2015

Dec.

13^th

Geco plasmid construction

1. Polymerase Chain Reaction (PCR)

Use PBX-084 TRE-mCherry-2A-Bla plasmid as template to get blasticidin(Bla) resistance gene.

Primers: Age-Bla-S & Bla-E2A-AS

(without purification), 20μl, 30 cycles

	Volume/ul
Buffer	2
Template	0.5
Polymerase(Taq)	0.2
dNTP	1
Primer	0.5, 0.5
ddH2O	15.4

2. PCR

Use PBX-084 TRE-mCherry-2A-Bla plasmid as template to get 2A sequence.

Primers: E2A-S & E2A-Hind III-AS

(without purification), 20μl, 30 cycles

	Volume/ul
Buffer	2
Template	0.5
Polymerase(Taq)	0.2
dNTP	1
Primer	0.5, 0.5
ddH2O	15.4

3. PCR

Step 1: run 10 cycles without primer to let Bla and 2A link together.

98℃	10s	\
55℃	5s		x10 cycles
72℃	30s	/

Step 2：add primers to run 30 cycles.

Primers: AgeI-Bla-S 0.3μM & E2A-HindIII-AS 0.3μM

98℃	10s	\
55℃	5s		x30 cycles
72℃	30s	/

4. PCR product cycle purification by using E.Z.N.A.® Cycle Pure Kit.

---

15^th

Geco plasmid construction

1. Digest the PCR purification product with AgeI and HindIII restriction endonuclease(RE).(37 ℃ 2 hours)

	Volume/ul
PCR purification product	8.4 (~1ug)
CutSmart buffer	5
AgeI	1.5
HindIII	1.5
ddH2O	33.6

2. Digest the Geco plasmid with BglII restriction endonuclease. (50℃ 3 hours)

	Volume/ul
Geco plasmid	9.5 (~1ug)
3.1 buffer(X10)	5
BglII	1.5
ddH2O	34

3.Cycle pure the RE digestion product with the kit “xxxxxx”.

4. Digest the purification product with HindIII restriction endonuclease. (37 ℃ 3 hours)

	Volume/ul
the purification product	5 (~640ng)
CutSmart (X10)	5
HindIII	1
ddH2O	39

5. Digest the vector plasmid with AgeI restriction endonuclease. (37 ℃ 3 hours)

	Volume/ul
The vector plasmid	10 (~2.5 ug)
CutSmart(X10)	5
AgeI	1
ddH2O	34

6.Add 1.5 μl BclII restriction endonuclease. (50 ℃ 3 hours)

Note: BclI and BglII have the same sticky end.

7. Gel running and Gel extraction to get the insert and vector fragments. E.Z.N.A.® Gel Extraction Kit - Spin Protocol

---

16^th

Geco plasmid construction

1. Geco,Vector,Bla+2A Ligation with T4 DNA Ligase(Vector:Insert=1:3).

Vector (5.8 kbp): 5.5ng/μl

Bla+2A (0.45kbp): 16.8ng/μl

Geco (1.25kbp): 5.6ng/μl

	Kit	Add (ul)
10X T4 DNA Ligase Buffer	2ul	2.5
Vector DNA(5.8kb)	0.02pmol	12.7
Bla+2A(0.45kb)	0.06pmol	1
Geco(1.25kb)	0.06pmol	8.2
ddH2O		0
T4 DNA Ligase	1ul	1
Total	20ul	25

Room temperature for 10 minutes.

2. Mix&Go hyper-efficient competent cells transformation.

• Quickly thaw: remove "Mix&Go" hyper-efficient competent cells from -80℃ freezer and water flow till 50% of the cells melt.
• Add DNA: DNA volume is less than 1/10 volume of competent cells. (blow and suck for mixing )
• Heat shock: heat shock at 42℃ water bath for 45s.
• Spread the plates: remove LB(Amp+) plates from 4℃refrigerator,and spread all the bacterial on the plates. Overnight culture at 37℃ incubator (12~16hours).

Vector+Bla 2A+Geco 3 μl + competent cells 30 μl

---

17^th

Geco plasmid construction

1. Vector+Bla 2A+Geco transformation results:

2. Pick single clones and overnight culture.

Pick 5 single clones and use 6 ml Amp⁺ LB medium with 37℃ and 220 rpm shaker to overnight culture each clones.

---

18^th

Geco plasmid construction

1. Extraction of plasmid with E.Z.N.A.® Plasmid DNA Mini Kit I Protocol.

Geco plasmid	Conc. (ng/ul)	A260/280
1	94.2	1.92
2	79.7	1.96
3	110.6	1.90
4	150.3	1.87
5	149.7	1.88

2. Send 5 plasmids to sequence.

---

29^th

Piezo plasmid construction

1. Piezo backbone(PBX-123 plasmid from Prof.Huang’s lab) transformation. Mix&Go method.

Piezo backbone plasmids 2μl + competent cells 20μl

---

30^th

Piezo plasmid construction

1. Piezo backbone transformation results:

2. Pick single clones and overnight culture.

Pick 3 single clones and use 6 ml Amp⁺ LB medium with 37℃ and 220 rpm shaker to overnight culture each clones.

31^th

Piezo plasmid construction

1. Extraction of plasmid with E.Z.N.A.® Plasmid DNA Mini Kit I Protocol.

piezo	Conc. (ng/ul)	A260/280
1	143.4	1.87
2	283.1	1.87
3	186.8	1.87

2. Piezo GPA、pTRE-3G PCR.

Piezo: 310ng/μl GPA: 444bp pTRE-3G: 376bp

	Protocol	Final conc.	Add (ul)
PrimeSTAR Max(2X)	25ul	1X	25
Primer1	10-15pmol	0.2-0.3uM	1.3
Primer2	10-15pmol	0.2-0.3uM	1.3
Template	<200ng		0.7
ddH2O			21.7
Total	50ul		50

Program setting:

98℃	10s	\
55℃	15s	X 35 cycles
72℃	30s	/

3.Gel Running

4.PCR purification.

E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol

	Conc. (ng/ul)	A260/280
GPA	122.7	1.85
pTRE-3G	102.5	1.84

---

2016

Jan.

21^th

Piezo plasmid construction

1. Piezo plasmid construction design:

2. Piezo plasmid(original) RE digestion: 37℃ 2hours

	Volume/ul
piezo DNA (576ng/ul)	2
AscI	1
NotI	1
10X CutSmart buffer	5
ddH2O	41

3. Backbone PBX-123 plasmid RE digestion: 37℃ 2hours

	Volume/ul
pBX123 DNA (312ng/ul)	3
MfeI	1
PmeI	1
10X CutSmart buffer	5
ddH2O	40

4. Gel running and gel extraction.

E.Z.N.A.® Gel Extraction Kit - Spin Protocol

	Gel Extraction concentration (ng/ul)
piezo (original)	18.6
pBX123	40.7

5. Gibson assembly:

	Gibson system (20ul)	Gibson Control system(10ul)
piezo	4	0
pBX-123	2	1
pTRE-3G	0.2	0.1
GpA	0.2	0.1
Gibson mix (X2)	10	5
ddH2O	3.6	3.8

Incubate the mix for 1 hour at 50°C. ( Gibson Assembly® Master Mix – Assembly (E2611) Method)

6. Gibson product transformation:

[[Team:SUSTech_Shenzhen/Notebook/Protocol#Transformation_.26_Competent_cell_recovery | Transformation & Competent cell recovery]

5μl gibson product + 50μl competent cells

Spread plates and overnight cultrue.

---

22^th

Piezo plasmid construction

1. Pick single colonies:

   pick 1 colony from control group, pick 5 colonies from piezo group.

   Add into 6ml Amp⁺ LB, shake at 37℃ and 220 rpm.

2. Make Amp LB and agar.

   make two 500ml Amp⁺ LB medium and one 500ml Amp⁺ LB agar.

   pour 29 plates.

3. Sterilization.

   We put bunch of tips and tubes for sterilization.

Piezo plasmid construction

1. Extract the plasmids from the single colonies (1 control group and 5 PIEZO group):

	Conc. (ng/ul)
Control group	389.6
PIEZO group 1	343.5
PIEZO group 2	376.3
PIEZO group 3	371.6
PIEZO group 4	388.5
PIEZO group 5	245.2

1. Gel electrophoresis of the six plasmids:
   

Sample 2 and Sample 4 have shown positive results, which should be tested further with PCR.

Materials sorting:

We sorted the material and put all of them into the lowermost layer of the -20℃ fridge.

---

25^th

Piezo plasmid construction

1. Sterilization:

   We put a bottle of ddH2O and bunch of tips and tubes for sterilization.

2. PCR test for PIEZO group 2 and PIEZO group 4: Premix TaqTM (RR902A)

For each system

	Volume/ul
Premix Taq	10
Sample	0.5
GpA primer1	1
GpA primer2	1
ddH2O	7.5

Program setting:

95℃

5min

95℃

30s

\

55℃

20s

x35 cycles

72℃

40s

/

3. Gel running:

4. Pick up single colonies and colony PCR

As the result of gel electrophoresis of piezo Gibson group 2&4(yesterday,2016.1.24) missed bands of 4000, we picked up 20 single colonies to test by colony PCR. (use primers of GpA and PTRE).

The system of colony PCR (total 20 μl): Premix TaqTM (RR902A)

	Volume/ul
2X Taq mix	10
Template	05
Primer1	1
Primer2	1
ddH2O	3

Program setting:

95℃	5min
95℃	30s	\
55℃	20s		x35 cycles
72℃	40s	/

Finally, we got 40 groups for PCR colonies (20 for GpA and 20 for PTRE).

