃refrigerator,and spread all the bacterial on the plates. Overnight culture at 37℃ incubator (12~16hours).
Vector+Bla 2A+Geco 3 μl + competent cells 30 μl
17th
Geco plasmid construction
1. Vector+Bla 2A+Geco transformation results:
2. Pick single clones and overnight culture.
Pick 5 single clones and use 6 ml Amp+ LB medium with 37℃ and 220 rpm shaker to overnight culture each clones.
18th
Geco plasmid construction
1. Extraction of plasmid with E.Z.N.A.® Plasmid DNA Mini Kit I Protocol.
Geco plasmid | Conc. (ng/ul) | A260/280 |
---|---|---|
1 | 94.2 | 1.92 |
2 | 79.7 | 1.96 |
3 | 110.6 | 1.90 |
4 | 150.3 | 1.87 |
5 | 149.7 | 1.88 |
2. Send 5 plasmids to sequence.
29th
Piezo plasmid construction
1. Piezo backbone(PBX-123 plasmid from Prof.Huang’s lab) transformation. Mix&Go method.
Piezo backbone plasmids 2μl + competent cells 20μl
30th
Piezo plasmid construction
1. Piezo backbone transformation results:
2. Pick single clones and overnight culture.
Pick 3 single clones and use 6 ml Amp+ LB medium with 37℃ and 220 rpm shaker to overnight culture each clones.
31th
Piezo plasmid construction
1. Extraction of plasmid with E.Z.N.A.® Plasmid DNA Mini Kit I Protocol.
piezo | Conc. (ng/ul) | A260/280 |
---|---|---|
1 | 143.4 | 1.87 |
2 | 283.1 | 1.87 |
3 | 186.8 | 1.87 |
2. Piezo GPA、pTRE-3G PCR.
Piezo: 310ng/μl GPA: 444bp pTRE-3G: 376bp
Protocol | Final conc. | Add (ul) | |
---|---|---|---|
PrimeSTAR Max(2X) | 25ul | 1X | 25 |
Primer1 | 10-15pmol | 0.2-0.3uM | 1.3 |
Primer2 | 10-15pmol | 0.2-0.3uM | 1.3 |
Template | <200ng | 0.7 | |
ddH2O | 21.7 | ||
Total | 50ul | 50 |
Program setting:
98℃ | 10s | \ |
55℃ | 15s | X 35 cycles |
72℃ | 30s | / |
3.Gel Running
4.PCR purification.
E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol
Conc. (ng/ul) | A260/280 | |
---|---|---|
GPA | 122.7 | 1.85 |
pTRE-3G | 102.5 | 1.84 |
2016
Jan.
21th
Piezo plasmid construction
1. Piezo plasmid construction design:
2. Piezo plasmid(original) RE digestion: 37℃ 2hours
Volume/ul | |
---|---|
piezo DNA (576ng/ul) | 2 |
AscI | 1 |
NotI | 1 |
10X CutSmart buffer | 5 |
ddH2O | 41 |
3. Backbone PBX-123 plasmid RE digestion: 37℃ 2hours
Volume/ul | |
---|---|
pBX123 DNA (312ng/ul) | 3 |
MfeI | 1 |
PmeI | 1 |
10X CutSmart buffer | 5 |
ddH2O | 40 |
4. Gel running and gel extraction.
E.Z.N.A.® Gel Extraction Kit - Spin Protocol
Gel Extraction concentration (ng/ul) | |
---|---|
piezo (original) | 18.6 |
pBX123 | 40.7 |
5. Gibson assembly:
Gibson system (20ul) | Gibson Control system(10ul) | |
---|---|---|
piezo | 4 | 0 |
pBX-123 | 2 | 1 |
pTRE-3G | 0.2 | 0.1 |
GpA | 0.2 | 0.1 |
Gibson mix (X2) | 10 | 5 |
ddH2O | 3.6 | 3.8 |
Incubate the mix for 1 hour at 50°C. ( Gibson Assembly® Master Mix – Assembly (E2611) Method)
6. Gibson product transformation:
[[Team:SUSTech_Shenzhen/Notebook/Protocol#Transformation_.26_Competent_cell_recovery | Transformation & Competent cell recovery]
5μl gibson product + 50μl competent cells
Spread plates and overnight cultrue.
22th
Piezo plasmid construction
- Pick single colonies:
- pick 1 colony from control group, pick 5 colonies from piezo group.
- Add into 6ml Amp+ LB, shake at 37℃ and 220 rpm.
- Make Amp LB and agar.
- make two 500ml Amp+ LB medium and one 500ml Amp+ LB agar.
- pour 29 plates.
- Sterilization.
- We put bunch of tips and tubes for sterilization.
Piezo plasmid construction
- Extract the plasmids from the single colonies (1 control group and 5 PIEZO group):
Conc. (ng/ul) | |
---|---|
Control group | 389.6 |
PIEZO group 1 | 343.5 |
PIEZO group 2 | 376.3 |
PIEZO group 3 | 371.6 |
PIEZO group 4 | 388.5 |
PIEZO group 5 | 245.2 |
- Gel electrophoresis of the six plasmids:
Sample 2 and Sample 4 have shown positive results, which should be tested further with PCR.
Materials sorting:
We sorted the material and put all of them into the lowermost layer of the -20℃ fridge.
25th
Piezo plasmid construction
- Sterilization:
- We put a bottle of ddH2O and bunch of tips and tubes for sterilization.
- PCR test for PIEZO group 2 and PIEZO group 4: Premix TaqTM (RR902A)
For each system
Volume/ul | |
---|---|
Premix Taq | 10 |
Sample | 0.5 |
GpA primer1 | 1 |
GpA primer2 | 1 |
ddH2O | 7.5 |
Program setting:
95℃ | 5min | 95℃ | 30s | \ | 55℃ | 20s | x35 cycles | 72℃ | 40s | / |
3. Gel running:
4. Pick up single colonies and colony PCR
As the result of gel electrophoresis of piezo Gibson group 2&4(yesterday,2016.1.24) missed bands of 4000, we picked up 20 single colonies to test by colony PCR. (use primers of GpA and PTRE).
The system of colony PCR (total 20 μl): Premix TaqTM (RR902A)
Volume/ul | |
---|---|
2X Taq mix | 10 |
Template | 05 |
Primer1 | 1 |
Primer2 | 1 |
ddH2O | 3 |
Program setting:
95℃ | 5min | ||
95℃ | 30s | \ | |
55℃ | 20s | x35 cycles | |
72℃ | 40s | / |
Finally, we got 40 groups for PCR colonies (20 for GpA and 20 for PTRE).
5. Gel electrophoresis of 40 groups after PCR colonies.
6.TRPC5 & TRPC6 &PBX-090 transformation.
We transformed these plasmids into competent cell and coated. After that, incubated at 37℃ for 16 hours.(5 plasmids onto 5 Amp plates)
26th
Piezo plasmid construction
1. Pick up single colonies
After TRPC5, TRPC6 and PBX-090 transformation, we found that there are no colony growing on PBX-090 plate. Later we knew that PBX-090 is Kanamycin resistant. We pick 1 colony from other 4 plates. Add into 5ml Amp LB, shake at 37℃.
2.PCR test Premix TaqTM (RR902A)
For yesterday PIEZO group 2 and PIEZO group 4(GPA verified):
Volume/ul | |
---|---|
Premix Taq | 10 |
Sample | 0.5 |
GpA primer1 | 1 |
GpA primer2 | 1 |
ddH2O | 7.5 |
Program setting:
95℃ | 5min | ||
95℃ | 30s | \ | |
55℃ | 20s | x30 cycles | |
72℃ | 40s | / |
For yesterday PIEZO colony PCR promoter(pTRE) group 9,11,15(pTRE verified):
Volume/ul | |
---|---|
Premix Taq | 10 |
Sample | 0.5 |
GpA primer1 | 1 |
GpA primer2 | 1 |
ddH2O | 7.5 |
Program setting:
95℃ | 5min | ||
95℃ | 30s | \ | |
55℃ | 20s | x30 cycles | |
72℃ | 40s | / |
3.Gel running of PCR product
4.Streak plate of colony PCR9&11&15
We streaked 3 Amp plates using tips.
5.RE Digestion of PIEZO(original plasmid), PIEZO group 2,and PIEZO group 4 PIEZO Total 20μl
Volume/ul | |
---|---|
1ug PIEZO(original plasmid, conc. 576ng/ul) | 1.7 |
BamHI | 0.2 |
CutSmart buffer(X10) | 2 |
ddH2O | 16.1 |
PIEZO group 2(1) Total 20μl
Volume/ul | |
---|---|
1ug PIEZO group2(original plasmid, conc. 376.3ng/ul) | 2.6 |
PmeI | 0.2 |
CutSmart buffer(X10) | 2 |
ddH2O | 15.2 |
PIEZO group 2(2) Total 20μl
Volume/ul | |
---|---|
1ug PIEZO group2(original plasmid, conc. 376.3ng/ul) | 2.6 |
PmeI | 0.2 |
BamHI | 0.2 |
CutSmart buffer(X10) | 2 |
ddH2O | 15 |
PIEZO group 4(1) Total 20μl
Volume/ul | |
---|---|
1ug PIEZO group4(original plasmid, conc. 388.5ng/ul) | 2.6 |
PmeI | 0.2 |
CutSmart buffer(X10) | 2 |
ddH2O | 15.2 |
PIEZO group 4(2) Total 20μl
Volume/ul | |
---|---|
1ug PIEZO group2(original plasmid, conc. 388.5ng/ul) | 2.6 |
PmeI | 0.2 |
BamHI | 0.2 |
CutSmart buffer(X10) | 2 |
ddH2O | 15 |
Gel running results:
Since the results out to be blurred, we decide to run gel again tomorrow.