5. Gel electrophoresis of 40 groups after PCR colonies.

6.TRPC5 & TRPC6 &PBX-090 transformation.

We transformed these plasmids into competent cell and coated. After that, incubated at 37℃ for 16 hours.（5 plasmids onto 5 Amp plates）

---

26^th

Piezo plasmid construction

1. Pick up single colonies

After TRPC5, TRPC6 and PBX-090 transformation, we found that there are no colony growing on PBX-090 plate. Later we knew that PBX-090 is Kanamycin resistant. We pick 1 colony from other 4 plates. Add into 5ml Amp LB, shake at 37℃.

2.PCR test Premix TaqTM (RR902A)

For yesterday PIEZO group 2 and PIEZO group 4(GPA verified):

	Volume/ul
Premix Taq	10
Sample	0.5
GpA primer1	1
GpA primer2	1
ddH2O	7.5

Program setting:

95℃	5min
95℃	30s	\
55℃	20s		x30 cycles
72℃	40s	/

For yesterday PIEZO colony PCR promoter(pTRE) group 9,11,15(pTRE verified):

	Volume/ul
Premix Taq	10
Sample	0.5
GpA primer1	1
GpA primer2	1
ddH2O	7.5

Program setting:

95℃	5min
95℃	30s	\
55℃	20s		x30 cycles
72℃	40s	/

3.Gel running of PCR product

4.Streak plate of colony PCR9&11&15

We streaked 3 Amp plates using tips.

5.RE Digestion of PIEZO(original plasmid), PIEZO group 2,and PIEZO group 4 PIEZO Total 20μl

	Volume/ul
1ug PIEZO(original plasmid, conc. 576ng/ul)	1.7
BamHI	0.2
CutSmart buffer(X10)	2
ddH2O	16.1

PIEZO group 2(1) Total 20μl

	Volume/ul
1ug PIEZO group2(original plasmid, conc. 376.3ng/ul)	2.6
PmeI	0.2
CutSmart buffer(X10)	2
ddH2O	15.2

PIEZO group 2(2) Total 20μl

	Volume/ul
1ug PIEZO group2(original plasmid, conc. 376.3ng/ul)	2.6
PmeI	0.2
BamHI	0.2
CutSmart buffer(X10)	2
ddH2O	15

PIEZO group 4(1) Total 20μl

	Volume/ul
1ug PIEZO group4(original plasmid, conc. 388.5ng/ul)	2.6
PmeI	0.2
CutSmart buffer(X10)	2
ddH2O	15.2

PIEZO group 4(2) Total 20μl

	Volume/ul
1ug PIEZO group2(original plasmid, conc. 388.5ng/ul)	2.6
PmeI	0.2
BamHI	0.2
CutSmart buffer(X10)	2
ddH2O	15

Gel running results:

Since the results out to be blurred, we decide to run gel again tomorrow.

---

27^th

Piezo plasmid construction

1.Plasmid purification E.Z.N.A.® Plasmid DNA Mini Kit I Protocol - Spin Protocol

Plasmid purification of TRPC5 and TRPC6 from the single colonies we picked yesterday

The concentration of the plasmids:

	Conc. (ng/ul)
TRPC5 IRES-GFP	461.9
TRPC5 IRES-GFP	425.1
TRPC5 IRES-GFP	542.7
TRPC5 IRES-GFP	866.8

2.Gel electrophoresis of Restriction Enzyme Digestion product:

3.Pick single colonies After we strake plate of colony PCR9&11&15, we pick 1 colony from each plate. Add into 5ml Amp LB, shake at 37℃.

4. TRPC5 T5-GFP PCR Q5® High-Fidelity 2X Master Mix(M0492S)

	Volume/ul
Q5 premix	10
Primer1	1
Primer2	1
TRPC5 T5-GFP	0.8
ddH2O	7.2
Total	20

We make 2 groups of 50μL PCR solution.

5. PCR purification E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol

Accidentally make the centrifuge in step 8 30 seconds rather than 1 minute

Use 50μl ddH2O to elute DNA in the last process.

DNA concentration:

Group1: 21.8ng/μL

Group2: 31.6ng/μL

6. TRPC5 T5-GFP PCR(2nd) Q5® High-Fidelity 2X Master Mix(M0492S)

Because the DNA concentration in the last step was too low to conduct the following experiment, we did the TRPC5 T5-GFP PCR for the second time.

	Volume/ul
Q5 premix	25
Primer1	2.5
Primer2	2.5
TRPC5 T5-GFP	3
ddH2O	17
Total	50

We make 5 groups of 50μL PCR solution, and run 40 cycles.

---

28^th

Piezo plasmid construction

1. Plasmid purification and maintenance breeding ① Plasmid purification of colony PCR9&11&15 from the single colonies we picked yesterday

Use 50μL ddH2O to elute DNA in the last process.

E.Z.N.A.® Plasmid DNA Mini Kit I Protocol - Spin Protocol

The concentration of the plasmids:

Colony PCR9 463.6ng/μl

Colony PCR11 556.1ng/μl

Colony PCR15 474.4ng/μl

② Maintenance breeding

Mix 500μL bacterial liquid with 500μL (volume fraction:50%)glycerol, and then shore at -80℃.

2. PCR purification E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol

PCR purification of TPRC5 T5-GFP(2nd)

Use 80 μl Tris-HCl to elute DNA in the last process.

Finally, the concentration of DNA:

Group 1 55.8ng/μl

Group 2 68.7ng/μl

Group 3 69.2ng/μl

Group 4 71.6ng/μl

3. Mycoplasma detection

We did mycoplasma detection for the supernatant from the cell culture (step 4. Cell freezing) we collected yesterday.

a. PCR the supernatant by the primers of mycoplasma DNA.

The system of PCR (total 50μL): Q5® High-Fidelity 2X Master Mix(M0492S

	Volume/ul
Q5 hot start	25
Primer1	2.5
Primer2	2.5
DNA	3
ddH2O	17

Program setting:

95℃	30s
98℃	20s	\
50℃	10s		x35 cycles
72℃	100s	/
72℃	120s
4℃	∞

b. Gel electrophoresis of PCR product.

Obviously, positive control turns out to be positive result, while negative control and the samples are negative results, so that our freezing cells are not polluted and we can store them into liquid nitrogen (big liquid nitrogen cell storage tank 3-4).

4.Restriction Enzyme Digestion(A)

	Volume/ul
DNA (~50ng/uL)(actually, we use group 1&2 from step 2. today)	80
Age I-HF	1
10X CutSmart buffer	9

Digest the ends of TRPC5 for ligation.

Since we have the PBX123 with sticky ends of Age I and Bcl I, we should digest TRPC5 with Age I enzyme and Bcl I.

Firstly, we digest TRPC5 with Age I (activity:100%).The system (total 90μL):

Incubate at 37℃ for two hours.

Then, we digest TRPC5 with Bcl I (activity:75%).

We add Bcl I enzyme (1μL) into the final system of the first digestion. Incubate at 50℃ for six hours.

Digest the product of plasmid purification (step 1. today).

We digest the product of plasmid purification of pick up single colonies of streak plate of colony PCR group9&11&15 to test its linking.

The system (total 20μL):

	Volume/ul
DNA(~50ng/ul)	1
Bam HI-HF	10.2
10X CutSmart buffer	2
ddH2O	16.8

Incubate at 37℃ for two hours.

5. Gel electrophoresis of the digestion of plasmid purification product of colonies PCR 9&11&15

As we digest the plasmid with only one enzyme, we only get linear 15k bp DNA. Obviously, group9&15 are positive.

6. Restriction Enzyme Digestion(B) and gel electrophoresis

We decide to digest the product of plasmid purification of colony PCR group 9&15 with Bam-HI and Bgl I to ensure they are exactly correct.

The system (total 20μL):

Bam HI-HF 0.2μL(activity:100%)

Bgl I 0.2μL(activity:100%)

DNA(~500ng/μL) 1.25μL

10×NEBuffer 2μL(3.1 buffer)

ddH2O 16.35μL

Incubate at 37℃ for two hours.

Gel electrophoresis of the product of digestion.

7. Restriction Enzyme Digestion purification E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol

Use 30μL ddH₂O to elute DNA in the last process.

TRPC5 T5-GFP 1 72.6ng/Μl

TRPC5 T5-GFP 2 71.3ng/μL

8. Restriction Enzyme Digestion E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol

We digest PBX-123 with Age I to get the sticky end which can connected with TPRC5.

The system (total 50μL):

Age I-HF 2μL

DNA(~300ng/μL) 20μL(actually, we use PBX group 3.)

10×NEBuffer 5μL(CutSmart buffer)

ddH2O 23μL

Incubate at 37℃ for two hours.

9. Ligation (TRPC5 and PBX-123)

The system (total 20μL):

10×T4 DNA buffer 2μL

Vector(PBX123) 10μL(43.26ng)

TRPC5 1μL(55.26ng)

ddH₂O 6μL

T4 DNA ligase 1μL

10. Transformation:

We transform the plasmid which we get in the step 9. Ligation into 25μL competent cell.

We also help Dr. Huang (our mentor) transform 3 plasmids into competent cell (each 25μL).

Then, we coat and incubate at 37℃for 16 hours.

---

29 ^th

Piezo plasmid construction

1. Restriction Enzyme Digestion(PBX-123, Age I& Bcl I)

We digested PBX-123 with Age I to get the sticky end which can connected with TPRC5.