27th
Piezo plasmid construction
1.Plasmid purification E.Z.N.A.® Plasmid DNA Mini Kit I Protocol - Spin Protocol
Plasmid purification of TRPC5 and TRPC6 from the single colonies we picked yesterday
The concentration of the plasmids:
Conc. (ng/ul) | |
---|---|
TRPC5 IRES-GFP | 461.9 |
TRPC5 IRES-GFP | 425.1 |
TRPC5 IRES-GFP | 542.7 |
TRPC5 IRES-GFP | 866.8 |
2.Gel electrophoresis of Restriction Enzyme Digestion product:
3.Pick single colonies After we strake plate of colony PCR9&11&15, we pick 1 colony from each plate. Add into 5ml Amp LB, shake at 37℃.
4. TRPC5 T5-GFP PCR Q5® High-Fidelity 2X Master Mix(M0492S)
Volume/ul | |
---|---|
Q5 premix | 10 |
Primer1 | 1 |
Primer2 | 1 |
TRPC5 T5-GFP | 0.8 |
ddH2O | 7.2 |
Total | 20 |
We make 2 groups of 50μL PCR solution.
5. PCR purification E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol
Accidentally make the centrifuge in step 8 30 seconds rather than 1 minute
Use 50μl ddH2O to elute DNA in the last process.
DNA concentration:
Group1: 21.8ng/μL
Group2: 31.6ng/μL
6. TRPC5 T5-GFP PCR(2nd) Q5® High-Fidelity 2X Master Mix(M0492S)
Because the DNA concentration in the last step was too low to conduct the following experiment, we did the TRPC5 T5-GFP PCR for the second time.
Volume/ul | |
---|---|
Q5 premix | 25 |
Primer1 | 2.5 |
Primer2 | 2.5 |
TRPC5 T5-GFP | 3 |
ddH2O | 17 |
Total | 50 |
We make 5 groups of 50μL PCR solution, and run 40 cycles.
28th
Piezo plasmid construction
1. Plasmid purification and maintenance breeding ① Plasmid purification of colony PCR9&11&15 from the single colonies we picked yesterday
Use 50μL ddH2O to elute DNA in the last process.
E.Z.N.A.® Plasmid DNA Mini Kit I Protocol - Spin Protocol
The concentration of the plasmids:
Colony PCR9 463.6ng/μl
Colony PCR11 556.1ng/μl
Colony PCR15 474.4ng/μl
② Maintenance breeding
Mix 500μL bacterial liquid with 500μL (volume fraction:50%)glycerol, and then shore at -80℃.
2. PCR purification E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol
PCR purification of TPRC5 T5-GFP(2nd)
Use 80 μl Tris-HCl to elute DNA in the last process.
Finally, the concentration of DNA:
Group 1 55.8ng/μl
Group 2 68.7ng/μl
Group 3 69.2ng/μl
Group 4 71.6ng/μl
3. Mycoplasma detection
We did mycoplasma detection for the supernatant from the cell culture (step 4. Cell freezing) we collected yesterday.
a. PCR the supernatant by the primers of mycoplasma DNA.
The system of PCR (total 50μL): Q5® High-Fidelity 2X Master Mix(M0492S
Volume/ul | |
---|---|
Q5 hot start | 25 |
Primer1 | 2.5 |
Primer2 | 2.5 |
DNA | 3 |
ddH2O | 17 |
Program setting:
95℃ | 30s | ||
98℃ | 20s | \ | |
50℃ | 10s | x35 cycles | |
72℃ | 100s | / | |
72℃ | 120s | ||
4℃ | ∞ |
b. Gel electrophoresis of PCR product.
Obviously, positive control turns out to be positive result, while negative control and the samples are negative results, so that our freezing cells are not polluted and we can store them into liquid nitrogen (big liquid nitrogen cell storage tank 3-4).4.Restriction Enzyme Digestion(A)
Volume/ul | |
---|---|
DNA (~50ng/uL)(actually, we use group 1&2 from step 2. today) | 80 |
Age I-HF | 1 |
10X CutSmart buffer | 9 |
Digest the ends of TRPC5 for ligation.
Since we have the PBX123 with sticky ends of Age I and Bcl I, we should digest TRPC5 with Age I enzyme and Bcl I.
Firstly, we digest TRPC5 with Age I (activity:100%).The system (total 90μL):
Incubate at 37℃ for two hours.
Then, we digest TRPC5 with Bcl I (activity:75%).
We add Bcl I enzyme (1μL) into the final system of the first digestion. Incubate at 50℃ for six hours.
Digest the product of plasmid purification (step 1. today).
We digest the product of plasmid purification of pick up single colonies of streak plate of colony PCR group9&11&15 to test its linking.
The system (total 20μL):
Volume/ul | |
---|---|
DNA(~50ng/ul) | 1 |
Bam HI-HF | 10.2 |
10X CutSmart buffer | 2 |
ddH2O | 16.8 |
Incubate at 37℃ for two hours.
5. Gel electrophoresis of the digestion of plasmid purification product of colonies PCR 9&11&15
As we digest the plasmid with only one enzyme, we only get linear 15k bp DNA. Obviously, group9&15 are positive.
6. Restriction Enzyme Digestion(B) and gel electrophoresis
We decide to digest the product of plasmid purification of colony PCR group 9&15 with Bam-HI and Bgl I to ensure they are exactly correct.
The system (total 20μL):
Bam HI-HF 0.2μL(activity:100%)
Bgl I 0.2μL(activity:100%)
DNA(~500ng/μL) 1.25μL
10×NEBuffer 2μL(3.1 buffer)
ddH2O 16.35μL
Incubate at 37℃ for two hours.
Gel electrophoresis of the product of digestion.
7. Restriction Enzyme Digestion purification E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol
Use 30μL ddH2O to elute DNA in the last process.
TRPC5 T5-GFP 1 72.6ng/Μl
TRPC5 T5-GFP 2 71.3ng/μL
8. Restriction Enzyme Digestion E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol
We digest PBX-123 with Age I to get the sticky end which can connected with TPRC5.
The system (total 50μL):
Age I-HF 2μL
DNA(~300ng/μL) 20μL(actually, we use PBX group 3.)
10×NEBuffer 5μL(CutSmart buffer)
ddH2O 23μL
Incubate at 37℃ for two hours.
9. Ligation (TRPC5 and PBX-123)
The system (total 20μL):
10×T4 DNA buffer 2μL
Vector(PBX123) 10μL(43.26ng)
TRPC5 1μL(55.26ng)
ddH2O 6μL
T4 DNA ligase 1μL
10. Transformation:
We transform the plasmid which we get in the step 9. Ligation into 25μL competent cell.
We also help Dr. Huang (our mentor) transform 3 plasmids into competent cell (each 25μL).
Then, we coat and incubate at 37℃for 16 hours.
29 th
Piezo plasmid construction
- Restriction Enzyme Digestion(PBX-123, Age I& Bcl I)
We digested PBX-123 with Age I to get the sticky end which can connected with TPRC5.
Then we use Bcl1 to digest.
The system (total 50μL):
Bcl I 2μL
DNA(~300ng/μL) 20μL (actually, we use PBX group 3.)
10×NEBuffer 5μL(CutSmart buffer)
ddH2O 23μL
Incubate at 50℃ for two hours.
The result is strange. The brightest band is larger than 10000.
Still, we extract the plasmid from the brightest band. Concentration:61.8ng/μl
Gel running of restriction enzyme digestion (PIEZO Gibson Ligation from colony PCR group 9&15, BamHI Bgl II)
The undigested ones showed more bands while digested one only showed one band which is really strange.
We ran the gel for two times and still got the same results.
3. Colony PCR (5 PIEZO Gibson colony &2 PIEZO Gibson control colony&Negative control ddH2O, PCR for GpA& PTRE)
Total 20μl
2xTaq 10μl
Template 5μl
Primer 1 1μl
Primer 2 1μl
DdH2O 3μl
Primers: GpA primers/PTRE primers
From the results, GpA can still be seen in ddH2O. The result is so strange. We don’t know how to explain.
4.Colony PCR (12 TRPC5 Ligation colonies&dd H2O)
Total 20μl
2xTaq 10μl
Template 5μl
TRPC5 Primer 1 1μl
TRPC5 Primer 2 1μl
ddH2O 3μl
The PCR results showed no correct one. We can’t see TRPC5 band.
The rightmost one: Digested PBX123 backbone for TRPC5 is the gel extraction from step 1(Conc. 61.8ng/μl).The band should be around 8000bp. While the result is larger than 10000bp. This indicates that the extracted plasmid is not right. </blockquote> 5. Restriction enzyme digest(PBX123 backbone for PIEZO, PIEZO, both MfeI&BamHI&PmeI)
- PBX123 backbone for PIEZO
Total 50μl
PBX123(~300ng/μl) 35 μl
10x Buffer 5 μl
DdH2O 7 μl
MfeI 1μl
BamHI 1μl
PmeI 1μl
- PIEZO
Total 50μl
PBX123(~570ng/μl) 20μl
10x Buffer 5 μl
DdH2O 22 μl
MfeI 1μl
BamHI 1μl
PmeI 1μl
6. Pick up single colonies
Since the results from the Colony PCR of TRPC5 ligation was not very promising, we pick up 6 colony from the plate. Add into 5ml Amp LB, shake at 37℃.
The signal colonies are picked for the PCR process to make sure that Colony PCR it self have nothing to do with the failure.
30th
Piezo plasmid construction
1. Enzyme digestion of PBX123(Age I and Bcl I for TRPC5)
PBX123(~300ng/μL) 30μL
Age I 1μL
CutSmart 5μL
ddH2O 14μL
Incubate in 37℃ for a whole night.
Add in Bcl I at 11:00, and move to 50℃.
Bcl I 1μL
Incubate in 50℃ for a 4 hours.