Then we use Bcl1 to digest.

The system (total 50μL):

Bcl I 2μL

DNA(~300ng/μL) 20μL (actually, we use PBX group 3.)

10×NEBuffer 5μL(CutSmart buffer)

ddH2O 23μL

Incubate at 50℃ for two hours.

The result is strange. The brightest band is larger than 10000.

Still, we extract the plasmid from the brightest band. Concentration:61.8ng/μl

Gel running of restriction enzyme digestion (PIEZO Gibson Ligation from colony PCR group 9&15, BamHI Bgl II)

The undigested ones showed more bands while digested one only showed one band which is really strange.

We ran the gel for two times and still got the same results.

3. Colony PCR (5 PIEZO Gibson colony &2 PIEZO Gibson control colony&Negative control ddH2O, PCR for GpA& PTRE)

Total 20μl

2xTaq 10μl

Template 5μl

Primer 1 1μl

Primer 2 1μl

DdH2O 3μl

Primers: GpA primers/PTRE primers

From the results, GpA can still be seen in ddH2O. The result is so strange. We don’t know how to explain.

4.Colony PCR (12 TRPC5 Ligation colonies&dd H2O)

Total 20μl

2xTaq 10μl

Template 5μl

TRPC5 Primer 1 1μl

TRPC5 Primer 2 1μl

ddH2O 3μl

The PCR results showed no correct one. We can’t see TRPC5 band.

The rightmost one: Digested PBX123 backbone for TRPC5 is the gel extraction from step 1(Conc. 61.8ng/μl).The band should be around 8000bp. While the result is larger than 10000bp. This indicates that the extracted plasmid is not right. </blockquote> 5. Restriction enzyme digest(PBX123 backbone for PIEZO, PIEZO, both MfeI&BamHI&PmeI)

• PBX123 backbone for PIEZO

Total 50μl

PBX123(~300ng/μl) 35 μl

10x Buffer 5 μl

DdH2O 7 μl

MfeI 1μl

BamHI 1μl

PmeI 1μl

• PIEZO

Total 50μl

PBX123(~570ng/μl) 20μl

10x Buffer 5 μl

DdH2O 22 μl

MfeI 1μl

BamHI 1μl

PmeI 1μl

6. Pick up single colonies

Since the results from the Colony PCR of TRPC5 ligation was not very promising, we pick up 6 colony from the plate. Add into 5ml Amp LB, shake at 37℃.

The signal colonies are picked for the PCR process to make sure that Colony PCR it self have nothing to do with the failure.

---

30^th

Piezo plasmid construction

1. Enzyme digestion of PBX123(Age I and Bcl I for TRPC5)

PBX123(~300ng/μL) 30μL

Age I 1μL

CutSmart 5μL

ddH₂O 14μL

Incubate in 37℃ for a whole night.

Add in Bcl I at 11:00, and move to 50℃.

Bcl I 1μL

Incubate in 50℃ for a 4 hours.

2. Gel electrophoresis of PBX123(Mfe I, BamH I and Pme I for piezo), PBX123(Age I and Bcl I for TRPC5) and Piezo

The PBX123(MfeI BamHI PmeI for piezo) and Piezo(digested) on the other gel was cut off for gel extraction

The concentration of the extraction:

PBX-123 40.8ng/μL

Piezo 28.4ng/μL

3. Plasmid extraction E.Z.N.A.® Plasmid DNA Mini Kit I Protocol - Spin Protocol

Plasmid extraction from the single colonies we picked up yesterday.

The concentration of the plasmids:

TRPC5 ligation 1 378.2ng/μL

TRPC5 ligation 2 347.8ng/μL

TRPC5 ligation 3 343.3ng/μL

TRPC5 ligation 4 441.5ng/μL

TRPC5 ligation 5 438.0ng/μL

TRPC5 ligation 6 431.0ng/μL

4. TRPC5 PCR

We add in the primer of TRPC5 and try to make TRPC5 PCR from the ligation plasmid we extracted from the single colonies.

We also make two control groups, positive control group from the original TRPC5 T5-GFP plasmid we got, and negative control group from ddH₂O.

rTaq premix 5μL

Templet 1μL

Primer1 0.5μL

Primer2 0.5μL

ddH₂O 3μL

5. Gel electrophoresis of the PCR products and the gel extraction products.

Nothing, even with the positive control group from the original TRPC5 T5-GFP plasmid we got, have shown the right result (some brightness around 3000bp).

6. Gibson assembly of Piezo and PBX123

Gibson Assembly® Master Mix – Assembly (E2611)

	Gibson group (10ul)	Control group1 (10ul)	Control group2 (10ul)	Control group3 (10ul)
Piezo (28.4ng/ul)			2.5ul
pBX-123 (40.8ng/ul)	1.5ul	1.5ul	1.5ul	1.5ul
pTRE-3G (102.5ng/ul)	0.13ul	0.13ul
GpA (122.7ng/ul)	0.11ul	0.11ul
Gibson mix	5ul	5ul	2.5ul	5ul
ddH2O	0.76ul	3.26ul	1ul	1ul

7. Enzyme digestion of PBX123(Age I and Bcl I for TRPC5)(2nd)

PBX123(~300ng/μL) 30μL

Bcl I 1μL

3.1 5μL

ddH₂O 14μL

Incubate in 50℃ for a 4 hours.

Conduct DNA extraction with Cycle-Pure Kit, use 45μL ddH₂O to elute the DNA.

The DNA concentration was 92.5ng/μL.

DNA extraction 45μL

Age I 1μL

CutSmart 5μL

Incubate in 37℃ overnight.

8. Transformation

We transform the plasmids which we get in Gibson assembly into 33μL competent cell(1 gibson system and 4 control systems).

We also transform PBX090 and PBX123 to get more plasmid for further use.

---

31_th

Piezo plasmid construction

1. Gel electrophoresis of digested PBX123(Age I and Bcl I for TRPC5)(2nd)
   
2. Colony PCR

Before colony PCR, we remove the plate of PBX123 from incubator to cold room.

We pick up 20 single colonies from the plate of Gibson group, 2 colonies from both control group 1 and 2. There are no colonies on plates of control group 3 and PBX090.

The system of colony PCR(use primers of poly A and pTRE):

Primer1 0.5μL

Primer2 0.5μL

Bacterial liquid 5μL

rTaq premix 6μL

We use original PBX123 to substitute the Bacterial liquid in positive control group 1.

We use poly A or pTRE that we get from the original PBX123 by PCR process to substitute the Bacterial liquid in positive control group 2.

We use ddH₂O to substitute the Bacterial liquid in negative control group.

95℃	30s
98℃	10s	\
50℃	10s		x30 cycles
72℃	100s	/
72℃	120s
16℃	∞

3. Gel electrophoresis of colony PCR (step 2.)

Obviously, every Gibson group are negative.

4. Enzyme digestion of PBX133(Bcl I and Age I, Nhe I, Xba I )

We suspect the availability of our Bcl I enzyme, so we digest this new backbone with another tube of Bcl I, and set a group digested by our enzyme to test its availability.

The system of digestion (by Bcl I of HW) (total 100μL):

Template(~200ng/μL) 50μL

Bcl I 5μL

NEBuffer(3.1) 10μL

ddH₂O 35μL

Incubate in 50℃ for 1 hour.

The system of digestion (by Bcl I of IGEM)(total 10μL):

Template(~200ng/μL) 2.5μL

Bcl I(IGEM) 0.25μL

NEBuffer(3.1) 1μL

ddH₂O 6.25μL

Incubate in 50℃ for 3.5 hours.

Conduct DNA extraction with Cycle-Pure Kit, use 50μL ddH₂O to elute the DNA.

The DNA concentration was ng/μL.

The system of digestion (by Age I, Nhe I, Xba I )(total 50μL):

DNA extraction 42μL

Age I 1μL

Nhe I 1μL

Xba I 1μL

NEBuffer(CutSmart) 5μL

Incubate in 37℃ overnight.

5. Gel electrophoresis of PBX133 digested by Bcl I(after incubating for 1 hour) (step 4.)

From the result we can ensure our enzyme is available.

---

Feb.

01 ^st

Piezo plasmid construction

1. Gel running of 4 enzymes digestion

Digestion sites: Bcl I,Age I,Nhe I,Xba I

2. Gel Extraction E.Z.N.A.® Gel Extraction Kit - Spin Protocol

We use the rest digested product to do gel extraction of cut PBX133(After 4 enzymes digested) Concentration:39.7 ng/μl

3. Transformation of enzyme digested products

---

14 ^th

TRPC5 plasmid construction

1. Enzyme digestion of TRPC5(T5-GFP and IRES-GPF)

	Volume/ul
TRPC5(~400ng/ul)	0.5
Not I	0.2
10X CutSmart buffer	1
ddH2O	8.3
Total	10

Incubate in 37℃ for 3 hours.

2. TRPC5 PCR(T5-GFP and IRES-GPF)

	Volume/ul
Template	1
Primer1	2.5
Primer2	2.5
Q5 hotstart 2X Master Mix	25
ddH2O	19

40 cycles

3. Make petro dishes.

We make 10 LB K+ petro dishes,75 Amp+ petro dishes and 14 LB petro dishes while waiting.

4. Gel electrophoresis of TRPC5

The expected brightness (~3k bp) appeared with TRPC5 T5-GFP PCR.

But TRPC5 PCR purification group 4, which we did with the same process as TRPC5 T5-GFP PCR. Did not have the same brightness. So we decided to do another Gel electrophoresis process tomorrow.