2. Gel electrophoresis of PBX123(Mfe I, BamH I and Pme I for piezo), PBX123(Age I and Bcl I for TRPC5) and Piezo
The PBX123(MfeI BamHI PmeI for piezo) and Piezo(digested) on the other gel was cut off for gel extraction
The concentration of the extraction:
PBX-123 40.8ng/μL
Piezo 28.4ng/μL
3. Plasmid extraction E.Z.N.A.® Plasmid DNA Mini Kit I Protocol - Spin Protocol
Plasmid extraction from the single colonies we picked up yesterday.
The concentration of the plasmids:
TRPC5 ligation 1 378.2ng/μL
TRPC5 ligation 2 347.8ng/μL
TRPC5 ligation 3 343.3ng/μL
TRPC5 ligation 4 441.5ng/μL
TRPC5 ligation 5 438.0ng/μL
TRPC5 ligation 6 431.0ng/μL
4. TRPC5 PCR
We add in the primer of TRPC5 and try to make TRPC5 PCR from the ligation plasmid we extracted from the single colonies.
We also make two control groups, positive control group from the original TRPC5 T5-GFP plasmid we got, and negative control group from ddH2O.
rTaq premix 5μL
Templet 1μL
Primer1 0.5μL
Primer2 0.5μL
ddH2O 3μL
5. Gel electrophoresis of the PCR products and the gel extraction products.
Nothing, even with the positive control group from the original TRPC5 T5-GFP plasmid we got, have shown the right result (some brightness around 3000bp).
6. Gibson assembly of Piezo and PBX123
Gibson Assembly® Master Mix – Assembly (E2611)
Gibson group (10ul) | Control group1 (10ul) | Control group2 (10ul) | Control group3 (10ul) | |
---|---|---|---|---|
Piezo (28.4ng/ul) | 2.5ul | |||
pBX-123 (40.8ng/ul) | 1.5ul | 1.5ul | 1.5ul | 1.5ul |
pTRE-3G (102.5ng/ul) | 0.13ul | 0.13ul | ||
GpA (122.7ng/ul) | 0.11ul | 0.11ul | ||
Gibson mix | 5ul | 5ul | 2.5ul | 5ul |
ddH2O | 0.76ul | 3.26ul | 1ul | 1ul |
7. Enzyme digestion of PBX123(Age I and Bcl I for TRPC5)(2nd)
PBX123(~300ng/μL) 30μL
Bcl I 1μL
3.1 5μL
ddH2O 14μL
Incubate in 50℃ for a 4 hours.
Conduct DNA extraction with Cycle-Pure Kit, use 45μL ddH2O to elute the DNA.
The DNA concentration was 92.5ng/μL.
DNA extraction 45μL
Age I 1μL
CutSmart 5μL
Incubate in 37℃ overnight.
8. Transformation
We transform the plasmids which we get in Gibson assembly into 33μL competent cell(1 gibson system and 4 control systems).
We also transform PBX090 and PBX123 to get more plasmid for further use.
31th
Piezo plasmid construction
- Gel electrophoresis of digested PBX123(Age I and Bcl I for TRPC5)(2nd)
- Colony PCR
Before colony PCR, we remove the plate of PBX123 from incubator to cold room.
We pick up 20 single colonies from the plate of Gibson group, 2 colonies from both control group 1 and 2. There are no colonies on plates of control group 3 and PBX090.
The system of colony PCR(use primers of poly A and pTRE):
Primer1 0.5μL
Primer2 0.5μL
Bacterial liquid 5μL
rTaq premix 6μL
We use original PBX123 to substitute the Bacterial liquid in positive control group 1.
We use poly A or pTRE that we get from the original PBX123 by PCR process to substitute the Bacterial liquid in positive control group 2.
We use ddH2O to substitute the Bacterial liquid in negative control group.
95℃ | 30s | ||
98℃ | 10s | \ | |
50℃ | 10s | x30 cycles | |
72℃ | 100s | / | |
72℃ | 120s | ||
16℃ | ∞ |
3. Gel electrophoresis of colony PCR (step 2.)
Obviously, every Gibson group are negative.
4. Enzyme digestion of PBX133(Bcl I and Age I, Nhe I, Xba I )
We suspect the availability of our Bcl I enzyme, so we digest this new backbone with another tube of Bcl I, and set a group digested by our enzyme to test its availability.
The system of digestion (by Bcl I of HW) (total 100μL):
Template(~200ng/μL) 50μL
Bcl I 5μL
NEBuffer(3.1) 10μL
ddH2O 35μL
Incubate in 50℃ for 1 hour.
The system of digestion (by Bcl I of IGEM)(total 10μL):
Template(~200ng/μL) 2.5μL
Bcl I(IGEM) 0.25μL
NEBuffer(3.1) 1μL
ddH2O 6.25μL
Incubate in 50℃ for 3.5 hours.
Conduct DNA extraction with Cycle-Pure Kit, use 50μL ddH2O to elute the DNA.
The DNA concentration was ng/μL.
The system of digestion (by Age I, Nhe I, Xba I )(total 50μL):
DNA extraction 42μL
Age I 1μL
Nhe I 1μL
Xba I 1μL
NEBuffer(CutSmart) 5μL
Incubate in 37℃ overnight.
5. Gel electrophoresis of PBX133 digested by Bcl I(after incubating for 1 hour) (step 4.)
From the result we can ensure our enzyme is available.
Feb.
01 st
Piezo plasmid construction
1. Gel running of 4 enzymes digestion
Digestion sites: Bcl I,Age I,Nhe I,Xba I
2. Gel Extraction E.Z.N.A.® Gel Extraction Kit - Spin Protocol
We use the rest digested product to do gel extraction of cut PBX133(After 4 enzymes digested) Concentration:39.7 ng/μl
3. Transformation of enzyme digested products
14 th
TRPC5 plasmid construction
1. Enzyme digestion of TRPC5(T5-GFP and IRES-GPF)
Volume/ul | |
---|---|
TRPC5(~400ng/ul) | 0.5 |
Not I | 0.2 |
10X CutSmart buffer | 1 |
ddH2O | 8.3 |
Total | 10 |
Incubate in 37℃ for 3 hours.
2. TRPC5 PCR(T5-GFP and IRES-GPF)
Volume/ul | |
---|---|
Template | 1 |
Primer1 | 2.5 |
Primer2 | 2.5 |
Q5 hotstart 2X Master Mix | 25 |
ddH2O | 19 |
40 cycles
3. Make petro dishes.
We make 10 LB K+ petro dishes,75 Amp+ petro dishes and 14 LB petro dishes while waiting.
4. Gel electrophoresis of TRPC5
The expected brightness (~3k bp) appeared with TRPC5 T5-GFP PCR.
But TRPC5 PCR purification group 4, which we did with the same process as TRPC5 T5-GFP PCR. Did not have the same brightness. So we decided to do another Gel electrophoresis process tomorrow.
5. PCR purification of TRPC5 PCR products (T5-GFP and IRES-GPF)
E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol
The concentration of the products (diluted with 40μL ddH2O):
TRPC5 T5-GFP 105.2ng/μL
TRPC5 IRES-GPF 38.8ng/μL
6. Enzyme digestion of TRPC5 T5-GFP PCR purification product
Since we have the expected brightness (~3k bp) appeared with TRPC5 T5-GFP PCR, we carry on with the experiment. And started the enzyme digestion. Because Bcl I only have 75% activity in CutSmart buffer. So we decided to leave it overnight.
Volume/ul | |
---|---|
TRPC5 T5 GFP(~102ng/ul) | 30 |
Bcl I | 2 |
CutSmart | 5 |
ddH2O | 13 |
Total | 50 |
Incubate in 50℃ for overnight.
15 th
TRPC5 plasmid construction
1. Enzyme digestion of TRPC5(T5-GFP-Age 1)
Add 2 μL Age 1 into the system of last-night enzyme digestion.
Incubate in 37℃ for 2 hours.
2. Enzyme digested product purification of TRPC5
E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol
The concentration of the products (diluted with 30μL ddH2O):
TRPC5 T5-GFP 58.8 ng/μl
3. Gel electrophoresis of used TRPC5
As we can see, the expected brightness (~3k bp) also appeared. It means that our TRPC5 PCR purification product is no problem, while the other four T5 products which were did before all have problem. So the four can’t be used, we will go deep by using the new TRPC5 PCR purification product.
4. Ligation of TRPC5 and PBX133 backbone T4 DNA Ligase(M0202)
Volume/ul | |
---|---|
10* T4 DNA Ligase Buffer | 2 |
Vector DNA | 3 |
Insert DNA | 2 |
T4 DNA Ligase | 1 |
ddH2O | 12 |
Total | 20 |
Gently mix and let it in room temperature for 20 minutes.
Heat inactive at 65℃ for 10 minutes and put it in -20℃ for 4 hours.
5. Transformation of TRPC5 plasmid
Competent cells/ul | DNA/ul | |
---|---|---|
TRPC5-pBX133 Ligation 1 | 33 | 5 |
TRPC5-pBX133 Ligation 2 | 33 | 5 |
pBX133 backbone | 33 | 5 |
Results :
The results are not so good. There are many kinds of passible reasons which we will go to confirm one by one tomorrow.
16
TRPC5 plasmid construction =
- Learn to design primer from Prof. Huang.
- Make new Amp+ agar plate.
- Spread 12μl 50mg/ml Amp+ (sodium salt) to the plate made in Feb.24
- Put the plate to 25℃ for 3 hours
- Examination of experiment and propagation of 090
Amp+ New plate(2016.2.16):
Competent cells/ul | DNA/ul | |
---|---|---|
TRPC5-pBX133 Ligation 1 | 25 | 5 |
pBX133 backbone 1 | 25 | 5 |
TRPC5-pBX133 Ligation 2 | 25 | 1 |
pBX133 backbone 2 | 25 | 1 |
Control | 25 | 0 |
Amp+ Old plate(2016.2.14):
Competent cells/ul | DNA/ul | |
---|---|---|
pBX133 backbone 1 | 25 | 5 |
TRPC5-pBX133 Ligation 2 | 25 | 1 |
pBX133 backbone 2 | 25 | 1 |
Control | 25 | 0 |
Amp+ Former plate(2015):
Competent cells/ul | DNA/ul | |
---|---|---|
TRPC5-pBX133 Ligation 1 | 25 | 5 |
K+ plate(2016.2.14):
Competent cells/ul | DNA/ul | |
---|---|---|
090 | 25 | 5 |
Control | 25 | 0 |
Results:
Amp+ New plate(2016.2.16):
Amp+ Old plate(2016.2.14):Amp+ Former plate(2015):
K+ plate(2016.2.14):
Discussion:
Compare new and old plate, it comes out that some is wrong with the plate for its antibiotic function.
We thinks there may be two reason for this:
1.the antibiotics is inactived.
2.there is some distribution problem in the production of plate.
3.there is some concentration issue with the antibiotic.
There is also some problem with the ligation of TPRC6 and PBX133 backbone.
17 th
TRPC5 plasmid construction
- To check whether Ampicillin and Kanamycin are effective
- Add 1 μl Ampicillin solution to each LB agar plate and spread.Add 1 μl Kanamycin solution to each LB agar plate and spread.
- 2 Let them stay for 3 hours.
- 3 Add 25 μl competent cell to each plate. Incubate for 16 hours in 37 ℃
- Result:There is no any colony in each plate. So Ampicillin and Kanamycin are effective.
- TRPC5 primer design
3. Make Amp+ and K+ LB agar plates.
We made 2*500ml LB agar. Add 500μl 1000x Amp+ in one and add 500 μl 1000x K+ in the other. We poured 15 K+ plates and 13 Amp+ plates.
18 th
TRPC5 plasmid construction
- Modify the previous designed primers,based on following defects
- Protection bases are too short,should be 4~6 bases.
- The temperature of matching pieces is too low,should be 55~65℃,and the Tm of primer should be 75~85℃.
- The number of bases between start codon and stop codon of final ligation product should be the fold of 3.
- Modified primers:
J23100-sfgfp-pBX123-piezo-primer
primer1:5'-AGAC ACCGGT TCTAGA CTAGAGTCGCGGCCGCTTTACTTGTA- 3'
AgeI XbaI Tm 62.6
primer2:5'-TACG GGATCC TTA T GGCGCGCC TTGATATCGAGCTCTTGACGGCTAGC- 3'
BamHI AscI Tm 60.9 J23100-sfgfp-pBX123-TRPC5-primer
primer1: 5'-AGAC ACCGGT GAATTC CTAGAGTCGCGGCCGCTTTACTTGTA- 3'
AgeI EcoRI Tm 62.6
primer2: 5'-TACG GGATCC TTA T GCGGCCGC TTGATATCGAGCTCTTGACGGCTAGC- 3'
BamHI NotI Tm 60.9
2. Amplify PBX-123 backbone
Backbone 1μL+competent cell 33μL (3 tubes)
Results:All 3 culture dishes don’t grow colony.
Discussion:Maybe the concentration of PBX-123 backbone is too low,so we increase the concentration.(2016.02.19)
3. Enzyme digestion of PBX-123 backbone(previous extracted PBX-123) 2 tubes,each 3μL
NotI/ul | 1 |
CutSmart/ul | 5 |
pBX123 /ul | 3 |
ddH2O | 41 |
Total/ul | 50 |
Purification of PBX-123(30μL system,2 tubes)
Results:
①13.7ng/μL A260/280: 1.6
②20.6ng/μL A260/280: 1.4
4. Add Klenow Fragment to create blunt ends(2 tubes)
Klenow Fragment: 5units/μL
DNA Polymerase I, Large (Klenow) Fragment(M0210S)
Protocol(combine the NEB and Chinese protocol):
①
Total | 40 | Final |
---|---|---|
10X NEBuffer2 | 4 | |
dNTP(2.5mM) | 0.6 | 33uM |
pBX123 | 27.5 | 20~30ul(0.2~8ug) |
Klenow Fragment | 0.1 | 0.4~1.6ul (2~8unit) 1 unit per ugDNA |
Control | 7.8 |
②Incubate 15min at 25℃
③Incubate 30min at 75℃
5. Gel electrophoresis of 2 tubes blunt-ended PBX-123
Marker: DL10000
Results: Both 2 bands are near 10000bp and at the same site,which means the two bands are both blunt ends or sticky ends,we need to confirm after extracting the plasmid.
(We forgot to take a picture of the gel)
19 th
TRPC5 plasmid construction
1. Gel cutting and extraction of PBX-123 Klenow Fragment products
(30μL system)
Concentration:7.6ng/μL, A260/280: 1.55
2. Ligation of PBX-123 blunt end T4 DNA Ligase(M0202)
Volume/ul | |
---|---|
Total | 30 |
10X Buffer | 3 |
DNA | 25 |
T4 DNA Ligase | 2 |
Amplify PBX-123 backbone,transform,select single colony and shake colony(4 tubes)
Results:
PBX-123/ μl | Competent cell/ μl | Colonies |
0 | 25 | 0 |
5 | 25 | 10+ |
15 | 25 | 2 |
25 | 25 | 1 |
Discussion:
The number of colonies decreases as the concentration of PBX-123
backbone increases,which is strange,so we need to do a gel running after
extracting the plasmid to confirm whether the PBX-123 has problem.
4. Ligation product transform,select single colony and shake colony (1 tubes)
Results: only one culture dish grows 1 colony
---
20 th
TRPC5 plasmid construction
1. PBX123 and PBX123(NotI-cut ligation) plasmid extraction
AxyPrep Plasmid Miniprep Spin Protocol
Final volume: 70 ul each tube
PBX-123 NotI-cut | 249.3ng/ul |
PBX-123 plasmid1 | 299.1ng/ul |
PBX-123 plasmid2 | 213.6ng/ul |
PBX-123 plasmid3 | 252.9ng/ul |
PBX-123 plasmid4 | 360.3ng/ul |
2. Breed preservation :
500ul bacterial : 500ul glycerol each tube
PBX-123 NotI-cut | 1 ml | -8℃ 107 |
PBX-123 plasmid1 | 1 ml | -8℃ 107 |
PBX-123 plasmid2 | 1 ml | -8℃ 107 |
PBX-123 plasmid3 | 1 ml | -8℃ 107 |
PBX-123 plasmid4 | 1 ml | -8℃ 107 |
3. NotI digest and transform (2 tubes)
NotI/ul | 1 |
CutSmart/ul | 5 |
pBX-123/ul | 3 |
ddH20/ul | 41 |
Total/ul | 50 |
Purification: 40 ul system
Results: ① 18.1 ng/μL A260/280: 1.64
Transform 3 plates (Amp+)
4. He Yuhao repeats PBX123 NotI-cut:
NotI digest: 2 tubes
NotI/ul | 1 |
CutSmart/ul | 5 |
pBX-123/ul | 3 |
ddH20/ul | 41 |
Total/ul | 50 |
Purification: 30 ul system each
Results: ① 25 ng/μL A260/280: 1.70
② 23 ng/μL A260/280: 1.66
21 th
TRPC5 plasmid construction
1.Select single colony
All 3 culture dishes grow many colonies,but we still need to do colony
PCR to confirm they are blunt-ended.Ling Shaohua has designed the primer
for colony PCR,we need to ask Pro.Huang whether it’s right.
So we select 10 colonies,each with 10ul Amp+ LB broth and store at cold
room.When the primer is verified and synthesized,we will do colony PCR
and extract plasmid from those colonies which are confirmed to be right.
22 th
TRPC5 plasmid construction
1.Enzyme double digestion of HindIII-HF,Not I-HF. 37 ℃, 3hrs
Volume/ul | |
---|---|
pBX-123 Not I-cut plasmid(~249ng/ul) | 4 |
CutSmart buffer(10X) | 5 |
HindIII-HF | 1 |
NotI-HF | 1 |
ddH2O | 39 |
Volume/ul | |
---|---|
pBX-123 Not I-cut plasmid(~252ng/ul) | 4 |
CutSmart buffer(10X) | 5 |
HindIII-HF | 1 |
NotI-HF | 1 |
ddH2O | 39 |
24 th
TRPC5 plasmid construction
1. TRPC5 enzyme digestion
We cut the TRPC5 PCR gel extraction from day 2.16 to give it a shot.
Only 23μL DNA left inside the tube.
Volume/ul | |
---|---|
DNA | 23 |
CutSmart buffer(10X) | 5 |
BclI | 1 |
ddH2O | 39 |
Total | 50 |
2. Transformation:
We transform PBX133 PBX090 and Piezo to propagate them for further use.
We use the micropipette to inhale and blow the liquid inside Piezo for the plasmid sample, and add it to 33μL competent cells.
We add 2.5μL PBX133 and 2.5μL PBX090 to 33μL competent cells.
We coat and incubate at 37℃for 16 hours.
April
13 th~24 th
087&NFAT Plasmid Construction
Restriction Enzyme Digestion for Verification
Gel Extraction Sequencing Result:Correct
04.24~05.06 TRPC5 Plasmid Construction
06.15~06.30 Restriction Enzyme,Ligase and Transformation Efficiency Test sfgfp PCR and Gel Extraction
Transformation ResultJuly
0 1 st
Efficiency Tests
Transformation efficiency (3 groups)
Competent cell/ul | sfGFP plasmid/ng | sfGFP plasmid/ul |
---|---|---|
33 | 45.88 | 0.3 |
Enzyme digestion efficiency (3 groups)
Competent cell/ul | sfGFP digested/ng | sfGFP digested/ul |
---|---|---|
33 | 45.88 | 1.9 |
1>Prepare digestion system:
Amount/ ul | |
---|---|
DNA | 2.4 |
AflII | 1 |
EcoRI | 1 |
CutSmart(NEB) | 2.5 |
ddH2O | 18.1 |
Total | 25 |
Incubate at 37℃,6hrs.