5. PCR purification of TRPC5 PCR products (T5-GFP and IRES-GPF)

E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol

The concentration of the products (diluted with 40μL ddH₂O):

TRPC5 T5-GFP 105.2ng/μL

TRPC5 IRES-GPF 38.8ng/μL

6. Enzyme digestion of TRPC5 T5-GFP PCR purification product

Since we have the expected brightness (~3k bp) appeared with TRPC5 T5-GFP PCR, we carry on with the experiment. And started the enzyme digestion. Because Bcl I only have 75% activity in CutSmart buffer. So we decided to leave it overnight.

	Volume/ul
TRPC5 T5 GFP(~102ng/ul)	30
Bcl I	2
CutSmart	5
ddH2O	13
Total	50

Incubate in 50℃ for overnight.

---

15 ^th

TRPC5 plasmid construction

1. Enzyme digestion of TRPC5(T5-GFP-Age 1)

Add 2 μL Age 1 into the system of last-night enzyme digestion.

Incubate in 37℃ for 2 hours.

2. Enzyme digested product purification of TRPC5

E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol

The concentration of the products (diluted with 30μL ddH₂O):

TRPC5 T5-GFP 58.8 ng/μl

3. Gel electrophoresis of used TRPC5

As we can see, the expected brightness (~3k bp) also appeared. It means that our TRPC5 PCR purification product is no problem, while the other four T5 products which were did before all have problem. So the four can’t be used, we will go deep by using the new TRPC5 PCR purification product.

4. Ligation of TRPC5 and PBX133 backbone T4 DNA Ligase(M0202)

	Volume/ul
10* T4 DNA Ligase Buffer	2
Vector DNA	3
Insert DNA	2
T4 DNA Ligase	1
ddH2O	12
Total	20

Gently mix and let it in room temperature for 20 minutes.

Heat inactive at 65℃ for 10 minutes and put it in -20℃ for 4 hours.

5. Transformation of TRPC5 plasmid

	Competent cells/ul	DNA/ul
TRPC5-pBX133 Ligation 1	33	5
TRPC5-pBX133 Ligation 2	33	5
pBX133 backbone	33	5

Results :

The results are not so good. There are many kinds of passible reasons which we will go to confirm one by one tomorrow.

16

TRPC5 plasmid construction =

1. Learn to design primer from Prof. Huang.
2. Make new Amp+ agar plate.

   Spread 12μl 50mg/ml Amp+ (sodium salt) to the plate made in Feb.24

   Put the plate to 25℃ for 3 hours

3. Examination of experiment and propagation of 090

Amp+ New plate(2016.2.16):

	Competent cells/ul	DNA/ul
TRPC5-pBX133 Ligation 1	25	5
pBX133 backbone 1	25	5
TRPC5-pBX133 Ligation 2	25	1
pBX133 backbone 2	25	1
Control	25	0

Amp+ Old plate(2016.2.14):

	Competent cells/ul	DNA/ul
pBX133 backbone 1	25	5
TRPC5-pBX133 Ligation 2	25	1
pBX133 backbone 2	25	1
Control	25	0

Amp+ Former plate(2015):

	Competent cells/ul	DNA/ul
TRPC5-pBX133 Ligation 1	25	5

K+ plate(2016.2.14):

	Competent cells/ul	DNA/ul
090	25	5
Control	25	0

Results:

Amp+ New plate(2016.2.16):

Amp+ Old plate(2016.2.14):

Amp+ Former plate(2015):

K+ plate(2016.2.14):

Discussion:

Compare new and old plate, it comes out that some is wrong with the plate for its antibiotic function.

We thinks there may be two reason for this:

1.the antibiotics is inactived.

2.there is some distribution problem in the production of plate.

3.there is some concentration issue with the antibiotic.

There is also some problem with the ligation of TPRC6 and PBX133 backbone.

---

17 ^th

TRPC5 plasmid construction

1. To check whether Ampicillin and Kanamycin are effective
   • Add 1 μl Ampicillin solution to each LB agar plate and spread.Add 1 μl Kanamycin solution to each LB agar plate and spread.
   • 2 Let them stay for 3 hours.
   • 3 Add 25 μl competent cell to each plate. Incubate for 16 hours in 37 ℃

   Result：There is no any colony in each plate. So Ampicillin and Kanamycin are effective.

2. TRPC5 primer design

3. Make Amp⁺ and K⁺ LB agar plates.

We made 2*500ml LB agar. Add 500μl 1000x Amp⁺ in one and add 500 μl 1000x K⁺ in the other. We poured 15 K⁺ plates and 13 Amp⁺ plates.

---

18 ^th

TRPC5 plasmid construction

1. Modify the previous designed primers,based on following defects
   1. Protection bases are too short,should be 4~6 bases.
   2. The temperature of matching pieces is too low,should be 55~65℃,and the Tm of primer should be 75~85℃.
   3. The number of bases between start codon and stop codon of final ligation product should be the fold of 3.

   Modified primers:

J23100-sfgfp-pBX123-piezo-primer

primer1:5'-AGAC ACCGGT TCTAGA CTAGAGTCGCGGCCGCTTTACTTGTA- 3'

AgeI XbaI Tm 62.6

primer2:5'-TACG GGATCC TTA T GGCGCGCC TTGATATCGAGCTCTTGACGGCTAGC- 3'

BamHI AscI Tm 60.9 J23100-sfgfp-pBX123-TRPC5-primer

primer1: 5'-AGAC ACCGGT GAATTC CTAGAGTCGCGGCCGCTTTACTTGTA- 3'

AgeI EcoRI Tm 62.6

primer2: 5'-TACG GGATCC TTA T GCGGCCGC TTGATATCGAGCTCTTGACGGCTAGC- 3'

BamHI NotI Tm 60.9

2. Amplify PBX-123 backbone

Backbone 1μL+competent cell 33μL (3 tubes)

Results:All 3 culture dishes don’t grow colony.

Discussion:Maybe the concentration of PBX-123 backbone is too low,so we increase the concentration.(2016.02.19)

3. Enzyme digestion of PBX-123 backbone(previous extracted PBX-123) 2 tubes,each 3μL

NotI/ul	1
CutSmart/ul	5
pBX123 /ul	3
ddH2O	41
Total/ul	50

Purification of PBX-123(30μL system,2 tubes)

Results:

①13.7ng/μL A260/280: 1.6

②20.6ng/μL A260/280: 1.4

4. Add Klenow Fragment to create blunt ends(2 tubes)

Klenow Fragment: 5units/μL

DNA Polymerase I, Large (Klenow) Fragment(M0210S)

Protocol(combine the NEB and Chinese protocol):

①

Total	40	Final
10X NEBuffer2	4
dNTP(2.5mM)	0.6	33uM
pBX123	27.5	20~30ul(0.2~8ug)
Klenow Fragment	0.1	0.4~1.6ul (2~8unit) 1 unit per ugDNA
Control	7.8

②Incubate 15min at 25℃

③Incubate 30min at 75℃

5. Gel electrophoresis of 2 tubes blunt-ended PBX-123

Marker: DL10000

Results: Both 2 bands are near 10000bp and at the same site,which means the two bands are both blunt ends or sticky ends,we need to confirm after extracting the plasmid.

(We forgot to take a picture of the gel)

19 ^th

TRPC5 plasmid construction

1. Gel cutting and extraction of PBX-123 Klenow Fragment products

(30μL system)

Concentration:7.6ng/μL, A260/280: 1.55

2. Ligation of PBX-123 blunt end T4 DNA Ligase(M0202)

	Volume/ul
Total	30
10X Buffer	3
DNA	25
T4 DNA Ligase	2

Amplify PBX-123 backbone,transform,select single colony and shake colony(4 tubes)

Results:

PBX-123/ μl	Competent cell/ μl	Colonies
0	25	0
5	25	10+
15	25	2
25	25	1

Discussion:

The number of colonies decreases as the concentration of PBX-123

backbone increases,which is strange,so we need to do a gel running after

extracting the plasmid to confirm whether the PBX-123 has problem.

4. Ligation product transform,select single colony and shake colony (1 tubes)

Results: only one culture dish grows 1 colony

---

20 ^th

TRPC5 plasmid construction

1. PBX123 and PBX123(NotI-cut ligation) plasmid extraction

AxyPrep Plasmid Miniprep Spin Protocol

Final volume: 70 ul each tube

PBX-123 NotI-cut	249.3ng/ul
PBX-123 plasmid1	299.1ng/ul
PBX-123 plasmid2	213.6ng/ul
PBX-123 plasmid3	252.9ng/ul
PBX-123 plasmid4	360.3ng/ul

2. Breed preservation :

500ul bacterial : 500ul glycerol each tube

PBX-123 NotI-cut	1 ml	-8℃ 107
PBX-123 plasmid1	1 ml	-8℃ 107
PBX-123 plasmid2	1 ml	-8℃ 107
PBX-123 plasmid3	1 ml	-8℃ 107
PBX-123 plasmid4	1 ml	-8℃ 107

3. NotI digest and transform (2 tubes)

NotI/ul	1
CutSmart/ul	5
pBX-123/ul	3
ddH20/ul	41
Total/ul	50

Purification: 40 ul system

Results: ① 18.1 ng/μL A260/280: 1.64

Transform 3 plates (Amp+)

4. He Yuhao repeats PBX123 NotI-cut:

NotI digest: 2 tubes

NotI/ul	1
CutSmart/ul	5
pBX-123/ul	3
ddH20/ul	41
Total/ul	50

Purification: 30 ul system each

Results: ① 25 ng/μL A260/280: 1.70

② 23 ng/μL A260/280: 1.66

---

21 ^th

TRPC5 plasmid construction

1.Select single colony

All 3 culture dishes grow many colonies,but we still need to do colony

PCR to confirm they are blunt-ended.Ling Shaohua has designed the primer

for colony PCR,we need to ask Pro.Huang whether it’s right.

So we select 10 colonies,each with 10ul Amp+ LB broth and store at cold

room.When the primer is verified and synthesized,we will do colony PCR

and extract plasmid from those colonies which are confirmed to be right.

---

22 ^th

TRPC5 plasmid construction

1.Enzyme double digestion of HindIII-HF，Not I-HF. 37 ℃, 3hrs

	Volume/ul
pBX-123 Not I-cut plasmid(~249ng/ul)	4
CutSmart buffer(10X)	5
HindIII-HF	1
NotI-HF	1
ddH2O	39

	Volume/ul
pBX-123 Not I-cut plasmid(~252ng/ul)	4
CutSmart buffer(10X)	5
HindIII-HF	1
NotI-HF	1
ddH2O	39

2.Gel running, proof:

24 ^th

TRPC5 plasmid construction

1. TRPC5 enzyme digestion

We cut the TRPC5 PCR gel extraction from day 2.16 to give it a shot.

Only 23μL DNA left inside the tube.

	Volume/ul
DNA	23
CutSmart buffer(10X)	5
BclI	1
ddH2O	39
Total	50

2. Transformation：

We transform PBX133 PBX090 and Piezo to propagate them for further use.

We use the micropipette to inhale and blow the liquid inside Piezo for the plasmid sample, and add it to 33μL competent cells.

We add 2.5μL PBX133 and 2.5μL PBX090 to 33μL competent cells.

We coat and incubate at 37℃for 16 hours.

---

April

13 ^th~24 ^th

087&NFAT Plasmid Construction

Restriction Enzyme Digestion for Verification

Gel Extraction Sequencing Result:

Correct

04.24~05.06 TRPC5 Plasmid Construction

06.15~06.30 Restriction Enzyme,Ligase and Transformation Efficiency Test sfgfp PCR and Gel Extraction

Transformation Result

July

0 1 ^st

Efficiency Tests

Transformation efficiency (3 groups)

Competent cell/ul	sfGFP plasmid/ng	sfGFP plasmid/ul
33	45.88	0.3

Enzyme digestion efficiency (3 groups)

Competent cell/ul	sfGFP digested/ng	sfGFP digested/ul
33	45.88	1.9

1>Prepare digestion system:

	Amount/ ul
DNA	2.4
AflII	1
EcoRI	1
CutSmart(NEB)	2.5
ddH2O	18.1
Total	25

Incubate at 37℃,6hrs.

Ligation efficiency (3 groups)

Competent cell/ul	sfGFP plasmid ligated/ng	sfGFP plasmid ligated/ul
33	41.67	3.3

1> Prepare ligation system T4 DNA Ligase(M0202)

Vector	0.02pmol
Insert	0.08pmol
T4 ligase	1ul
T4 ligase buffer 10X	2ul
ddH2O	to 20ul
Total	20ul

Incubate at room temperature for 20mins

Transformation & Competent cell recovery

1. Get competent cell (DH5α) from -80℃，lay on ice for 15mins till melted.

2. Add plasmids according to the table above, gently blow to mix well.

3. Incubate on ice for 30mins.

4. Incubate in 42℃ water bath for 90s.

5. Lay on ice for 5mins.

6. Add 300μl LB, 37℃, 220rpm for 20mins.

7. Add 300μl Amp+ LB, 37℃, 220rpm for 20mins.

8. Centrifuge at 5000rpm, 1min. Drop 400μl suspension.

9. Mix the left 200μl gently, spread plate.

NOTE:

1. For ligation products, subpackage of competent cell may decrease the final efficiency.
2. During transformation, after heat shock, competent cell should be spread on preheated agar plate (37℃) to reach a higher transformation efficiency.

02 ^nd

Efficiency tests results:

	Green colony number	Non-green colony number
Transformation 1	>1000	24
Transformation 2	>1000	32
Transformation 3	>1000	21
Digestion1	0	382
Digestion2	1	370
Digestion3	0	400
Ligation1	0	300
Ligation2	4	302
Ligation3	0	267

NOTE:

Too many non-target bacterial colonies(non-green).

Efficiency tests failed.

Non-green colony test (I)

Pick 1 non-green colony on each plate.

Mix with 20μl ddH₂O

Get 10μl add into 5ml Amp+ LB to incubate at 37℃, 220rpm for <16hrs.

Get 10μl to do colony PCR:

1> Primer

Forward -- AACGTATAAGCTTTAGGCGTGTACG

Reverse -- TTGTGCACCAGTCATAGCCGAATAG

2> Polymerase Chain Reaction (PCR)system</ul>

Q5® High-Fidelity 2X Master Mix(M0492S)

	Amount/ul
Q5 Master Mix 2X	12.5
Colony mixture	10
PrimerF	1
PrimerR	1
ddH2O	0.5
Total	25ul

3> PCR setting

STEP	TEMP	TIME
Initial Denaturation	98℃	30s
30 Cycles	98℃	10s
30 Cycles	50-72℃	20s
30 Cycles	72℃	20s
Final Extension	72℃	2mins
Hold	10℃	∞

4> Gel electrophoresis

03 ^th

Non-green colony test (II)

1. Use E.Z.N.A.^TM Plasmid Mini Kit(Omega D6942-02) to purified plasmids.

According to E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol

Test the concentration ( Eppendorf BioSpectrometer)

Use another pairs of primers to do PCR

Primer Forward -- CTAGAGTCGCGGCCGCTTTACTT

Primer Reverse -- TCGAGCTCTTGACAGCTAGCTCA

4.Double-enzyme digestion

Non-green plasmid	200ng
AflII	1ul
EcoRI	1ul
CutSmart(NEB)	2ul
ddH2O	to 20ul
Total	20ul

5. Gel electrophoresis

04 ^th

Non-green colony test (III)

1.Enzyme digestion

DNA	200ng
ScaI	1ul
CutSmart(NEB)	2ul
ddH2O	to 10ul
Total	10ul

2. Gel electrophoresis

06 ^th

1.Enzyme digestion

Non-green plasmid	200ng
ScaI/XbaI/XhoI	1ul
CutSmart(NEB)	2ul
ddH2O	to 20ul
Total	20ul

2. Gel electrophoresis

07 ^th-10 ^th

New plasmids design:

• TRPC5-Loxp

• Sfgfp-pBX123

• pBX097-neoloxp

11 ^th

TRPC5-Loxp Plasmid Construction(I)

1. TRPC5-R plasmid enzyme digestion

TRPC5-R	2ug
DraIII	1ul
CutSmart(NEB)	2ul
ddH2O	to 20ul
Total	20ul

2. Gel electrophoresis for gel extraction

NOTE: Wrong length and faint bands

DraIII digestion site:

12 ^th

TRPC5-Loxp Plasmid Construction(II)

1.TRPC5-L and TRPC5-R PCR

Primer F -- TTGGCAAAGAATTCCTCGAGG

Primer R -- GCCGATCATGCTGATATTGAGT

2.Gel electrophoresis for gel extraction

3.Gel Extraction (According to Gel Extraction protocol )

4.TRPC5-L plasmid re-synthesis

13 ^th

pBX097-neoloxp construction(I)

Neoloxp PCR from pBX123 plasmid

Gel Extraction protocol

3. Test product’s concentration

4.Double-enzyme digestion and pBX097 plasmid enzyme digestion

pBX097/neoLoxP	3ug
MfeI	1ul
BamHI	1ul
CutSmart(NEB)	5ul
ddH2O	to 50ul
Total	50ul

5.Gel electrophoresis

16 ^th - 21 ^th

pBX097-neoloxp construction(II)

1.Ligate the pBX097 and neoloxp with T4 DNA Ligase(M0202) and Quick Ligation

2.DNA transformation

Result: None colony

TRPC5-Loxp Plasmid Construction(III)

TRPC5-R PCR product double-enzyme digestion (AflII; KpnI) overnight

TRPC5-L synthesis products transformation

TRPC5-L plasmid purification

TRPC5-L plasmid enzyme digestion (AflII; KpnI) overnight

Ligation of TRPC5 left and right (T4 DNA ligase)

Spread plate, incubate at 37℃ for <16hrs

Pick single colony, incubate in 15ml Amp+ LB for 16hrs at 37℃

Separate the culture into 5ml(to prove); 9.5ml(for endofree); 0.5ml (for

preservation in -80℃)

Single-enzyme digestion (PvuI; BamHI) and gel electrophoresis

Correct

pBX123-sfGFP construction

1. sfGFP PCR
2. Pbx123 double-enzyme digestion

3. Double-enzyme digestion ( AgeI; BamHI ) of sfGFP Overnight

4.Gel Extraction protocol and E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol

5. Ligation of sfGFP and pBX123 backbone

6. Spread plate incubate at 37℃, <16hrs

7. Pick 8 colonies incubated in 5ml Amp+ LB each, at 37℃ 220rpm for <16hrs

8. Plasmid purification

E.Z.N.A.® Plasmid DNA Mini Kit I Protocol

9. Double enzyme digestion for proof (AflII; EcoRI)

10.Gel electrophoresis

22 ^th - 23 ^th

pBX097-neoloxp construction(II)

1.Ligate the pBX097 and neoloxp with T4 DNA Ligase(M0202)

2.DNA transformation

Result: 7 colonies

3. Pick colonies to 5ml Amp+ LB, incubate at 37℃, 220rpm for <16hrs.

4. Plasmid extraction with Plasmid Mini Kit (Omega)

5.Single-enzyme digestion

pBX097/neoLoxP	200ng
AflIII/ScaI	1ul
CutSmart(NEB)	2ul
ddH2O	to 20ul
Total	20ul

Incubate at 37℃, overnight.