Ligation efficiency (3 groups)
Competent cell/ul | sfGFP plasmid ligated/ng | sfGFP plasmid ligated/ul |
---|---|---|
33 | 41.67 | 3.3 |
1> Prepare ligation system T4 DNA Ligase(M0202)
Vector | 0.02pmol |
Insert | 0.08pmol |
T4 ligase | 1ul |
T4 ligase buffer 10X | 2ul |
ddH2O | to 20ul |
Total | 20ul |
Incubate at room temperature for 20mins
Transformation & Competent cell recovery
1. Get competent cell (DH5α) from -80℃,lay on ice for 15mins till melted.
2. Add plasmids according to the table above, gently blow to mix well.
3. Incubate on ice for 30mins.
4. Incubate in 42℃ water bath for 90s.
5. Lay on ice for 5mins.
6. Add 300μl LB, 37℃, 220rpm for 20mins.
7. Add 300μl Amp+ LB, 37℃, 220rpm for 20mins.
8. Centrifuge at 5000rpm, 1min. Drop 400μl suspension.
9. Mix the left 200μl gently, spread plate.
NOTE:
- For ligation products, subpackage of competent cell may decrease the final efficiency.
- During transformation, after heat shock, competent cell should be spread on preheated agar plate (37℃) to reach a higher transformation efficiency.
02 nd
Efficiency tests results:
Green colony number | Non-green colony number | |
---|---|---|
Transformation 1 | >1000 | 24 |
Transformation 2 | >1000 | 32 |
Transformation 3 | >1000 | 21 |
Digestion1 | 0 | 382 |
Digestion2 | 1 | 370 |
Digestion3 | 0 | 400 |
Ligation1 | 0 | 300 |
Ligation2 | 4 | 302 |
Ligation3 | 0 | 267 |
NOTE:
Too many non-target bacterial colonies(non-green).
Efficiency tests failed.
Non-green colony test (I)
Pick 1 non-green colony on each plate.
Mix with 20μl ddH2O
Get 10μl add into 5ml Amp+ LB to incubate at 37℃, 220rpm for <16hrs.
Get 10μl to do colony PCR:
1> Primer
Forward -- AACGTATAAGCTTTAGGCGTGTACG
Reverse -- TTGTGCACCAGTCATAGCCGAATAG
2> Polymerase Chain Reaction (PCR)system</ul>
Q5® High-Fidelity 2X Master Mix(M0492S)
Amount/ul | |
---|---|
Q5 Master Mix 2X | 12.5 |
Colony mixture | 10 |
PrimerF | 1 |
PrimerR | 1 |
ddH2O | 0.5 |
Total | 25ul |
3> PCR setting
STEP | TEMP | TIME |
---|---|---|
Initial Denaturation | 98℃ | 30s |
30 Cycles | 98℃ | 10s |
30 Cycles | 50-72℃ | 20s |
30 Cycles | 72℃ | 20s |
Final Extension | 72℃ | 2mins |
Hold | 10℃ | ∞ |
4> Gel electrophoresis
03 th
Non-green colony test (II)
1. Use E.Z.N.A.TM Plasmid Mini Kit(Omega D6942-02) to purified plasmids.
According to E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol
Test the concentration ( Eppendorf BioSpectrometer)
Use another pairs of primers to do PCR
Primer Forward -- CTAGAGTCGCGGCCGCTTTACTT
Primer Reverse -- TCGAGCTCTTGACAGCTAGCTCA
4.Double-enzyme digestion
Non-green plasmid | 200ng |
AflII | 1ul |
EcoRI | 1ul |
CutSmart(NEB) | 2ul |
ddH2O | to 20ul |
Total | 20ul |
5. Gel electrophoresis
04 th
Non-green colony test (III)
1.Enzyme digestion
DNA | 200ng |
ScaI | 1ul |
CutSmart(NEB) | 2ul |
ddH2O | to 10ul |
Total | 10ul |
2. Gel electrophoresis
06 th
1.Enzyme digestion
Non-green plasmid | 200ng |
ScaI/XbaI/XhoI | 1ul |
CutSmart(NEB) | 2ul |
ddH2O | to 20ul |
Total | 20ul |
2. Gel electrophoresis
07 th-10 th
New plasmids design:
- TRPC5-Loxp
- Sfgfp-pBX123
- pBX097-neoloxp
11 th
TRPC5-Loxp Plasmid Construction(I)
1. TRPC5-R plasmid enzyme digestion
TRPC5-R | 2ug |
DraIII | 1ul |
CutSmart(NEB) | 2ul |
ddH2O | to 20ul |
Total | 20ul |
2. Gel electrophoresis for gel extraction
DraIII digestion site:
12 th
TRPC5-Loxp Plasmid Construction(II)
1.TRPC5-L and TRPC5-R PCR
Primer F -- TTGGCAAAGAATTCCTCGAGG
Primer R -- GCCGATCATGCTGATATTGAGT
2.Gel electrophoresis for gel extraction
3.Gel Extraction (According to Gel Extraction protocol )
4.TRPC5-L plasmid re-synthesis
13 th
pBX097-neoloxp construction(I)
Neoloxp PCR from pBX123 plasmid
3. Test product’s concentration
4.Double-enzyme digestion and pBX097 plasmid enzyme digestion
pBX097/neoLoxP | 3ug |
MfeI | 1ul |
BamHI | 1ul |
CutSmart(NEB) | 5ul |
ddH2O | to 50ul |
Total | 50ul |
5.Gel electrophoresis
16 th - 21 th
pBX097-neoloxp construction(II)
1.Ligate the pBX097 and neoloxp with T4 DNA Ligase(M0202) and Quick Ligation
2.DNA transformation
Result: None colony
TRPC5-Loxp Plasmid Construction(III)
TRPC5-R PCR product double-enzyme digestion (AflII; KpnI) overnight
TRPC5-L synthesis products transformation
TRPC5-L plasmid purification
TRPC5-L plasmid enzyme digestion (AflII; KpnI) overnight
Ligation of TRPC5 left and right (T4 DNA ligase)
Spread plate, incubate at 37℃ for <16hrs
Pick single colony, incubate in 15ml Amp+ LB for 16hrs at 37℃
Separate the culture into 5ml(to prove); 9.5ml(for endofree); 0.5ml (for
preservation in -80℃)
Single-enzyme digestion (PvuI; BamHI) and gel electrophoresis
Correct
pBX123-sfGFP construction
- sfGFP PCR
- Pbx123 double-enzyme digestion
3. Double-enzyme digestion ( AgeI; BamHI ) of sfGFP Overnight
4.Gel Extraction protocol and E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol
5. Ligation of sfGFP and pBX123 backbone
6. Spread plate incubate at 37℃, <16hrs
7. Pick 8 colonies incubated in 5ml Amp+ LB each, at 37℃ 220rpm for <16hrs
8. Plasmid purification
E.Z.N.A.® Plasmid DNA Mini Kit I Protocol
9. Double enzyme digestion for proof (AflII; EcoRI)
10.Gel electrophoresis
22 th - 23 th
pBX097-neoloxp construction(II)
1.Ligate the pBX097 and neoloxp with T4 DNA Ligase(M0202)
2.DNA transformation
Result: 7 colonies
3. Pick colonies to 5ml Amp+ LB, incubate at 37℃, 220rpm for <16hrs.
4. Plasmid extraction with Plasmid Mini Kit (Omega)
5.Single-enzyme digestion
pBX097/neoLoxP | 200ng |
AflIII/ScaI | 1ul |
CutSmart(NEB) | 2ul |
ddH2O | to 20ul |
Total | 20ul |
Incubate at 37℃, overnight.
24 th - 25 th
pBX097-neoloxp construction(II)
1.Gel electrophoresis
Result: pBX097-neoloxp successfully constructed.
26 th - 30 th
TRPC5-Loxp Plasmid Construction(IV)
1.TRPC5-Loxp endofree plasmid purification.
2.pBX097-neoloxp and TRPC5 sequencing
Primer for TRPC5---GCCGATCATGCTGATATTGAGT
Primer for pBX097-neoloxp---GGCAACGTGCTGGTTATTGTGC
Aug.