24 ^th - 25 ^th

pBX097-neoloxp construction(II)

1.Gel electrophoresis

Result: pBX097-neoloxp successfully constructed.

26 ^th - 30 ^th

TRPC5-Loxp Plasmid Construction(IV)

1.TRPC5-Loxp endofree plasmid purification.

2.pBX097-neoloxp and TRPC5 sequencing

Primer for TRPC5---GCCGATCATGCTGATATTGAGT

Primer for pBX097-neoloxp---GGCAACGTGCTGGTTATTGTGC

Aug.

01 ^st - 02 ^nd

pBX123-sfGFP Efficiency test

pBX123-sfGFP Efficiency Test(AflII, EcoRI)	Transformation
pBX123-sfGFP Efficiency Test(AflII, EcoRI)	Enzyme digestion
pBX123-sfGFP Efficiency Test(AflII, EcoRI)	Ligation

Repeat the experiments steps mentioned in 7.1

03 ^rd - 04 ^th

pBX123-sfGFP enzymes’ digestion sites ligation ability

Groups	Combination
1	AgeI+BamHI
2	AgeI+AflI
3	EcoRI+BamHI
4	EcoRI+AflI

1> Prepare digestion system, incubate overnight

2> Gel Extraction protocol to get different fragments

3> Ligation of T4 DNA Ligase(M0202)

4> Transformation

Results:

Groups	Colony number
AgeI+BamHI	0
AgeI+AflI	0
EcoRI+BamHI	non-green
EcoRI+AflI	non-green

05 ^th

TRPC5-loxp sequencing results:

TRPC5-(1)	1 mismatch
TRPC5-(2)	Correct
TRPC5-(3)	1 Failed
TRPC5-(4)	1 Correct

pBX097-neoloxp sequencing results:

097-neoLoxP-(1)	Correct
097-neoLoxP-(2)	Correct
097-neoLoxP-(3)	3 mismatches

06 ^th - 07 ^th

Non-green colony PCR

09 ^th

Change NFAT-YFP to NFAT-EGFP(I)

Double enzyme digestion (AgeI, BamHI) pBX123 to get EGFP fragment

Double enzyme digestion (AgeI, BamHI) NFAT-YFP to get backbone Overnight

10 ^th

Change NFAT-YFP to NFAT-EGFP(II)

Gel Extraction protocol for EGFP and NFAT backbone

Ligation by T4 DNA Ligase(M0202)

Transformation

11 ^th - 13 ^th

Change NFAT-YFP to NFAT-EGFP(II)

1. Pick single colony to culture in 15ml Amp+ LB for 16hrs
2. E.Z.N.A.® Plasmid DNA Mini Kit I Protocol to get purified plasmid
3. Enzyme digestion to prove
4. Send to sequencing

22 ^th

TRPC5 Random mutagenesis(I)

TRPC5 Random mutagenesis	Megaprimer PCR
TRPC5 Random mutagenesis	Gibson
TRPC5 Random mutagenesis	Enzyme Digestion

Megaprimer PCR

1> Pre-experiments: T5 exonuclease digestion level according to time.

a. Use PrimerStar to do PCR of TRPC5 mutation region (~640bp)

b. Gel extraction to get TRPC5 mutation region

c. Set a series gradients of T5 digestion time: 0, 5, 10, 20mins

T5 exonuclease digestion time	groups
5 mins	1,2
10 mins	3,4
20 mins	5,6

d. EDTA preparation

To get EDTA solution with final concentration of 11mM (Planing to add 1μl solution into

50μl to stop reaction). We should get 540mM stock solution.

• Weigh 1.08g EDTA powder add into 5ml ddH₂O
  • Use magnetic stirring bar to help dissolve
    • Add NaOH powder to adjust solution’s PH until dissolved completely
      • Use 0.22μm filter to filtrate the solution
        • store in -20℃

Note: To keep T5 exonuclease digestion time as precise as possible, according to its protocol, we use EDTA to stop the digestion. e. T5 digestion (according to T5 exonuclease protocol)

T5 exonuclease	3.4ul
NEB4.0 Buffer	5ul
TRPC5 region	3.4ug
ddH2O	to 50ul
Total	50ul

f. Take group①②③for gel extraction; ④⑤⑥for cycle pure.

23 ^th

Megaprimer PCR 1> Send ④⑤⑥ to sequence Primer F:ATCCGAATTCCCCTCCAAATC Primer R:TATGTTAAGTTCCCAGCCCAG 2> Megaprimer PCR:

• Use Q5® High-Fidelity 2X Master Mix(M0492S), System 50μl, Tm=65℃
  • E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol to get purified PCR products.
    • Use DpnI to digest plasmids that come from bacteria (methylated sites)
      • Transformation of digested products.

24 ^th

Megaprimer PCR results of different digestion time and ratios of templet and

primer:

TRPC5 mutation region PCR

TPRC5 preserved bacteria plate streaking

DpnI digestion time experiment: “Whether 100ng plasmid can be digested completely by 1μl DpnI in 25μl, for 1h”

Result:

25 ^th

Megaprimer PCR

1. To find out the best annealing temperature for megaprimer. Set a series of annealing temperatures: 55, 60,65,70℃
2. Repeat PCR
3. E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol to get purified PCR products.
4. DpnI digestion
5. Transformation

26 ^th

Megaprimer PCR results of different digestion time;PCR annealing temperatures and ratios of templet and primer:

Colony number according to different annealing temperatures and ratios of templet and primer:

PCR Annealing TEMP	Primer:Template= 1:1	Primer:Template= 1:2
55℃	125	44
60℃	120	100
65℃	116	58
70℃	168	76

Sequencing results of T5 exonuclease digestion level according to time:

T5 Exonuclease digestion time	5' end digest number/bp	Direction
5mins	48	Forward
5mins	43	Reverse
10mins	176	Forward
10mins	166	Reverse

Repeat T5 exonuclease digestion level according to time:

Set series of time gradients: 0, 5, 7.5, 10mins

a. T5 digestion (according to T5 exonuclease protocol)

T5 Exonuclease	3.4ul
NEB4.0 Buffer	5ul
TRPC5 region	3.4ug
ddH2O	to 50ul
Total	50ul

b. Take each group for Gel electrophoresis

c. Send each group to sequence

Primer F:ATCCGAATTCCCCTCCAAATC

Primer R:TATGTTAAGTTCCCAGCCCAG

28 ^th

Sequencing results of T5 exonuclease digestion level according to time:

T5 Exonuclease digestion time	5' end digest number/bp	Direction
5mins	42	Forward
5mins	43	Reverse
7.5mins	104	Forward
7.5mins	96	Reverse
10mins	188	Forward
10mins	156	Forward

29 ^th

Culture medium Pollution proving:

Set 4 groups of experiments (use sfGFP plasmid):

30 ^th

Culture medium Pollution proving results:

Group 3 number > Group 1 number ; with lots of non-green bacteria

Group 4 has >100 colonies of non-green bacteria

Group 2 has no colony

Conclusion: Culture medium has been polluted.

Gibson assembly (pre-experiment)

1> Directly cut the mutation region by AflII and EcoRI for 8hrs

2> Gel extraction to get the 640bp fragment

3> Use Gibson Assembly® Master Mix to get whole plasmid

4> Transformation

31 ^th

1.Gibson assembly result: NONE colony

2.Random mutagenesis with Kit, according to Random mutagenesis protocol

Sept.

01 ^st

Design qPCR Primers and Send for Synthesization

Sequences:

1.097&NeoLoxP qPCR-1st

2. qPCR Internal Positive Control

04 ^th

Gibson Assembly® Master Mix

Insert : vector=2 : 3(50~100ng vector)

Reagent	Volume/ul(for 20bp)	Volume/ul(for 30bp)	fmol
Vector	1	1	19.4
Insert	8.6	3.1	58.2
2X Master Mix	10	10
ddH2O	0.4	5.9
Total	20	20

T5 Exonuclease Digestion

Temperature: 50℃

	20bp)	30bp
Digestion time/min	40	60

Transformation into Competent Cells

5μl product are transformed with 50ul competent cells.

Error-prone PCR(low frequency)

1. Information supplied with Random mutagenesis protocol

(Agilent Technologies,Catalog #200550):

2. Primers sequence:

Forward: ttactcaccatacagagatcgaattcc

Reverse: ttttccactttgctcagctccttaag

Target DNA mass: 500ng,corresponding to low frequency mutation

Reagent	Volume/ul
ddH2O	9.5
dNTP mix	1
Mutazyme II DNA polymerase	1
Forward Primer	1
Reverse Primer	1
Template	31.5
10X Mutazyme II reaction buffer	5
Total	50

4. Procedure

The annealing temperature is set to be 57℃.

Gel Extraction protocol of ep-PCR Product

Concentration: 135ng/μl, 30μl

qPCR Primer Test

Instrument: ABI StepOne Plus qPCR

Kit: Power SYBR® Green PCR Master Mix and RT-PCR Reagents Kit

Sample:

CHO cell genomic DNA extracted from 4.5x10⁶ cells.

Concentration: 56.1ng/μl, 400μl

Target:

Neoloxp segment, 18sRNA, GAPDH

Standard:

097&Neoloxp plasmid(length:6635bp)

Concentration: 101.2ng/μl

Stock Conc./ng*ul-1	Volume/ul	Dilute Volume/ul
c(101.2)	1	99
c/100	1	99
c/200	50	50
c/400	50	50
c/800	50	50
c/1600

4.

Reagent	Volume/ul	Final Conc.	Negative Control
ddH2O	6.4		8.4
2XSYBR® Master Mix	10		10
Forward Primer	0.8	0.4	0.8
Reverse Primer	0.8	0.4	0.8
Template	2		0
Total	20		20

5. Procedure

05 ^th

Transformation Result

No colony

Possible reason: The transformation efficiency of self-made competent cells is quite low.

06 ^th

TRPC5 PCR with PrimeStar

1.Primers sequence:

Forward: ttactcaccatacagagatcgaattcc

Reverse: ttttccactttgctcagctccttaag

2.Total 8 tubes of PCR reaction:

Reagent	Volume/ul	Final conc./uM
ddH2O	20.8
2X Premix	25
Forward Primer	1.5	0.3
Reverse Primer	1.5	0.3
Template	1.2(1ng)
Total	50

3. Procedure

Temperature/℃	Duration/seconds	Number of cycles
98	10	1
98	10
55	10
72	60	32
72	120	1
10	∞

Gel Extraction protocol

Concentration: 180ng/μl, 30μl, total 4 tubes.

T5 Digestion for 3.5 minutes and E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol

Concentration: 60ng/μl, 50μl

Mega-primer PCR with KOD Polymerase

Template DNA: 0.1ng,

Mega-primer:Template=10000:1

Component	Volume/ul	Final Conc.
10X buffer#1 for KOD DNA Polymerase	5	1X
dNTP (2mM each)	5	0.2mM(each)
MgCl2(10mM)	5	1mM
Forward Primer(5pmol/ul)	4	0.4uM
Reverse Primer(5pmol/ul)	4	0.4uM
Template	Y
PCR Grade water	X
KOD DNA Polymerase(2.5U/ul)	0.4	0.02U/ul
Total	50

Procedure:

Temperature/℃	Duration/seconds	Number of cycles
98	30	1
98	20
60	20
72	180	30
72	120	1
10	∞

E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol and Gel Running

Concentration: 30ng/μl, 50μl

No 6000bp band is appeared,it’s a problem!!

DpnI Digestion for 1 hour

Transformation

5μl product are transformed with 100ul competent cells.

qPCR Primer Test

Instrument: Bio-Rad

Kit: TaKaRa-One Step SYBR PrimeScript RT-PCR Kit I

1. Sample:

CHO cell genomic DNA extracted from 4.5x10⁶ cells.

Concentration: 56.1ng/μl, 400μl

2. Target:

Neoloxp segment, 18sRNA, GAPDH

3. Standard:

097&Neoloxp plasmid(length:6635bp)

Concentration: 101.2ng/μl

Stock Conc./ng*ul-1	Volume/ul	Dilute Volume/ul
c(101.2)	1	99
c/100	1	99
c/10000	2	18
c/100000	2	18
c/1000000	2	18
c/10000000	2	18

4.

Reagent	Volume/ul	Final Conc.	Negative Control
ddH2O	6.4		8.4
2XSYBR® Master Mix	10		10
Forward Primer	0.8	0.4	0.8
Reverse Primer	0.8	0.4	0.8
Template	2		0
Total	20		20

Wrong: Forget to add ‘PrimeScript Enzyme Mix’ which contains ‘Taq enzyme’,thus no PCR reaction works.

5. Procedure

07 ^th

Transformation Result

No colony

Possible reason: The mega-primer PCR procedure didn’t work.

Mega-primer PCR with Q5

1.Template DNA: 0.1ng,

Mega-primer:Template=10000:1

	Volume/ul	Volume/ul
Reagent	No T5 Digestion	T5 digestion for 3.5min -	ddH2O	18.4	17.1
2X Q5 mix	25	25
Mega Primer	0.6	1.9
Template	6(0.1ng)	6
Total	50	50

2. Procedure

Temperature/℃	Duration/seconds	Number of cycles
98	30	1
98	10
60	30
72	300	35
72	120	1
4	∞

qPCR Primer Test with Premix and Gel Running

1. Gel concentration: 2%(to better show the needed band)

2.

Reagent	Volume/ul	Mass/ng
ddH2O	X
2X Premix	12.5
Forward Primer	0.5
Reverse Primer	0.5
Template	Y		1ng for plasmid,640ng for gDNA
Total	25

3. Procedure

Temperature/℃	Duration/seconds	Number of cycles
98	60	1
98	20
60	30
72	20	30
72	120	1
10	∞

4. Results

The gel running results show that primer 1~4 and primer GAPDH has been contaminated,we need to use new primer and be care of experiment operation.

08 ^th

Gel Running with 30μl mega-primer PCR product

There is a band at around 6000bp position!

DpnI Digestion for 1 hour

Reagent	Volume/ul
ddH2O	3
DNA	20
5X Buffer	6
DpnI	1
Total	30

Transformation

10μl product are transformed with 100ul competent cells.

9 ^th

Transformation Result

Little or no colony is appeared,maybe the transformation efficiency of competent cell is still too low.

09.12 Pre-experiment of enzyme digestion and ligation

TRPC5 PCR with PrimeStar

Primers sequence

Forward Primer:　atccGAATTCccctccaaatc

Reverse Primer:　ATGATCTCCAGTTCTCTGGA

2. Total 2 tubes PCR reaction

Reagent	Volume/ul
ddH2O	20.8
Forward Primer	1.5
Reverse Primer	1.5
2X Premix	25
Template	1.2(1ng)
Total	50

3. Procedure

Temperature/℃	Duration/seconds	Number of cycles
98	10	1
98	10
55	10
72	60	32
72	120	1
10	∞

Gel Extraction

Concentration: 44.4ng/μl, 40μl

EcoRI,SacI Restriction Enzyme Digestion

1. Insert

Reagent	Volume/ul
ddH2O	1
DNA	40
10X Buffer	5
EcoRI	2
SacI	2
Total	50

The digestion is from 00:20 to 09:00.

2. Vector

Reagent	Volume/ul
ddH2O	11
DNA	30 (5ug)
10X Buffer	5
EcoRI	2
SacI	2
Total	50

The digestion is from 21:00 to 09:00.

qPCR Primer Re-design and Send for Synthesization

Sequences:

097&NeoLoxP qPCR-2nd

13 ^th

Transformation

Use the bought competent cell,with transformation efficiency of approximately 10^7.

Gel Extraction of Enzyme Digested Vector

360x360px

Concentration of vector: 44.8ng/μl,20μl

Cycle-pure of Enzyme Digested Insert

Concentration of insert: 25.3ng/μl, 40μl

Ligation with T4 DNA Ligase

Volume/ul	Mass/ng	pmol	Control
2			2
1.4	62	0.02	1.4
1.1	28	0.06	0
14.5			15.6
1			1
20			20

The ligation is from 12:50 to 14:00.

Transformation

14 ^th

Transformation Result

Method	Colonies	Control
Q5	191	0
Gibson	38	7
KOD	0	0
Ligation	1772	330
Positive Control	237

Competent Cell Efficiency

1. Formula: Colonies on plate / ng of DNA plated x 1000 ng/μg

2. Calculation:　237 / 0.02 x 1000=1.185x10⁷ cfu/μg

3. Actual meaning: 20pg,5640bp→3.457x10⁶ copies

4. 457x10⁶ / 237=14586,which means 1 of 14586 vectors would actually grow on the plate.

Ligation Efficiency

1. 62ng,4906bp→1.232x10¹⁰ copies

2. Efficiency=

Mutation Library

1.Q5: 2.782x10⁶

2.Gibson: 5.54x10⁵

3. Ligation:　2.102x10⁷

Repeat the pre-experiment on 09.12

Use enzyme digestion and ligation method to construct mutation library,except that using error-prone PCR,and the target DNA is 500ng.

15 ^th

qPCR Primer Test with Premix and Gel Running

1. Procedure is the same with the experiment on 09.07

2. Results:

2. Conclusion:

I. Primer 1~4 are not good enough,cause they all can match with CHO cell’s gDNA and have PCR products.

II. Primer 2~4 are contaminated.

III. Primer GAPDH has unspecific PCR product,so it can’t be used.

Primer 18sRNA can be used.

18 ^th

Transformation

10μl positive ligation product are transformed with 125ul competent cells.For control group,5ul ligation product are transformed with 50ul competent cells.

qPCR Primer Test with Premix and Gel Running

1. We set 2 annealing temperature,which are 65℃ and 70℃ respectively.

2. Results:

3. Conclusion:

I. Primer 1~4 are all not contaminated and have specific PCR band with annealing temperature of 65℃,while they don’t have PCR product band with annealing temperature of 70℃.

II. Raising annealing temperature can reduce unspecific amplification,while it can also decrease the PCR efficiency and cause Ct increasement.Also we need to verify whether the product band is what we need.

19 ^th

Transformation Result

Colonies	Control
10688	113

1. Mutation library(10ul ligation product)=10688

2. Ligation efficiency=

Pick 20 Single Colony for sequencing

Sequencing Result:

7 out of 20 plasmids have mutation(s) among specific region,in which one has 15 base mutations,one has 2 base mutations,and the rest five have 1 base mutation.