01 st - 02 nd
pBX123-sfGFP Efficiency test
pBX123-sfGFP Efficiency Test(AflII, EcoRI) | Transformation |
pBX123-sfGFP Efficiency Test(AflII, EcoRI) | Enzyme digestion |
pBX123-sfGFP Efficiency Test(AflII, EcoRI) | Ligation |
Repeat the experiments steps mentioned in 7.1
03 rd - 04 th
pBX123-sfGFP enzymes’ digestion sites ligation ability
Groups | Combination |
---|---|
1 | AgeI+BamHI |
2 | AgeI+AflI |
3 | EcoRI+BamHI |
4 | EcoRI+AflI |
1> Prepare digestion system, incubate overnight
2> Gel Extraction protocol to get different fragments
3> Ligation of T4 DNA Ligase(M0202)
4> Transformation
Results:
Groups | Colony number |
---|---|
AgeI+BamHI | 0 |
AgeI+AflI | 0 |
EcoRI+BamHI | non-green |
EcoRI+AflI | non-green |
05 th
TRPC5-loxp sequencing results:
TRPC5-(1) | 1 mismatch |
TRPC5-(2) | Correct |
TRPC5-(3) | 1 Failed |
TRPC5-(4) | 1 Correct |
pBX097-neoloxp sequencing results:
097-neoLoxP-(1) | Correct |
097-neoLoxP-(2) | Correct |
097-neoLoxP-(3) | 3 mismatches |
06 th - 07 th
Non-green colony PCR
09 th
Change NFAT-YFP to NFAT-EGFP(I)
Double enzyme digestion (AgeI, BamHI) pBX123 to get EGFP fragment
Double enzyme digestion (AgeI, BamHI) NFAT-YFP to get backbone Overnight
10 th
Change NFAT-YFP to NFAT-EGFP(II)
Gel Extraction protocol for EGFP and NFAT backbone
Ligation by T4 DNA Ligase(M0202)
Transformation
11 th - 13 th
Change NFAT-YFP to NFAT-EGFP(II)
- Pick single colony to culture in 15ml Amp+ LB for 16hrs
- E.Z.N.A.® Plasmid DNA Mini Kit I Protocol to get purified plasmid
- Enzyme digestion to prove
- Send to sequencing
22 th
TRPC5 Random mutagenesis(I)
TRPC5 Random mutagenesis | Megaprimer PCR |
TRPC5 Random mutagenesis | Gibson |
TRPC5 Random mutagenesis | Enzyme Digestion |
Megaprimer PCR
1> Pre-experiments: T5 exonuclease digestion level according to time.
a. Use PrimerStar to do PCR of TRPC5 mutation region (~640bp)
b. Gel extraction to get TRPC5 mutation region
c. Set a series gradients of T5 digestion time: 0, 5, 10, 20mins
T5 exonuclease digestion time | groups |
---|---|
5 mins | 1,2 |
10 mins | 3,4 |
20 mins | 5,6 |
d. EDTA preparation
To get EDTA solution with final concentration of 11mM (Planing to add 1μl solution into
50μl to stop reaction). We should get 540mM stock solution.
- Weigh 1.08g EDTA powder add into 5ml ddH2O
- Use magnetic stirring bar to help dissolve
- Add NaOH powder to adjust solution’s PH until dissolved completely
- Use 0.22μm filter to filtrate the solution
- store in -20℃
- Use 0.22μm filter to filtrate the solution
- Add NaOH powder to adjust solution’s PH until dissolved completely
- Use magnetic stirring bar to help dissolve
Note: To keep T5 exonuclease digestion time as precise as possible, according to its protocol, we use EDTA to stop the digestion. e. T5 digestion (according to T5 exonuclease protocol)
T5 exonuclease | 3.4ul |
NEB4.0 Buffer | 5ul |
TRPC5 region | 3.4ug |
ddH2O | to 50ul |
Total | 50ul |
f. Take group①②③for gel extraction; ④⑤⑥for cycle pure.
23 th
Megaprimer PCR 1> Send ④⑤⑥ to sequence Primer F:ATCCGAATTCCCCTCCAAATC Primer R:TATGTTAAGTTCCCAGCCCAG 2> Megaprimer PCR:
- Use Q5® High-Fidelity 2X Master Mix(M0492S), System 50μl, Tm=65℃
- E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol to get purified PCR products.
- Use DpnI to digest plasmids that come from bacteria (methylated sites)
- Transformation of digested products.
- Use DpnI to digest plasmids that come from bacteria (methylated sites)
- E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol to get purified PCR products.
24 th
Megaprimer PCR results of different digestion time and ratios of templet and
primer:
TRPC5 mutation region PCR
TPRC5 preserved bacteria plate streaking
DpnI digestion time experiment: “Whether 100ng plasmid can be digested completely by 1μl DpnI in 25μl, for 1h”
Result:
25 th
Megaprimer PCR
- To find out the best annealing temperature for megaprimer. Set a series of annealing temperatures: 55, 60,65,70℃
- Repeat PCR
- E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol to get purified PCR products.
- DpnI digestion
- Transformation
26 th
Megaprimer PCR results of different digestion time;PCR annealing temperatures and ratios of templet and primer:
Colony number according to different annealing temperatures and ratios of templet and primer:
PCR Annealing TEMP | Primer:Template= 1:1 | Primer:Template= 1:2 |
---|---|---|
55℃ | 125 | 44 |
60℃ | 120 | 100 |
65℃ | 116 | 58 |
70℃ | 168 | 76 |
Sequencing results of T5 exonuclease digestion level according to time:
T5 Exonuclease digestion time | 5' end digest number/bp | Direction |
---|---|---|
5mins | 48 | Forward |
5mins | 43 | Reverse |
10mins | 176 | Forward |
10mins | 166 | Reverse |
Repeat T5 exonuclease digestion level according to time:
Set series of time gradients: 0, 5, 7.5, 10mins
a. T5 digestion (according to T5 exonuclease protocol)
T5 Exonuclease | 3.4ul |
NEB4.0 Buffer | 5ul |
TRPC5 region | 3.4ug |
ddH2O | to 50ul |
Total | 50ul |
b. Take each group for Gel electrophoresis
c. Send each group to sequence
Primer F:ATCCGAATTCCCCTCCAAATC
Primer R:TATGTTAAGTTCCCAGCCCAG
28 th
Sequencing results of T5 exonuclease digestion level according to time:
T5 Exonuclease digestion time | 5' end digest number/bp | Direction |
---|---|---|
5mins | 42 | Forward |
5mins | 43 | Reverse |
7.5mins | 104 | Forward |
7.5mins | 96 | Reverse |
10mins | 188 | Forward |
10mins | 156 | Forward |
29 th
Culture medium Pollution proving:
Set 4 groups of experiments (use sfGFP plasmid):
30 th
Culture medium Pollution proving results:
Group 3 number > Group 1 number ; with lots of non-green bacteria
Group 4 has >100 colonies of non-green bacteria
Group 2 has no colony
Conclusion: Culture medium has been polluted.
Gibson assembly (pre-experiment)
1> Directly cut the mutation region by AflII and EcoRI for 8hrs
2> Gel extraction to get the 640bp fragment
3> Use Gibson Assembly® Master Mix to get whole plasmid
4> Transformation
31 th
1.Gibson assembly result: NONE colony
2.Random mutagenesis with Kit, according to Random mutagenesis protocol
Sept.
01 st
Design qPCR Primers and Send for Synthesization
Sequences:
1.097&NeoLoxP qPCR-1st
2. qPCR Internal Positive Control
04 th
Gibson Assembly® Master Mix
Insert : vector=2 : 3(50~100ng vector)
Reagent | Volume/ul(for 20bp) | Volume/ul(for 30bp) | fmol |
---|---|---|---|
Vector | 1 | 1 | 19.4 |
Insert | 8.6 | 3.1 | 58.2 |
2X Master Mix | 10 | 10 | |
ddH2O | 0.4 | 5.9 | |
Total | 20 | 20 |
T5 Exonuclease Digestion
Temperature: 50℃
20bp) | 30bp | |
---|---|---|
Digestion time/min | 40 | 60 |
Transformation into Competent Cells
5μl product are transformed with 50ul competent cells.
Error-prone PCR(low frequency)
1. Information supplied with Random mutagenesis protocol
(Agilent Technologies,Catalog #200550):
2. Primers sequence:
Forward: ttactcaccatacagagatcgaattcc
Reverse: ttttccactttgctcagctccttaag
Target DNA mass: 500ng,corresponding to low frequency mutation
Reagent | Volume/ul |
---|---|
ddH2O | 9.5 |
dNTP mix | 1 |
Mutazyme II DNA polymerase | 1 |
Forward Primer | 1 |
Reverse Primer | 1 |
Template | 31.5 |
10X Mutazyme II reaction buffer | 5 |
Total | 50 |
4. Procedure
The annealing temperature is set to be 57℃.
Gel Extraction protocol of ep-PCR Product
Concentration: 135ng/μl, 30μl
qPCR Primer Test
Instrument: ABI StepOne Plus qPCR
Kit: Power SYBR® Green PCR Master Mix and RT-PCR Reagents Kit
Sample:
CHO cell genomic DNA extracted from 4.5x106 cells.
Concentration: 56.1ng/μl, 400μl
Target:
Neoloxp segment, 18sRNA, GAPDH
Standard:
097&Neoloxp plasmid(length:6635bp)
Concentration: 101.2ng/μl
Stock Conc./ng*ul-1 | Volume/ul | Dilute Volume/ul |
---|---|---|
c(101.2) | 1 | 99 |
c/100 | 1 | 99 |
c/200 | 50 | 50 |
c/400 | 50 | 50 |
c/800 | 50 | 50 |
c/1600 |
4.
Reagent | Volume/ul | Final Conc. | Negative Control |
---|---|---|---|
ddH2O | 6.4 | 8.4 | |
2XSYBR® Master Mix | 10 | 10 | |
Forward Primer | 0.8 | 0.4 | 0.8 |
Reverse Primer | 0.8 | 0.4 | 0.8 |
Template | 2 | 0 | |
Total | 20 | 20 |
5. Procedure
05 th
Transformation Result
No colony
Possible reason: The transformation efficiency of self-made competent cells is quite low.
06 th
TRPC5 PCR with PrimeStar
1.Primers sequence:
Forward: ttactcaccatacagagatcgaattcc
Reverse: ttttccactttgctcagctccttaag
2.Total 8 tubes of PCR reaction:
Reagent | Volume/ul | Final conc./uM |
---|---|---|
ddH2O | 20.8 | |
2X Premix | 25 | |
Forward Primer | 1.5 | 0.3 |
Reverse Primer | 1.5 | 0.3 |
Template | 1.2(1ng) | |
Total | 50 |
3. Procedure
Temperature/℃ | Duration/seconds | Number of cycles |
---|---|---|
98 | 10 | 1 |
98 | 10 | |
55 | 10 | |
72 | 60 | 32 |
72 | 120 | 1 |
10 | ∞ |
Concentration: 180ng/μl, 30μl, total 4 tubes.
T5 Digestion for 3.5 minutes and E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol
Concentration: 60ng/μl, 50μl
Mega-primer PCR with KOD Polymerase
Template DNA: 0.1ng,
Mega-primer:Template=10000:1
Component | Volume/ul | Final Conc. |
---|---|---|
10X buffer#1 for KOD DNA Polymerase | 5 | 1X |
dNTP (2mM each) | 5 | 0.2mM(each) |
MgCl2(10mM) | 5 | 1mM |
Forward Primer(5pmol/ul) | 4 | 0.4uM |
Reverse Primer(5pmol/ul) | 4 | 0.4uM |
Template | Y | |
PCR Grade water | X | |
KOD DNA Polymerase(2.5U/ul) | 0.4 | 0.02U/ul |
Total | 50 |
Procedure:
Temperature/℃ | Duration/seconds | Number of cycles |
---|---|---|
98 | 30 | 1 |
98 | 20 | |
60 | 20 | |
72 | 180 | 30 |
72 | 120 | 1 |
10 | ∞ |
E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol and Gel Running
Concentration: 30ng/μl, 50μl
No 6000bp band is appeared,it’s a problem!!DpnI Digestion for 1 hour
5μl product are transformed with 100ul competent cells.
qPCR Primer Test
Instrument: Bio-Rad
Kit: TaKaRa-One Step SYBR PrimeScript RT-PCR Kit I
1. Sample:
CHO cell genomic DNA extracted from 4.5x106 cells.
Concentration: 56.1ng/μl, 400μl
2. Target:
Neoloxp segment, 18sRNA, GAPDH
3. Standard:
097&Neoloxp plasmid(length:6635bp)
Concentration: 101.2ng/μl
Stock Conc./ng*ul-1 | Volume/ul | Dilute Volume/ul |
---|---|---|
c(101.2) | 1 | 99 |
c/100 | 1 | 99 |
c/10000 | 2 | 18 |
c/100000 | 2 | 18 |
c/1000000 | 2 | 18 |
c/10000000 | 2 | 18 |
4.
Reagent | Volume/ul | Final Conc. | Negative Control |
---|---|---|---|
ddH2O | 6.4 | 8.4 | |
2XSYBR® Master Mix | 10 | 10 | |
Forward Primer | 0.8 | 0.4 | 0.8 |
Reverse Primer | 0.8 | 0.4 | 0.8 |
Template | 2 | 0 | |
Total | 20 | 20 |
Wrong: Forget to add ‘PrimeScript Enzyme Mix’ which contains ‘Taq enzyme’,thus no PCR reaction works.
5. Procedure
07 th
Transformation Result
No colony
Possible reason: The mega-primer PCR procedure didn’t work.
Mega-primer PCR with Q5
1.Template DNA: 0.1ng,
Mega-primer:Template=10000:1
Volume/ul | Volume/ul | ||||
---|---|---|---|---|---|
Reagent | No T5 Digestion | T5 digestion for 3.5min
- |
ddH2O | 18.4 | 17.1 |
2X Q5 mix | 25 | 25 | |||
Mega Primer | 0.6 | 1.9 | |||
Template | 6(0.1ng) | 6 | |||
Total | 50 | 50 |
2. Procedure
Temperature/℃ | Duration/seconds | Number of cycles |
---|---|---|
98 | 30 | 1 |
98 | 10 | |
60 | 30 | |
72 | 300 | 35 |
72 | 120 | 1 |
4 | ∞ |
qPCR Primer Test with Premix and Gel Running
1. Gel concentration: 2%(to better show the needed band)
2.
Reagent | Volume/ul | Mass/ng | |
---|---|---|---|
ddH2O | X | ||
2X Premix | 12.5 | ||
Forward Primer | 0.5 | ||
Reverse Primer | 0.5 | ||
Template | Y | 1ng for plasmid,640ng for gDNA | |
Total | 25 |
3. Procedure
Temperature/℃ | Duration/seconds | Number of cycles |
---|---|---|
98 | 60 | 1 |
98 | 20 | |
60 | 30 | |
72 | 20 | 30 |
72 | 120 | 1 |
10 | ∞ |
4. Results
The gel running results show that primer 1~4 and primer GAPDH has been contaminated,we need to use new primer and be care of experiment operation.08 th
Gel Running with 30μl mega-primer PCR product
There is a band at around 6000bp position!
DpnI Digestion for 1 hour
Reagent | Volume/ul |
---|---|
ddH2O | 3 |
DNA | 20 |
5X Buffer | 6 |
DpnI | 1 |
Total | 30 |
Transformation
10μl product are transformed with 100ul competent cells.
9 th
Transformation Result
Little or no colony is appeared,maybe the transformation efficiency of competent cell is still too low.
09.12 Pre-experiment of enzyme digestion and ligation
TRPC5 PCR with PrimeStar
Primers sequence
Forward Primer: atccGAATTCccctccaaatc
Reverse Primer: ATGATCTCCAGTTCTCTGGA
2. Total 2 tubes PCR reaction
Reagent | Volume/ul |
---|---|
ddH2O | 20.8 |
Forward Primer | 1.5 |
Reverse Primer | 1.5 |
2X Premix | 25 |
Template | 1.2(1ng) |
Total | 50 |
3. Procedure
Temperature/℃ | Duration/seconds | Number of cycles |
---|---|---|
98 | 10 | 1 |
98 | 10 | |
55 | 10 | |
72 | 60 | 32 |
72 | 120 | 1 |
10 | ∞ |
Gel Extraction
Concentration: 44.4ng/μl, 40μlEcoRI,SacI Restriction Enzyme Digestion
1. Insert
Reagent | Volume/ul |
---|---|
ddH2O | 1 |
DNA | 40 |
10X Buffer | 5 |
EcoRI | 2 |
SacI | 2 |
Total | 50 |
The digestion is from 00:20 to 09:00.
2. Vector
Reagent | Volume/ul |
---|---|
ddH2O | 11 |
DNA | 30 (5ug) |
10X Buffer | 5 |
EcoRI | 2 |
SacI | 2 |
Total | 50 |
The digestion is from 21:00 to 09:00.
qPCR Primer Re-design and Send for Synthesization
Sequences:
097&NeoLoxP qPCR-2nd
13 th
Transformation
Use the bought competent cell,with transformation efficiency of approximately 10^7.
Gel Extraction of Enzyme Digested Vector
Concentration of vector: 44.8ng/μl,20μl
Cycle-pure of Enzyme Digested Insert
Concentration of insert: 25.3ng/μl, 40μl
Ligation with T4 DNA Ligase
Volume/ul | Mass/ng | pmol | Control |
---|---|---|---|
2 | 2 | ||
1.4 | 62 | 0.02 | 1.4 |
1.1 | 28 | 0.06 | 0 |
14.5 | 15.6 | ||
1 | 1 | ||
20 | 20 |
The ligation is from 12:50 to 14:00.
Transformation
14 th
Transformation Result
Method | Colonies | Control |
---|---|---|
Q5 | 191 | 0 |
Gibson | 38 | 7 |
KOD | 0 | 0 |
Ligation | 1772 | 330 |
Positive Control | 237 |
Competent Cell Efficiency
1. Formula: Colonies on plate / ng of DNA plated x 1000 ng/μg
2. Calculation: 237 / 0.02 x 1000=1.185x107 cfu/μg
3. Actual meaning: 20pg,5640bp→3.457x106 copies
4. 457x106 / 237=14586,which means 1 of 14586 vectors would actually grow on the plate.
Ligation Efficiency
1. 62ng,4906bp→1.232x1010 copies
2. Efficiency=Mutation Library
1.Q5: 2.782x106
2.Gibson: 5.54x105
3. Ligation: 2.102x107
Repeat the pre-experiment on 09.12
Use enzyme digestion and ligation method to construct mutation library,except that using error-prone PCR,and the target DNA is 500ng.
15 th
qPCR Primer Test with Premix and Gel Running
1. Procedure is the same with the experiment on 09.07
2. Results:
2. Conclusion:I. Primer 1~4 are not good enough,cause they all can match with CHO cell’s gDNA and have PCR products.
II. Primer 2~4 are contaminated.
III. Primer GAPDH has unspecific PCR product,so it can’t be used.
Primer 18sRNA can be used.
18 th
Transformation
10μl positive ligation product are transformed with 125ul competent cells.For control group,5ul ligation product are transformed with 50ul competent cells.
qPCR Primer Test with Premix and Gel Running
1. We set 2 annealing temperature,which are 65℃ and 70℃ respectively.
2. Results:
3. Conclusion:
I. Primer 1~4 are all not contaminated and have specific PCR band with annealing temperature of 65℃,while they don’t have PCR product band with annealing temperature of 70℃.
II. Raising annealing temperature can reduce unspecific amplification,while it can also decrease the PCR efficiency and cause Ct increasement.Also we need to verify whether the product band is what we need.
19 th
Transformation Result
Colonies | Control |
---|---|
10688 | 113 |
1. Mutation library(10ul ligation product)=10688
2. Ligation efficiency=Pick 20 Single Colony for sequencing
Sequencing Result:
7 out of 20 plasmids have mutation(s) among specific region,in which one has 15 base mutations,one has 2 base mutations,and the rest five have 1 base mutation.
Scrape the Colonies for endofree plasmid purification.
The scraped colonies are cultured for around 9 hours till the OD achieves 2.879,with 150ml Amp.