Scrape the Colonies for endofree plasmid purification.

The scraped colonies are cultured for around 9 hours till the OD achieves 2.879,with 150ml Amp.

Concentration: 55ng/μl, 1.75ml

20 ^th

qPCR Primer Test with Premix and Gel Running

1. We set 3 annealing temperature,which are 61℃,62℃ and 63℃ respectively.

2. Results:

21 ^th

CHO cell Genomic DNA Extraction

Positive: GECO+NFAT+Neoloxp

①d1-A10 ②d2-B5 ③d2-B9 ④d1-D3 ⑤d2-E9

⑥d1-F5 ⑦d1-F11 ⑧d1-A9 ⑨d1-B3 ⑩d2-C1

Control: GECO+NFAT

①C4 ②E6 ③F8 ④H10

22 ^th

qPCR Primer Test

Instrument: ABI StepOne Plus qPCR

Kit: TaKaRa-One Step SYBR PrimeScript RT-PCR Kit II

1. Sample:

CHO cell genomic DNA

Positive: transfected with GECO+NFAT+Neoloxp

Negative Control: transfected with GECO+NFAT

Wild Type Control: CHO cell genomic DNA

2. Target:

Neoloxp segment, 18sRNA

3. Standard:

097&Neoloxp plasmid(length:6635bp)

Concentration: 101.2ng/μl

Stock Conc./ng*ul-1	Volume/ul	Dilute Volume/ul
c(101.2)	10	90
c/10	10	90
c/100	10	40
c/500	10	40
..	..	..
dilution point8(1.5)	10	40

4.

Reagent	Volume/ul	Final Conc.	Negative Control
ddH2O	6.4		8.4
2XSYBR® Master Mix	10		10
Forward Primer	0.8	0.4	0.8
Reverse Primer	0.8	0.4	0.8
Template	2		0
Total	20		20

5. Procedure

6. Results

Primer	Ct
Negative Control-2	32
Negative Control-3	29
Negative Control-4	30
Negative Control-18s	32

7. Conclusion

I.Can’t use ‘TaKaRa-One Step SYBR PrimeScript RT-PCR Kit II’,cause our sample is DNA.

II.We forgot to add ‘PrimeScript Enzyme Mix’ at the beginning,which may cause inaccurate results.

III.We forgot to change pipette tips during the dilution,which may bring huge deviation.

IV.Two-step PCR has a low amplification efficiency in our experiment.To increase the efficiency,we need to use three-step PCR.

23 ^th

qPCR Primer Test

Instrument: ABI StepOne Plus qPCR

Kit: TaKaRa-SYBR Premix Ex Taq II(Tli RNaseH Plus)

1. Sample,Target and Standard are the same with the experiment yesterday.

2.

Reagent	Volume/ul
ddH2O	6
SYBR Premix Ex Taq II(2X)	10
Forward Primer	0.8
Reverse Primer	0.8
Template(<100ng)	2
ROX Reference Dye(50X)	0.4
Total	20

3. Procedure

4. Results

Primer	Ct
Negative Control-2	27.8
Negative Control-3	30.7
Negative Control-4	32

Standard	R2	Efficiency
Primer-2	0.9954	116%
Primer-3	0.9993	104%
Primer-4	0.9998	104%

5. Conclusion

Primer 3,4 are similarly efficient,combining with previous experiment result,we choose Primer 3 in the later experiment.

24 ^th

Repeat the mutation experiment on 09.14

1. The targeted mutation segments are 1ng,10ng,100ng respectively.

2. During the first PCR procedure,the annealing temperature is set to be 52℃,which is quite low,so it didn’t work.Then we change it to 57℃.

3. Procedure

Temperature/℃	Duration/seconds	Number of cycles
98	10	1
98	10
55	10
72	60	32
72	120	1
10	∞

Gel Extraction protocol of PCR Product(as Insert)

Target Mass/ng	1	10	100
Conc./ng*ul-1	215.2	208.5	259.5

Each with volume of 30μl.

EcoRI,SacI Restriction Enzyme Digestion for 9 hours

E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol

Target Mass/ng	1	10	100
Conc./ng*ul-1	105	107	113

qPCR Primer Test with Premix and Gel Running

Annealing temperature: 62℃

Conclusion:

I.We can directly see the band’s brightness differences from the gel running result,which may indicate their plasmid copy number differences.Still,we need to do quantitative PCR to get more precise results.

II.It’s strange as well as unreasonable that band appears in wild-type control PCR result,which may indicate that it has been contaminated.

qPCR: 097-gDNA with Primer3

Instrument: ABI StepOne Plus qPCR

Kit: TaKaRa-SYBR Premix Ex Taq II(Tli RNaseH Plus)

Sample: Positive ①②③⑤⑦⑧⑩

Target: Neoloxp

Standard: 097&Neoloxp plasmid-③

2. Reagent and Procedure are the same with the experiment on 09.23.

3. Results

Standard	R2	Efficiency
Primer-3	0.9998	109%

Name	Ct
WT-old	29
WT-1 new	21.6
NC-3	32

Sample	Copy Number
1	19
2	8
3	4
5	5
7	12
8	7
10	5

4. Conclusion

Wild type control(new) may be contaminated.

25 ^th

We find that the synthesized TRPC5 has a problem,which may cause replacement during protein translation,so we need to re-construct TRPC5 plasmid.

Primer Synthesization(send to Invitrogen)

Sequences

Forward Primer: atccGAATTCccctccaaatc(we already have,don’t need to synthesize)

Reverse Primer: tgc tctaga gtg gcccagctgtactacaag

26 ^th

qPCR Primer Verification with Premix and Sequencing

Sequencing Results:

The PCR results are what we need,and the wild-type genomic DNA which were recently extracted are indeed contaminated.

27 ^th

Re-construct TRPC5 Plasmid

TRPC5 PCR with modify-primer

Same procedure as before

Gel Extraction protocol

XbaI,SacI Restriction Enzyme Digestion for Vector and Insert

28 ^th

Gel Extraction protocol for Vector

E.Z.N.A.® Cycle Pure Kit - Centrifugation Protocol for Insert

T4 DNA Ligase(M0202) for 20min

Transformation

After culture for 10 hours:

584x279px

Pick 8 Single Colony and Culture for Sequencing

Sequencing Result:

All correct.

Culture Colonies for endofree plasmid purification.

CHO Cell Genomic DNA Extraction

Positive: GECO+NFAT+Neoloxp

(11)d1-C1 (12)d1-C8 (13)d1-D12 (14)d1-E3 (15)d1-E4

(16)d1-F3 (17)d1-F6 (18)d1-F9 (19)d2-C3 (20)d2-C8

(21)d2-D5

29 ^th

PvuI,NcoI Restriction Enzyme Digestion for Verification

Verification result: All correct.

Oct.

01 ^st

Construct Mutation Library

Vector: TRPC5 digested with EcoRI,SacI,AflII

Insert: ep-PCR segments,with low&medium&high mutation frequency.

Gel Extraction protocol of Enzyme-digested Vector

Ligation for 1 hour

Transformation

5μl ligation product are transformed with 100ul competent cells.

qPCR: 097-gDNA with Primer3

Instrument: ABI StepOne Plus qPCR

Kit: TaKaRa-One Step SYBR PrimeScript RT-PCR Kit I

1. Sample: Positive (3),(11)~(21)

Negative: wild type cho cell gDNA

Target: Neoloxp

Standard: 097&Neoloxp plasmid（ Endofree-① ），289ng/μl

The first and last dilution point are added with 10ng wild-type gDNA,to see its influence on standard curve.

2. Reagent and Procedure are the same with the experiment on 09.23,except that the annealing temperature is set to be 64℃.

3. Results

Standard	R2	Efficiency
Primer-3	0.9998	97%

Name	Ct
WT-old	24
NC-3	29

4. Conclusion

I. The plasmid concentration differs each time,we need to standardize the method for concentration measurement.

II. The primer is not good enough,which may cause inaccurate standard curve and copy number result.

02 ^nd

Scrape the Plate for endofree plasmid purification.

Colonies	Control
104~105	12

Target Mass/ng	1	10	100	500
Conc./ng*ul-1	295.7	271.5	167.6	200.4

Each with volume of 100μl.

CHO Cell Genomic DNA Extraction

Positive: GECO+NFAT+Neoloxp

d2-C6 (23)d2-A5 (24)d2-A8

d2-A9 (26)d1-D10 Wild type: CHO cell’s gDNA All the plasmids’ concentrations are re-measured using NanoDrop.

03 ^rd

qPCR: 097-gDNA with Primer3

Instrument: ABI StepOne Plus qPCR

Kit: TaKaRa-SYBR Premix Ex Taq II(Tli RNaseH Plus)

1. Sample: Positive (3),(22)~(26)

Negative: wild type cho cell gDNA(newly extracted)

Target: Neoloxp

Standard: 097&Neoloxp plasmid（ Endofree-① , 307.8ng/μl

All the dilution points are added with 10ng wild-type gDNA.

2. Reagent and Procedure are the same with the experiment on 09.23,except that the annealing temperature is set to be 64℃.

3. Results

Standard	R2	Efficiency
Primer-3	0.9998	140%

Name	Ct
WT-old	26
NC-3	30

4. Conclusion

I. The standard curve efficiency is 140%,it may result from the adding of wild type gDNA in the preparation of standard point.

II. The Ct of wild type gDNA is 26,which indicates that it has been contaminated.So the copy number results are not precise,we can only compare their differences.