Concentration: 55ng/μl, 1.75ml
20 th
qPCR Primer Test with Premix and Gel Running
1. We set 3 annealing temperature,which are 61℃,62℃ and 63℃ respectively.
2. Results:
21 th
CHO cell Genomic DNA Extraction
Positive: GECO+NFAT+Neoloxp
①d1-A10 ②d2-B5 ③d2-B9 ④d1-D3 ⑤d2-E9
⑥d1-F5 ⑦d1-F11 ⑧d1-A9 ⑨d1-B3 ⑩d2-C1
Control: GECO+NFAT
①C4 ②E6 ③F8 ④H10
22 th
qPCR Primer Test
Instrument: ABI StepOne Plus qPCR
Kit: TaKaRa-One Step SYBR PrimeScript RT-PCR Kit II
1. Sample:
CHO cell genomic DNA
Positive: transfected with GECO+NFAT+Neoloxp
Negative Control: transfected with GECO+NFAT
Wild Type Control: CHO cell genomic DNA
2. Target:
Neoloxp segment, 18sRNA
3. Standard:
097&Neoloxp plasmid(length:6635bp)
Concentration: 101.2ng/μl
Stock Conc./ng*ul-1 | Volume/ul | Dilute Volume/ul |
---|---|---|
c(101.2) | 10 | 90 |
c/10 | 10 | 90 |
c/100 | 10 | 40 |
c/500 | 10 | 40 |
.. | .. | .. |
dilution point8(1.5) | 10 | 40 |
4.
Reagent | Volume/ul | Final Conc. | Negative Control |
---|---|---|---|
ddH2O | 6.4 | 8.4 | |
2XSYBR® Master Mix | 10 | 10 | |
Forward Primer | 0.8 | 0.4 | 0.8 |
Reverse Primer | 0.8 | 0.4 | 0.8 |
Template | 2 | 0 | |
Total | 20 | 20 |
5. Procedure
6. Results
Primer | Ct |
---|---|
Negative Control-2 | 32 |
Negative Control-3 | 29 |
Negative Control-4 | 30 |
Negative Control-18s | 32 |
7. Conclusion
I.Can’t use ‘TaKaRa-One Step SYBR PrimeScript RT-PCR Kit II’,cause our sample is DNA.
II.We forgot to add ‘PrimeScript Enzyme Mix’ at the beginning,which may cause inaccurate results.
III.We forgot to change pipette tips during the dilution,which may bring huge deviation.
IV.Two-step PCR has a low amplification efficiency in our experiment.To increase the efficiency,we need to use three-step PCR.
23 th
qPCR Primer Test
Instrument: ABI StepOne Plus qPCR
Kit: TaKaRa-SYBR Premix Ex Taq II(Tli RNaseH Plus)
1. Sample,Target and Standard are the same with the experiment yesterday.
2.
Reagent | Volume/ul |
---|---|
ddH2O | 6 |
SYBR Premix Ex Taq II(2X) | 10 |
Forward Primer | 0.8 |
Reverse Primer | 0.8 |
Template(<100ng) | 2 |
ROX Reference Dye(50X) | 0.4 |
Total | 20 |
3. Procedure
4. ResultsPrimer | Ct |
---|---|
Negative Control-2 | 27.8 |
Negative Control-3 | 30.7 |
Negative Control-4 | 32 |
Standard | R2 | Efficiency |
---|---|---|
Primer-2 | 0.9954 | 116% |
Primer-3 | 0.9993 | 104% |
Primer-4 | 0.9998 | 104% |
5. Conclusion
Primer 3,4 are similarly efficient,combining with previous experiment result,we choose Primer 3 in the later experiment.
24 th
Repeat the mutation experiment on 09.14
1. The targeted mutation segments are 1ng,10ng,100ng respectively.
2. During the first PCR procedure,the annealing temperature is set to be 52℃,which is quite low,so it didn’t work.Then we change it to 57℃.
3. Procedure
Temperature/℃ | Duration/seconds | Number of cycles |
---|---|---|
98 | 10 | 1 |
98 | 10 | |
55 | 10 | |
72 | 60 | 32 |
72 | 120 | 1 |
10 | ∞ |
Gel Extraction protocol of PCR Product(as Insert)
Target Mass/ng | 1 | 10 | 100 |
---|---|---|---|
Conc./ng*ul-1 | 215.2 | 208.5 | 259.5 |
Each with volume of 30μl.
EcoRI,SacI Restriction Enzyme Digestion for 9 hours
E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol
Target Mass/ng | 1 | 10 | 100 |
---|---|---|---|
Conc./ng*ul-1 | 105 | 107 | 113 |
qPCR Primer Test with Premix and Gel Running
Annealing temperature: 62℃
Conclusion:
I.We can directly see the band’s brightness differences from the gel running result,which may indicate their plasmid copy number differences.Still,we need to do quantitative PCR to get more precise results.
II.It’s strange as well as unreasonable that band appears in wild-type control PCR result,which may indicate that it has been contaminated.
qPCR: 097-gDNA with Primer3
Instrument: ABI StepOne Plus qPCR
Kit: TaKaRa-SYBR Premix Ex Taq II(Tli RNaseH Plus)
Sample: Positive ①②③⑤⑦⑧⑩
Target: Neoloxp
Standard: 097&Neoloxp plasmid-③
2. Reagent and Procedure are the same with the experiment on 09.23.
3. Results
Standard | R2 | Efficiency |
---|---|---|
Primer-3 | 0.9998 | 109% |
Name | Ct |
---|---|
WT-old | 29 |
WT-1 new | 21.6 |
NC-3 | 32 |
Sample | Copy Number |
---|---|
1 | 19 |
2 | 8 |
3 | 4 |
5 | 5 |
7 | 12 |
8 | 7 |
10 | 5 |
4. Conclusion
Wild type control(new) may be contaminated.
25 th
We find that the synthesized TRPC5 has a problem,which may cause replacement during protein translation,so we need to re-construct TRPC5 plasmid.
Primer Synthesization(send to Invitrogen)
Sequences
Forward Primer: atccGAATTCccctccaaatc(we already have,don’t need to synthesize)
Reverse Primer: tgc tctaga gtg gcccagctgtactacaag
26 th
qPCR Primer Verification with Premix and Sequencing
Sequencing Results:
The PCR results are what we need,and the wild-type genomic DNA which were recently extracted are indeed contaminated.
27 th
Re-construct TRPC5 Plasmid
TRPC5 PCR with modify-primer
Same procedure as before
XbaI,SacI Restriction Enzyme Digestion for Vector and Insert
28 th
Gel Extraction protocol for Vector
E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol for Insert
T4 DNA Ligase(M0202) for 20min
After culture for 10 hours:
Pick 8 Single Colony and Culture for Sequencing
Sequencing Result:
All correct.
Culture Colonies for endofree plasmid purification.
CHO Cell Genomic DNA Extraction
Positive: GECO+NFAT+Neoloxp
(11)d1-C1 (12)d1-C8 (13)d1-D12 (14)d1-E3 (15)d1-E4
(16)d1-F3 (17)d1-F6 (18)d1-F9 (19)d2-C3 (20)d2-C8
(21)d2-D5
29 th
PvuI,NcoI Restriction Enzyme Digestion for Verification
Verification result: All correct.
Oct.
01 st
Construct Mutation Library
Vector: TRPC5 digested with EcoRI,SacI,AflII
Insert: ep-PCR segments,with low&medium&high mutation frequency.
Gel Extraction protocol of Enzyme-digested Vector
Ligation for 1 hour
5μl ligation product are transformed with 100ul competent cells.
qPCR: 097-gDNA with Primer3
Instrument: ABI StepOne Plus qPCR
Kit: TaKaRa-One Step SYBR PrimeScript RT-PCR Kit I
1. Sample: Positive (3),(11)~(21)
Negative: wild type cho cell gDNA
Target: Neoloxp
Standard: 097&Neoloxp plasmid( Endofree-① ),289ng/μl
The first and last dilution point are added with 10ng wild-type gDNA,to see its influence on standard curve.
2. Reagent and Procedure are the same with the experiment on 09.23,except that the annealing temperature is set to be 64℃.
3. Results
Standard | R2 | Efficiency |
---|---|---|
Primer-3 | 0.9998 | 97% |
Name | Ct |
---|---|
WT-old | 24 |
NC-3 | 29 |
4. Conclusion
I. The plasmid concentration differs each time,we need to standardize the method for concentration measurement.
II. The primer is not good enough,which may cause inaccurate standard curve and copy number result.
02 nd
Scrape the Plate for endofree plasmid purification.
Colonies | Control |
---|---|
104~105 | 12 |
Target Mass/ng | 1 | 10 | 100 | 500 |
---|---|---|---|---|
Conc./ng*ul-1 | 295.7 | 271.5 | 167.6 | 200.4 |
Each with volume of 100μl.
CHO Cell Genomic DNA Extraction
Positive: GECO+NFAT+Neoloxp
d2-C6 (23)d2-A5 (24)d2-A8
d2-A9 (26)d1-D10 Wild type: CHO cell’s gDNA All the plasmids’ concentrations are re-measured using NanoDrop.
03 rd
qPCR: 097-gDNA with Primer3
Instrument: ABI StepOne Plus qPCR
Kit: TaKaRa-SYBR Premix Ex Taq II(Tli RNaseH Plus)
1. Sample: Positive (3),(22)~(26)
Negative: wild type cho cell gDNA(newly extracted)
Target: Neoloxp
Standard: 097&Neoloxp plasmid( Endofree-① , 307.8ng/μl
All the dilution points are added with 10ng wild-type gDNA.
2. Reagent and Procedure are the same with the experiment on 09.23,except that the annealing temperature is set to be 64℃.
3. Results
Standard | R2 | Efficiency |
---|---|---|
Primer-3 | 0.9998 | 140% |
Name | Ct |
---|---|
WT-old | 26 |
NC-3 | 30 |
4. Conclusion
I. The standard curve efficiency is 140%,it may result from the adding of wild type gDNA in the preparation of standard point.
II. The Ct of wild type gDNA is 26,which indicates that it has been contaminated.So the copy number results are not precise,we can only compare their differences.